1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Cells
2.3. Virus Infection
2.4. Isolation of RNA and Proteins
2.5. Quantitative Reverse Transcription-PCR
2.6. Western Blot Analysis
2.7. Analysis of Inflammatory Cytokines
2.8. Immunohistochemistry (IHC)
2.9. Statistical Analysis
3. Results
3.1. MERS-CoV Infection Induced Pyroptosis in THP-1 Macrophages
3.2. Pyroptosis in Mice Infected with MERS-CoV
3.3. Inflammatory Responses in Mice Infected with MERS-CoV
3.4. MERS-CoV Infection Alters Expression of Complement in THP-1 Monocytes and Macrophages
3.5. Inhibiting C5aR1 Reduces Pyroptosis in Mice Infected with MERS-CoV
3.6. Inhibiting C5aR1 Reduces Inflammation in Mice Infected with MERS-CoV
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Arabi, Y.M.; Arifi, A.A.; Balkhy, H.H.; Najm, H.; Aldawood, A.S.; Ghabashi, A.; Hawa, H.; Alothman, A.; Khaldi, A.; Al Raiy, B. Clinical course and outcomes of critically ill patients with Middle East respiratory syndrome coronavirus infection. Ann. Intern. Med. 2014, 160, 389–397. [Google Scholar] [CrossRef]
- Assiri, A.; Al-Tawfiq, J.A.; Al-Rabeeah, A.A.; Al-Rabiah, F.A.; Al-Hajjar, S.; Al-Barrak, A.; Flemban, H.; Al-Nassir, W.N.; Balkhy, H.H.; Al-Hakeem, R.F.; et al. Epidemiological, demographic, and clinical characteristics of 47 cases of Middle East respiratory syndrome coronavirus disease from Saudi Arabia: A descriptive study. Lancet. Infect. Dis. 2013, 13, 752–761. [Google Scholar] [CrossRef]
- Al-Abdallat, M.M.; Payne, D.C.; Alqasrawi, S.; Rha, B.; Tohme, R.A.; Abedi, G.R.; Al Nsour, M.; Iblan, I.; Jarour, N.; Farag, N.H.; et al. Hospital-associated outbreak of Middle East respiratory syndrome coronavirus: A serologic, epidemiologic, and clinical description. Clin. Infect. Dis. 2014, 59, 1225–1233. [Google Scholar] [CrossRef] [PubMed]
- Vande Walle, L.; Lamkanfi, M. Pyroptosis. Curr. Biol. 2016, 26, R568–R572. [Google Scholar] [CrossRef] [PubMed]
- Kanneganti, T.D.; Body-Malapel, M.; Amer, A.; Park, J.H.; Whitfield, J.; Franchi, L.; Taraporewala, Z.F.; Miller, D.; Patton, J.T.; Inohara, N.; et al. Critical role for Cryopyrin/Nalp3 in activation of caspase-1 in response to viral infection and double-stranded RNA. J. Biol. Chem. 2006, 281, 36560–36568. [Google Scholar] [CrossRef] [PubMed]
- Joly, S.; Sutterwala, F.S. Fungal pathogen recognition by the NLRP3 inflammasome. Virulence 2010, 1, 276–280. [Google Scholar] [CrossRef][Green Version]
- Mariathasan, S.; Weiss, D.S.; Newton, K.; McBride, J.; O’Rourke, K.; Roose-Girma, M.; Lee, W.P.; Weinrauch, Y.; Monack, D.M.; Dixit, V.M. Cryopyrin activates the inflammasome in response to toxins and ATP. Nature 2006, 440, 228–232. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Shaw, O.M.; Steiger, S.; Liu, X.; Hamilton, J.A.; Harper, J.L. Brief report: Granulocyte-macrophage colony-stimulating factor drives monosodium urate monohydrate crystal-induced inflammatory macrophage differentiation and NLRP3 inflammasome up-regulation in an in vivo mouse model. Arthritis Rheumatol. 2014, 66, 2423–2428. [Google Scholar] [CrossRef]
