Microsatellite Markers as a Useful Tool for Species Identification and Assessment of Genetic Diversity of the Endangered Species Populus nigra L. in the Czech Republic
Abstract
1. Introduction
2. Materials and Methods
Analyses of Microsatellite Markers
3. Results
3.1. Evaluation of Genetic Diversity of Poplar Trees and Detection of Possible Hybrids
3.2. Evaluation of Genetic Diversity Among Selected 337 Black Poplar Genotypes
3.3. Genetic Characteristics of Microsatellite Markers
3.4. Genetic Differences Among Poplar Species and Hybrids
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Čížková, L.; Barnet, P.; Máchová, P. Využití topolu šedého jako náhrady jasanu a olše při obnově zejména lužních lesů (The use of grey poplar as a substitute for ash and alder in the restoration of floodplain forests). Lesn. Průvodce 2018, 3, 27. [Google Scholar]
- Hejný, S.; Slavík, B. Květena České Republiky, 2nd ed.; Academia: Praha, Czech Republic, 1990; p. 540. [Google Scholar]
- Úradníček, L.; Maděra, P.; Tichá, S.; Koblížek, J. Dřeviny České republiky; Lesnická práce, s.r.o.: Kostelec nad Černými lesy, Czech Republic, 2009; p. 367. [Google Scholar]
- Heinze, B. Genetic traces of cultivated hybrid poplars in the offspring of native Populus nigra in Austria. Preslia 2008, 80, 365–374. [Google Scholar]
- Smulders, M.J.M.; Cottrell, J.E.; Lefèvre, F.; Van der Schoot, J.; Arens, P.; Vosman, B.; Tabbener, H.E.; Grassi, F.; Fossati, T.; Castiglione, S.; et al. Structure of the genetic diversity in black poplar (Populus nigra L.) populations across European river systems: Consequences for conservation and restoration. For. Ecol. Manag. 2008, 255, 1388–1399. [Google Scholar] [CrossRef] [Scilit]
- Čortan, D.; Schroeder, H.; Šijačić-Nikolić, M.; Wehenkel, C.; Fladung, M. Genetic structure of remnant black poplar (Populus nigra L.) populations along biggest rivers in Serbia assessed by SSR markers. Silvae Genet. 2016, 65, 12–19. [Google Scholar] [CrossRef] [Scilit]
- Booy, G.; Hendriks, R.J.J.; Smulders, M.J.M.; Van Groenendael, J.M.; Vosman, B. Genetic diversity and the survival of populations. Plant Biol. 2000, 2, 379–395. [Google Scholar] [CrossRef] [Scilit]
- Vanden Broeck, A.; Storme, V.; Cottrell, J.E.; Boerjan, W.; Van Bockstaele, E.; Quataert, P.; Van Slycken, J. Gene flow between cultivated poplars and native black poplar (Populus nigra L.): A case study along the river Meuse on the Dutch-Belgian border. For. Ecol. Manag. 2004, 197, 307–310. [Google Scholar] [CrossRef] [Scilit]
- Smulders, M.J.M.; Beringen, R.; Volosyanchuk, R.; Vanden Broeck, A.; Van der Schoot, J.; Arens, P.; Vosman, B. Natural hybridisation between Populus nigra L. and P. × canadensis Moench. Hybrid offspring competes for niches along the Rhine river in the Netherlands. Tree Genet. Genomes 2008, 4, 663–675. [Google Scholar] [CrossRef] [Scilit]
- Uluğ, A. Detection and confirmation of diagnostic microsatellite loci in Populus nigra and Populus deltoides to identify their hybrids (P. × canadensis). Turk. J. Bot. 2022, 46, 603–613. [Google Scholar] [CrossRef] [Scilit]
- Fossati, T.; Grassi, F.; Sala, F.; Castiglione, S.S. Molecular analysis of natural populations of Populus nigra L. intermingled with cultivated hybrids. Mol. Ecol. 2003, 12, 2033–2043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rathmacher, G.; Niggemann, M.; Köhnen, M.; Ziegenhagen, B.; Bialozyt, R. Short-distance gene flow in Populus nigra L. accounts for small-scale spatial genetic structures: Implications for in situ conservation measures. Conserv. Genet. 2010, 11, 1327–1338. [Google Scholar] [CrossRef] [Scilit]
- Khasa, D.; Nadeem, S.; Thomas, B.; Robertson, A.; Bousquet, J. Application of SSR markers for parentage analysis of Populus clones. For. Genet. 2003, 10, 273–281. [Google Scholar]
- Rathmacher, G.; Niggemann, M.; Wypukol, H.; Gebhardt, K.; Ziegenhagen, B.; Bialozyt, R. Allelic ladders and reference genotypes for a rigorous standardization of poplar microsatellite data. Trees 2009, 23, 573–583. [Google Scholar] [CrossRef] [Scilit]
- Liesebach, H.; Schneck, V.; Ewald, E. Clonal fingerprinting in the genus Populus L. by nuclear microsatellite loci regarding differences between sections, species and hybrids. Tree Genet. Genomes 2010, 6, 259–269. [Google Scholar] [CrossRef] [Scilit]
- Van der Schoot, J.; Pospíšková, M.; Vosman, B.; Smulders, M.J.M. Development and characterization of microsatellite markers in black poplar (Populus nigra L.). Theor. Appl. Genet. 2000, 101, 317–322. [Google Scholar] [CrossRef] [Scilit]
- Smulders, M.J.M.; Van der Schoot, J.; Arens, P.; Vosman, B. Trinucleotide repeat microsatellite markers for black poplar (Populus nigra L.). Mol. Ecol. Notes 2001, 1, 188–190. [Google Scholar] [CrossRef] [Scilit]
