IFI16 Inhibits Porcine Reproductive and Respiratory Syndrome Virus 2 Replication in a MAVS-Dependent Manner in MARC-145 Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Virus
2.2. Antibodies and Reagents
2.3. Plasmids
2.4. Gene Silencing with siRNA
2.5. Quantitative Real-Time PCR Analysis
2.6. Dual Luciferase Reporter Assay
2.7. Co-Immunoprecipitation
2.8. Virus Titration
2.9. Statistical Analysis
3. Results
3.1. IFI16 Inhibits PRRSV-2 Replication
3.2. IFI16 Enhances the MAVS-mediated Type I IFN Signaling
3.3. IFI16 Interacts with MAVS
3.4. Antiviral Activity of IFI16 is Dependent on MAVS
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Nieuwenhuis, N.; Duinhof, T.F.; van Nes, A. Economic analysis of outbreaks of porcine reproductive and respiratory syndrome virus in nine sow herds. Vet. Rec. 2012, 170, 225. [Google Scholar] [CrossRef] [PubMed]
- Pejsak, Z.; Stadejek, T.; Markowska-Daniel, I. Clinical signs and economic losses caused by porcine reproductive and respiratory syndrome virus in a large breeding farm. Vet. Microbiol. 1997, 55, 317–322. [Google Scholar] [CrossRef]
- Albina, E. Epidemiology of porcine reproductive and respiratory syndrome (PRRS): An overview. Vet. Microbiol. 1997, 55, 309–316. [Google Scholar] [CrossRef]
- Cavanagh, D. Nidovirales: A new order comprising Coronaviridae and Arteriviridae. Arch. Virol. 1997, 142, 629–633. [Google Scholar] [PubMed]
- Music, N.; Gagnon, C.A. The role of porcine reproductive and respiratory syndrome (PRRS) virus structural and non-structural proteins in virus pathogenesis. Anim. Health Res. Rev. 2010, 11, 135–163. [Google Scholar] [CrossRef] [Green Version]
- Johnson, C.R.; Griggs, T.F.; Gnanandarajah, J.; Murtaugh, M.P. Novel structural protein in porcine reproductive and respiratory syndrome virus encoded by an alternative ORF5 present in all arteriviruses. J. Gen. Virol. 2011, 92, 1107–1116. [Google Scholar] [CrossRef]
- Allende, R.; Lewis, T.L.; Lu, Z.; Rock, D.L.; Kutish, G.F.; Ali, A.; Doster, A.R.; Osorio, F.A. North American and European porcine reproductive and respiratory syndrome viruses differ in non-structural protein coding regions. J. Gen. Virol. 1999, 80, 307–315. [Google Scholar] [CrossRef]
- Nelsen, C.J.; Murtaugh, M.P.; Faaberg, K.S. Porcine reproductive and respiratory syndrome virus comparison: Divergent evolution on two continents. J. Virol. 1999, 73, 270–280. [Google Scholar]
- Kuhn, J.H.; Lauck, M.; Bailey, A.L.; Shchetinin, A.M.; Vishnevskaya, T.V.; Bao, Y.; Ng, T.F.; LeBreton, M.; Schneider, B.S.; Gillis, A.; et al. Reorganization and expansion of the nidoviral family Arteriviridae. Arch. Virol. 2016, 161, 755–768. [Google Scholar] [CrossRef]
- Adams, M.J.; Lefkowitz, E.J.; King, A.M.; Harrach, B.; Harrison, R.L.; Knowles, N.J.; Kropinski, A.M.; Krupovic, M.; Kuhn, J.H.; Mushegian, A.R.; et al. Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses (2016). Arch. Virol. 2016, 161, 2921–2949. [Google Scholar] [CrossRef] [Green Version]
- Kappes, M.A.; Faaberg, K.S. PRRSV structure, replication and recombination: Origin of phenotype and genotype diversity. Virology 2015, 479–480, 475–486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef] [PubMed]