- Dostert, C.; Petrilli, V.; Van Bruggen, R.; Steele, C.; Mossman, B.T.; Tschopp, J. Innate immune activation through Nalp3 inflammasome sensing of asbestos and silica. Science 2008, 320, 674–677. [Google Scholar] [CrossRef]
- Ding, J.; Wang, K.; Liu, W.; She, Y.; Sun, Q.; Shi, J.; Sun, H.; Wang, D.C.; Shao, F. Pore-forming activity and structural autoinhibition of the gasdermin family. Nature 2016, 535, 111–116. [Google Scholar] [CrossRef]
- Schroder, K.; Tschopp, J. The inflammasomes. Cell 2010, 140, 821–832. [Google Scholar] [CrossRef] [PubMed]
- Al-Sharif, W.Z.; Sunyer, J.O.; Lambris, J.D.; Smith, L.C. Sea urchin coelomocytes specifically express a homologue of the complement component C3. J. Immunol. 1998, 160, 2983–2997. [Google Scholar] [PubMed]
- Levashina, E.A.; Moita, L.F.; Blandin, S.; Vriend, G.; Lagueux, M.; Kafatos, F.C. Conserved role of a complement-like protein in phagocytosis revealed by dsRNA knockout in cultured cells of the mosquito, Anopheles gambiae. Cell 2001, 104, 709–718. [Google Scholar] [CrossRef]
- Peng, Q.; Li, K.; Sacks, S.H.; Zhou, W. The role of anaphylatoxins C3a and C5a in regulating innate and adaptive immune responses. Inflamm. Allergy Drug Targets 2009, 8, 236–246. [Google Scholar] [CrossRef] [PubMed]
- DiScipio, R.G.; Schraufstatter, I.U. The role of the complement anaphylatoxins in the recruitment of eosinophils. Int. Immunopharmacol. 2007, 7, 1909–1923. [Google Scholar] [CrossRef]
- Jiang, Y.; Zhao, G.; Song, N.; Li, P.; Chen, Y.; Guo, Y.; Li, J.; Du, L.; Jiang, S.; Guo, R.; et al. Blockade of the C5a-C5aR axis alleviates lung damage in hDPP4-transgenic mice infected with MERS-CoV. Emerg. Microbes Infect. 2018, 7, 77. [Google Scholar] [CrossRef] [PubMed]
- Zhao, G.; Jiang, Y.; Qiu, H.; Gao, T.; Zeng, Y.; Guo, Y.; Yu, H.; Li, J.; Kou, Z.; Du, L.; et al. Multi-Organ Damage in Human Dipeptidyl Peptidase 4 Transgenic Mice Infected with Middle East Respiratory Syndrome-Coronavirus. PLoS ONE 2015, 10, e0145561. [Google Scholar] [CrossRef]
- Zhou, J.; Chu, H.; Li, C.; Wong, B.H.; Cheng, Z.S.; Poon, V.K.; Sun, T.; Lau, C.C.; Wong, K.K.; Chan, J.Y.; et al. Active replication of Middle East respiratory syndrome coronavirus and aberrant induction of inflammatory cytokines and chemokines in human macrophages: Implications for pathogenesis. J. Infect. Dis. 2014, 209, 1331–1342. [Google Scholar] [CrossRef]
- Wang, W.; Xiao, F.; Wan, P.; Pan, P.; Zhang, Y.; Liu, F.; Wu, K.; Liu, Y.; Wu, J. EV71 3D Protein Binds with NLRP3 and Enhances the Assembly of Inflammasome Complex. PLoS Pathog. 2017, 13, e1006123. [Google Scholar] [CrossRef]
- Allen, I.C.; Scull, M.A.; Moore, C.B.; Holl, E.K.; McElvania-TeKippe, E.; Taxman, D.J.; Guthrie, E.H.; Pickles, R.J.; Ting, J.P. The NLRP3 inflammasome mediates in vivo innate immunity to influenza A virus through recognition of viral RNA. Immunity 2009, 30, 556–565. [Google Scholar] [CrossRef]