- Bowie, A.G.; Unterholzner, L. Viral evasion and subversion of pattern-recognition receptor signalling. Nat. Rev. Immunol. 2008, 8, 911–922. [Google Scholar] [CrossRef] [PubMed]
- Nakhaei, P.; Genin, P.; Civas, A.; Hiscott, J. RIG-I-like receptors: Sensing and responding to RNA virus infection. Semin. Immunol. 2009, 21, 215–222. [Google Scholar] [CrossRef] [PubMed]
- Chan, Y.K.; Gack, M.U. Viral evasion of intracellular DNA and RNA sensing. Nat. Rev. Microbiol. 2016, 14, 360–373. [Google Scholar] [CrossRef]
- Ma, Z.; Ni, G.; Damania, B. Innate Sensing of DNA Virus Genomes. Annu. Rev. Virol. 2018, 5, 341–362. [Google Scholar] [CrossRef]
- Schneider, W.M.; Chevillotte, M.D.; Rice, C.M. Interferon-stimulated genes: A complex web of host defenses. Annu. Rev. Immunol. 2014, 32, 513–545. [Google Scholar] [CrossRef] [Green Version]
- Albina, E.; Carrat, C.; Charley, B. Interferon-alpha response to swine arterivirus (PoAV), the porcine reproductive and respiratory syndrome virus. J. Interferon Cytokine Res. 1998, 18, 485–490. [Google Scholar] [CrossRef]
- Overend, C.; Mitchell, R.; He, D.; Rompato, G.; Grubman, M.J.; Garmendia, A.E. Recombinant swine beta interferon protects swine alveolar macrophages and MARC-145 cells from infection with Porcine reproductive and respiratory syndrome virus. J. Gen. Virol. 2007, 88, 925–931. [Google Scholar] [CrossRef]
- Shi, X.; Zhang, X.; Wang, L.; Li, W.; Jiang, B.; Deng, R.; Wang, A.; Zhang, G. Recombinant beta interferon could clear the low-dose infected porcine reproductive and respiratory syndrome virus (PRRSV) in MARC-145 cells. Acta Virol. 2016, 60, 290–297. [Google Scholar] [CrossRef] [Green Version]
- Luo, R.; Fang, L.; Jin, H.; Jiang, Y.; Wang, D.; Chen, H.; Xiao, S. Antiviral activity of type I and type III interferons against porcine reproductive and respiratory syndrome virus (PRRSV). Antivir. Res. 2011, 91, 99–101. [Google Scholar] [CrossRef] [PubMed]
- Bautista, E.M.; Molitor, T.W. IFN gamma inhibits porcine reproductive and respiratory syndrome virus replication in macrophages. Arch Virol. 1999, 144, 1191–1200. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Feng, N.; Li, Z.; Wang, P.; Qi, Z.; Liang, W.; Zhou, X.; Xu, X.; Liu, B. 2′,5′-Oligoadenylate synthetase 1(OAS1) inhibits PRRSV replication in Marc-145 cells. Antivir. Res. 2016, 132, 268–273. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Bai, J.; Fan, B.; Li, Y.; Zhang, Q.; Jiang, P. The Interferon-Induced Mx2 Inhibits Porcine Reproductive and Respiratory Syndrome Virus Replication. J. Interferon Cytokine Res. 2016, 36, 129–139. [Google Scholar] [CrossRef]
- Gariano, G.R.; Dell’Oste, V.; Bronzini, M.; Gatti, D.; Luganini, A.; De Andrea, M.; Gribaudo, G.; Gariglio, M.; Landolfo, S. The intracellular DNA sensor IFI16 gene acts as restriction factor for human cytomegalovirus replication. PLoS Pathog. 2012, 8, e1002498. [Google Scholar] [CrossRef] [Green Version]
- Orzalli, M.H.; DeLuca, N.A.; Knipe, D.M. Nuclear IFI16 induction of IRF-3 signaling during herpesviral infection and degradation of IFI16 by the viral ICP0 protein. Proc. Natl. Acad. Sci. USA 2012, 109, E3008–E3017. [Google Scholar] [CrossRef] [Green Version]
- Jakobsen, M.R.; Paludan, S.R. IFI16: At the interphase between innate DNA sensing and genome regulation. Cytokine Growth Factor Rev. 2014, 25, 649–655. [Google Scholar] [CrossRef]
- Dell’Oste, V.; Gatti, D.; Giorgio, A.G.; Gariglio, M.; Landolfo, S.; De Andrea, M. The interferon-inducible DNA-sensor protein IFI16: A key player in the antiviral response. New Microbiol. 2015, 38, 5–20. [Google Scholar]
- Unterholzner, L.; Keating, S.E.; Baran, M.; Horan, K.A.; Jensen, S.B.; Sharma, S.; Sirois, C.M.; Jin, T.; Latz, E.; Xiao, T.S.; et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 2010, 11, 997–1004. [Google Scholar] [CrossRef] [Green Version]
- Thompson, M.R.; Sharma, S.; Atianand, M.; Jensen, S.B.; Carpenter, S.; Knipe, D.M.; Fitzgerald, K.A.; Kurt-Jones, E.A. Interferon gamma-inducible protein (IFI) 16 transcriptionally regulates type i interferons and other interferon-stimulated genes and controls the interferon response to both DNA and RNA viruses. J. Biol. Chem. 2014, 289, 23568–23581. [Google Scholar] [CrossRef] [Green Version]
- Shi, X.; Wang, L.; Zhi, Y.; Xing, G.; Zhao, D.; Deng, R.; Zhang, G. Porcine reproductive and respiratory syndrome virus (PRRSV) could be sensed by professional beta interferon-producing system and had mechanisms to inhibit this action in MARC-145 cells. Virus Res. 2010, 153, 151–156. [Google Scholar] [CrossRef] [PubMed]
- Chang, X.B.; Yang, Y.Q.; Gao, J.C.; Zhao, K.; Guo, J.C.; Ye, C.; Jiang, C.G.; Tian, Z.J.; Cai, X.H.; Tong, G.Z.; et al. Annexin A2 binds to vimentin and contributes to porcine reproductive and respiratory syndrome virus multiplication. Vet. Res. 2018, 49, 75. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reed, L.J.; Muench, H. A simple method of estimating fifty percent endpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
- Clarke, C.J.; Apostolidis, V.; Hii, L.L.; Gough, D.J.; Trapani, J.A.; Johnstone, R.W. Critical role of the transcription factor AP-1 for the constitutive and interferon-induced expression of IFI 16. J. Cell. Biochem. 2003, 89, 80–93. [Google Scholar] [CrossRef] [PubMed]
- Baggetta, R.; De Andrea, M.; Gariano, G.R.; Mondini, M.; Ritta, M.; Caposio, P.; Cappello, P.; Giovarelli, M.; Gariglio, M.; Landolfo, S. The interferon-inducible gene IFI16 secretome of endothelial cells drives the early steps of the inflammatory response. Eur. J. Immunol. 2010, 40, 2182–2189. [Google Scholar] [CrossRef] [PubMed]
- Dawson, M.J.; Trapani, J.A. IFI 16 gene encodes a nuclear protein whose expression is induced by interferons in human myeloid leukaemia cell lines. J. Cell. Biochem. 1995, 57, 39–51. [Google Scholar] [CrossRef] [PubMed]
- Orzalli, M.H.; Broekema, N.M.; Diner, B.A.; Hancks, D.C.; Elde, N.C.; Cristea, I.M.; Knipe, D.M. cGAS-mediated stabilization of IFI16 promotes innate signaling during herpes simplex virus infection. Proc. Natl. Acad. Sci. USA 2015, 112, E1773–E1781. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xie, S.; Chen, X.X.; Qiao, S.; Li, R.; Sun, Y.; Xia, S.; Wang, L.J.; Luo, X.; Deng, R.; Zhou, E.M.; et al. Identification of the RNA Pseudoknot within the 3′ End of the Porcine Reproductive and Respiratory Syndrome Virus Genome as a Pathogen-Associated Molecular Pattern To Activate Antiviral Signaling via RIG-I and Toll-Like Receptor 3. J. Virol. 2018, 92. [Google Scholar] [CrossRef] [Green Version]