- Ren, R.; Wu, S.; Cai, J.; Yang, Y.; Ren, X.; Feng, Y.; Chen, L.; Qin, B.; Xu, C.; Yang, H.; et al. The H7N9 influenza A virus infection results in lethal inflammation in the mammalian host via the NLRP3-caspase-1 inflammasome. Sci. Rep. 2017, 7, 7625. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Wang, W.; Li, G.; De, W.; Luo, Z.; Pan, P.; Tian, M.; Wang, Y.; Xiao, F.; Li, A.; Wu, K.; et al. Zika virus infection induces host inflammatory responses by facilitating NLRP3 inflammasome assembly and interleukin-1beta secretion. Nat. Commun. 2018, 9, 106. [Google Scholar] [CrossRef] [PubMed]
- Dinarello, C.A. Immunological and inflammatory functions of the interleukin-1 family. Annu. Rev. Immunol. 2009, 27, 519–550. [Google Scholar] [CrossRef] [PubMed]
- Guery, B.; Poissy, J.; el Mansouf, L.; Sejourne, C.; Ettahar, N.; Lemaire, X.; Vuotto, F.; Goffard, A.; Behillil, S.; Enouf, V.; et al. Clinical features and viral diagnosis of two cases of infection with Middle East Respiratory Syndrome coronavirus: A report of nosocomial transmission. Lancet 2013, 381, 2265–2272. [Google Scholar] [CrossRef]
- Hajishengallis, G.; Lambris, J.D. Crosstalk pathways between Toll-like receptors and the complement system. Trends Immunol. 2010, 31, 154–163. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Samstad, E.O.; Niyonzima, N.; Nymo, S.; Aune, M.H.; Ryan, L.; Bakke, S.S.; Lappegard, K.T.; Brekke, O.L.; Lambris, J.D.; Damas, J.K.; et al. Cholesterol crystals induce complement-dependent inflammasome activation and cytokine release. J. Immunol. 2014, 192, 2837–2845. [Google Scholar] [CrossRef] [PubMed]
- Liszewski, M.K.; Kolev, M.; Le Friec, G.; Leung, M.; Bertram, P.G.; Fara, A.F.; Subias, M.; Pickering, M.C.; Drouet, C.; Meri, S.; et al. Intracellular complement activation sustains T cell homeostasis and mediates effector differentiation. Immunity 2013, 39, 1143–1157. [Google Scholar] [CrossRef]
- Asgari, E.; Le Friec, G.; Yamamoto, H.; Perucha, E.; Sacks, S.S.; Kohl, J.; Cook, H.T.; Kemper, C. C3a modulates IL-1beta secretion in human monocytes by regulating ATP efflux and subsequent NLRP3 inflammasome activation. Blood 2013, 122, 3473–3481. [Google Scholar] [CrossRef]
- Gerard, N.P.; Gerard, C. The chemotactic receptor for human C5a anaphylatoxin. Nature 1991, 349, 614–617. [Google Scholar] [CrossRef]
- Gao, H.; Neff, T.A.; Guo, R.F.; Speyer, C.L.; Sarma, J.V.; Tomlins, S.; Man, Y.; Riedemann, N.C.; Hoesel, L.M.; Younkin, E.; et al. Evidence for a functional role of the second C5a receptor C5L2. FASEB J. 2005, 19, 1003–1005. [Google Scholar] [CrossRef]
- Gerard, N.P.; Lu, B.; Liu, P.; Craig, S.; Fujiwara, Y.; Okinaga, S.; Gerard, C. An anti-inflammatory function for the complement anaphylatoxin C5a-binding protein, C5L2. J. Biol. Chem. 2005, 280, 39677–39680. [Google Scholar] [CrossRef] [PubMed]