- Rehwinkel, J.; Tan, C.P.; Goubau, D.; Schulz, O.; Pichlmair, A.; Bier, K.; Robb, N.; Vreede, F.; Barclay, W.; Fodor, E.; et al. RIG-I detects viral genomic RNA during negative-strand RNA virus infection. Cell 2010, 140, 397–408. [Google Scholar] [CrossRef] [Green Version]
- Baum, A.; Sachidanandam, R.; Garcia-Sastre, A. Preference of RIG-I for short viral RNA molecules in infected cells revealed by next-generation sequencing. Proc. Natl. Acad. Sci. USA 2010, 107, 16303–16308. [Google Scholar] [CrossRef] [Green Version]
- Seth, R.B.; Sun, L.; Ea, C.K.; Chen, Z.J. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell 2005, 122, 669–682. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Belgnaoui, S.M.; Paz, S.; Hiscott, J. Orchestrating the interferon antiviral response through the mitochondrial antiviral signaling (MAVS) adapter. Curr. Opin. Immunol. 2011, 23, 564–572. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Zhu, C.; Wang, T.; Jiang, H.; Ren, Y.; Zhang, Q.; Wu, K.; Liu, F.; Liu, Y.; Wu, J. GP73 represses host innate immune response to promote virus replication by facilitating MAVS and TRAF6 degradation. PLoS Pathog. 2017, 13, e1006321. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lo Cigno, I.; De Andrea, M.; Borgogna, C.; Albertini, S.; Landini, M.M.; Peretti, A.; Johnson, K.E.; Chandran, B.; Landolfo, S.; Gariglio, M. The Nuclear DNA Sensor IFI16 Acts as a Restriction Factor for Human Papillomavirus Replication through Epigenetic Modifications of the Viral Promoters. J. Virol. 2015, 89, 7506–7520. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, H.; Gonzalezgugel, E.; Cheng, L.; Richbourgh, B.; Nie, L.; Liu, C. The roles of interferon-inducible p200 family members IFI16 and p204 in innate immune responses, cell differentiation and proliferation. Genes Dis. 2015, 2, 46–56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liao, J.C.; Lam, R.; Brazda, V.; Duan, S.; Ravichandran, M.; Ma, J.; Xiao, T.; Tempel, W.; Zuo, X.; Wang, Y.X.; et al. Interferon-inducible protein 16: Insight into the interaction with tumor suppressor p53. Structure 2011, 19, 418–429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martinez-Gil, L.; Goff, P.H.; Hai, R.; Garcia-Sastre, A.; Shaw, M.L.; Palese, P. A Sendai virus-derived RNA agonist of RIG-I as a virus vaccine adjuvant. J. Virol. 2013, 87, 1290–1300. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Almine, J.F.; O’Hare, C.A.; Dunphy, G.; Haga, I.R.; Naik, R.J.; Atrih, A.; Connolly, D.J.; Taylor, J.; Kelsall, I.R.; Bowie, A.G.; et al. IFI16 and cGAS cooperate in the activation of STING during DNA sensing in human keratinocytes. Nat. Commun. 2017, 8, 14392. [Google Scholar] [CrossRef]
- Ishikawa, H.; Barber, G.N. STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling. Nature 2008, 455, 674–678. [Google Scholar] [CrossRef]
- Zhong, B.; Yang, Y.; Li, S.; Wang, Y.Y.; Li, Y.; Diao, F.; Lei, C.; He, X.; Zhang, L.; Tien, P.; et al. The adaptor protein MITA links virus-sensing receptors to IRF3 transcription factor activation. Immunity 2008, 29, 538–550. [Google Scholar] [CrossRef] [Green Version]
- Brunette, R.L.; Young, J.M.; Whitley, D.G.; Brodsky, I.E.; Malik, H.S.; Stetson, D.B. Extensive evolutionary and functional diversity among mammalian AIM2-like receptors. J. Exp. Med. 2012, 209, 1969–1983. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zevini, A.; Olagnier, D.; Hiscott, J. Crosstalk between Cytoplasmic RIG-I and STING Sensing Pathways. Trends Immunol. 2017, 38, 194–205. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primers | Sequences (5′ to 3′) |
---|---|
IFI16-F | CGCGGATCCATGGAAAAAAAATACAAGAACATTG |
IFI16-R | CCGCTCGAGTTAGAAGAAAAAGCCTGGTGAAGTT |
RIG-I-F | TCCCCCCGGGCATGACTACGGAGCAGCGGCGCAGCCT |
RIG-I-R | ATCTGTCGACTCATTTGGCCATTTCTGCTGGAT |
MDA5-F | CGCGGATCCATGTCGAATGGGTATTCCACAGAC |
MDA5-R | CCGCTCGAGCTAATCCTCATCACTAAATAAACAGCA |
MAVS-F | CCCAAGCTTATGCCGTTTGCTGAAGACAAGACCT |
MAVS-R | CCGCTCGAGCTAGTGCAGGCGCCGCCGGTACATC |
IRF3-F | CCCAAGCTTATGGGAACCCCAAAGCCACGGAT |
IRF3-R | CCGCTCGAGTCAGGTCTCCCCAGGGCCCTGGAA |
TBK1-F | CGCGGATCCATGCAGAGCACTTCTAATCATCT |
TBK1-R | CCGCTCGAGCTAAAGACAGTCAACGTTGCGA |
MAVS-1-F | CCCAAGCTTATGCCGTTTGCTGAAGACAAGACCT |
MAVS-1-R | CGGGGTACCCTAGTGGCATGGCCCCTCCCTCT |
MAVS-2-F | CCCAAGCTTATGTACCAGCCTCGGACCTCGGAC |
MAVS-2-R | CGGGGTACCCTAGTGCAGGCGCCGCCGGTACATC |
MAVS-3-F | CCCAAGCTTATGTCCTCTGACCTGGCAGCCCTC |
MAVS-3-R | CGGGGTACCCTAGTGCAGGCGCCGCCGGTACATC |
Primers | Sequences (5′ to 3′) | Amplicon Size | Final Concentration |
---|---|---|---|
ORF7-F | AAACCAGTCCAGAGGCAAGG | 221 | 0.3 µM |
ORF7-R | GCAAACTAAACTCCACAGTGTAA | ||
IFI16-F | TGTGAATGGGGTGTTTGAGGT | 169 | 0.3 µM |
IFI16-R | CGGTGCCAATTCAAAGCAGG | ||
IFN-β-F | ACGGCTCTTTCCATGAGCTAC | 185 | 0.3 µM |
IFN-β-R | GTCAATGCAGCGTCCTCCTT | ||
ISG15-F | CTGAAGGCAAAGATCGCCCA | 186 | 0.3 µM |
ISG15-R | GTCGTTCCTCACCAGGATGC | ||
ISG56-F | AGGAAACACCCACTTCGGTC | 100 | 0.3 µM |
ISG56-R | CCTCTAGGCTGCCCTTTTGT | ||
MAVS-F | CTGCCTCACAGCAAGAGACCA | 181 | 0.3 µM |
MAVS-R | GTAGACACAGGCCACTTCGTC | ||
GAPDH-F | GAAGGTGAAGGTCGGAGTCA | 133 | 0.3 µM |
GAPDH-R | CATGTAAACCATGTAGTTGAGGTC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chang, X.; Shi, X.; Zhang, X.; Wang, L.; Li, X.; Wang, A.; Deng, R.; Zhou, E.; Zhang, G. IFI16 Inhibits Porcine Reproductive and Respiratory Syndrome Virus 2 Replication in a MAVS-Dependent Manner in MARC-145 Cells. Viruses 2019, 11, 1160. https://doi.org/10.3390/v11121160
Chang X, Shi X, Zhang X, Wang L, Li X, Wang A, Deng R, Zhou E, Zhang G. IFI16 Inhibits Porcine Reproductive and Respiratory Syndrome Virus 2 Replication in a MAVS-Dependent Manner in MARC-145 Cells. Viruses. 2019; 11(12):1160. https://doi.org/10.3390/v11121160
Chicago/Turabian StyleChang, Xiaobo, Xibao Shi, Xiaozhuan Zhang, Li Wang, Xuewu Li, Aiping Wang, Ruiguang Deng, Enmin Zhou, and Gaiping Zhang. 2019. "IFI16 Inhibits Porcine Reproductive and Respiratory Syndrome Virus 2 Replication in a MAVS-Dependent Manner in MARC-145 Cells" Viruses 11, no. 12: 1160. https://doi.org/10.3390/v11121160