- Morgan, B.P.; Gasque, P. Extrahepatic complement biosynthesis: Where, when and why? Clin. Exp. Immunol. 1997, 107, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Gu, J.; Gong, E.; Zhang, B.; Zheng, J.; Gao, Z.; Zhong, Y.; Zou, W.; Zhan, J.; Wang, S.; Xie, Z.; et al. Multiple organ infection and the pathogenesis of SARS. J. Exp. Med. 2005, 202, 415–424. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Doitsh, G.; Galloway, N.L.; Geng, X.; Yang, Z.; Monroe, K.M.; Zepeda, O.; Hunt, P.W.; Hatano, H.; Sowinski, S.; Munoz-Arias, I.; et al. Cell death by pyroptosis drives CD4 T-cell depletion in HIV-1 infection. Nature 2014, 505, 509–514. [Google Scholar] [CrossRef] [PubMed][Green Version]
- McAuley, J.L.; Tate, M.D.; MacKenzie-Kludas, C.J.; Pinar, A.; Zeng, W.; Stutz, A.; Latz, E.; Brown, L.E.; Mansell, A. Activation of the NLRP3 inflammasome by IAV virulence protein PB1-F2 contributes to severe pathophysiology and disease. PLoS Pathog. 2013, 9, e1003392. [Google Scholar] [CrossRef] [PubMed]
- Pinar, A.; Dowling, J.K.; Bitto, N.J.; Robertson, A.A.; Latz, E.; Stewart, C.R.; Drummond, G.R.; Cooper, M.A.; McAuley, J.L.; Tate, M.D.; et al. PB1-F2 Peptide Derived from Avian Influenza A Virus H7N9 Induces Inflammation via Activation of the NLRP3 Inflammasome. J. Biol. Chem. 2017, 292, 826–836. [Google Scholar] [CrossRef]
- Yao, S.T.; Cao, F.; Chen, J.L.; Chen, W.; Fan, R.M.; Li, G.; Zeng, Y.C.; Jiao, S.; Xia, X.P.; Han, C.; et al. NLRP3 is Required for Complement-Mediated Caspase-1 and IL-1beta Activation in ICH. J. Mol. Neurosci. 2017, 61, 385–395. [Google Scholar] [CrossRef]
- Arbore, G.; West, E.E.; Spolski, R.; Robertson, A.A.B.; Klos, A.; Rheinheimer, C.; Dutow, P.; Woodruff, T.M.; Yu, Z.X.; O’Neill, L.A.; et al. T helper 1 immunity requires complement-driven NLRP3 inflammasome activity in CD4(+) T cells. Science 2016, 352. [Google Scholar] [CrossRef]
- Reichhardt, M.P.; Meri, S. Intracellular complement activation-An alarm raising mechanism? Semin. Immunol. 2018. [Google Scholar] [CrossRef]
- Zhang, Y.; Liu, F.; Yuan, Y.; Jin, C.; Chang, C.; Zhu, Y.; Zhang, X.; Tian, C.; He, F.; Wang, J. Inflammasome-Derived Exosomes Activate NF-kappaB Signaling in Macrophages. J. Proteome Res. 2017, 16, 170–178. [Google Scholar] [CrossRef]
- Mebius, R.E.; Kraal, G. Structure and function of the spleen. Nat. Rev. Immunol. 2005, 5, 606–616. [Google Scholar] [CrossRef] [PubMed]







Primer | Species | Gene | Orientation | Sequence (5′-3′) |
---|---|---|---|---|
1 | Human | NLRP3 | F | ATTCGGAGATTGTGGTTGGG |
R | AGGGCGTTGTCACTCAGGTC | |||
2 | pro-caspase-1 | F | CTCAGGCTCAGAAGGGAATGTC | |
R | TGTGCGGCTTGACTTGTCC | |||
3 | pro-IL-1b | F | GCTCGCCAGTGAAATGATGG | |
R | CAGAGGGCAGAGGTCCAGG | |||
4 | C3 | F | CACTATGATCCTTGAGATCTGTACCA | |
R | GGAGCAAAGCCAGTCATCA | |||
5 | C3aR | F | GACATCCAGGTGCTGAAGCC | |
R | ACTGGGGGCTCATTCCATG | |||
6 | C5aR1 | F | GCTGACCATACCCTCCTTCCT | |
R | CCGTTTGTCGTGGCTGTAGTC | |||
7 | C5aR2 | F | TGCTGTTTGTCTCTGCCCATC | |
R | GTCAGCAGGATGATGGAGGG | |||
8 | Mouse | pro-caspase-1 | F | AATGAAGTTGCTGCTGGAGGA |
R | CAGAAGTCTTGTGCTCTGGGC | |||
9 | pro-IL-1b | F | TGGACCTTCCAGGATGAGGACA | |
R | GTTCATCTCGGAGCCTGTAGTG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).