- Khasa, D.; Pollefeys, P.; Navarro-Quezada, A.; Perinet, P.; Bousquet, J. Species-specific microsatellite markers to monitor gene flow between exotic poplars and their natural relatives in eastern North America. Mol. Ecol. Notes 2005, 5, 920–923. [Google Scholar] [CrossRef] [Scilit]
- Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef] [Scilit]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Scilit]
- Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef] [Scilit]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [Scilit]
- Falush, D.; Stephens, M.; Pritchard, J.K. Inference of population structure using multilocus genotype data: Linked loci and correlated allele frequencies. Genetics 2003, 164, 1567–1587. [Google Scholar] [CrossRef] [Scilit]
- Falush, D.; Stephens, M.; Pritchard, J.K. Inference of population structure using multilocus genotype data: Dominant markers and null alleles. Mol. Ecol. 2007, 7, 574–578. [Google Scholar] [CrossRef] [Scilit]
- Hubisz, M.J.; Falush, D.; Stephens, M.; Pritchard, J.K. Inferring weak population structure with the assistance of sample group information. Mol. Ecol. Resour. 2009, 9, 1322–1332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.L.; Liu, J.X. StructureSelector: A web based software to select and visualize the optimal number of clusters using multiple methods. Mol. Ecol. Resour. 2018, 18, 176–177. [Google Scholar] [CrossRef] [Scilit]
- Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. CLUMPAK: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef] [Scilit]
- Čížková, L.; Cvrčková, H.; Máchová, P. Možnosti využití domácích druhů rodu Populus v lesnické praxi (Possibilities for the use of native Populus species in forestry practice). Lesn. Průvodce 2020, 2, 33. [Google Scholar]
- Vanden Broeck, A. EUFORGEN Technical Guidelines for Genetic Conservation and Use for European Black Poplar (Populus nigra); International Plant Genetic Resources Institute: Rome, Italy, 2003; p. 6. [Google Scholar]
- De-Lucas, A.I.; Santana, J.C.; Recio, P.; Hidalgo, E. SSR-based tool for identification and certification of commercial Populus clones in Spain. Ann. For. Sci. 2008, 65, 107. [Google Scholar] [CrossRef] [Scilit]
- Ziegenhagen, B.; Gneuss, S.; Rathmacher, G.; Leyer, I.; Bialozyt, R.; Heinze, B.; Liepelt, S. A fast and simple genetic survey reveals the spread of poplar hybrids at natural Elbe river site. Conserv. Genet. 2008, 9, 373–379. [Google Scholar] [CrossRef] [Scilit]
- Chenault, N.; Arnaud-Haond, S.; Juteau, M.; Valade, R.; Almeida, J.-L.; Villar, M.; Bastien, C.; Dowkiw, A. SSR-based analysis of clonality, spatial genetic structure and introgression from the Lombardy poplar into a natural population of Populus nigra L. along the Loire River. Tree Genet. Genomes 2011, 7, 1249–1262. [Google Scholar] [CrossRef] [Scilit]
- Holub, J.; Procházka, F. Red List of vascular plants of the Czech Republic—2000. Preslia 2000, 72, 187–230. [Google Scholar]
- Pospíšková, M.; Šálková, I. Population structure and parentage analysis of black poplar along the Morava River. Can. J. For. Res. 2006, 36, 1067–1076. [Google Scholar] [CrossRef] [Scilit]
- Wójkiewicz, B.; Lewandowski, A.; Żukowska, W.B.; Litkowiec, M.; Wachowiak, W. Low effective population size and high spatial genetic structure of black poplar populations from the Oder valley in Poland. Ann. For. Sci. 2021, 78, 37. [Google Scholar] [CrossRef] [Scilit]
- Tröber, U.; Wolf, H. Erhaltung der Schwarz–Pappel (Populus nigra L.) in Sachsen: Erfassung, Charakterisierung und Vermehrung auf genetischer Grundlage. Forstarchiv 2015, 86, 166–173. [Google Scholar]
- Ciftci, A.; Karatay, H.; Küçükosmanoğlu, F.; Karahan, A.; Kaya, Z. Genetic differentiation between clone collections and natural populations of European black poplar (Populus nigra L.) in Turkey. Tree Genet. Genomes 2017, 13, 69. [Google Scholar] [CrossRef] [Scilit]
- Pospíšková, M.; Bartáková, I. Genetic diversity of a black poplar population in the Morava river basin assessed by microsatellite analysis. For. Genet. 2004, 11, 257–262. [Google Scholar]
- Żukowska, W.B.; Lewandowski, A. Genetic structure and divergence of marginal populations of black poplar (Populus nigra L.) in Poland. Sci. Rep. 2025, 15, 3014. [Google Scholar] [CrossRef] [Scilit]





| Microsatellite Loci | WPMS09 | WPMS18 | PMGC14 | PMGC2163 | PMGC456 | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| Reference Samples | Allele Sizes (bp) | Allele Sizes (bp) | Allele Sizes (bp) | Allele Sizes (bp) | Allele Sizes (bp) | |||||
| P.d._01 | 232 | 232 | 214 | 214 | 190 | 190 | 185 | 185 | 82 | 82 |
| P.d._02 | 232 | 232 | 214 | 214 | 193 | 193 | 185 | 185 | 82 | 82 |
| P.d._03 | 232 | 232 | 214 | 214 | 193 | 193 | 185 | 185 | 82 | 82 |
| P.d._04 | 232 | 232 | 214 | 214 | 190 | 190 | 185 | 185 | 82 | 82 |
| P.d._05 | 232 | 232 | 214 | 214 | 193 | 193 | 185 | 185 | 82 | 82 |
| P.d._06 | 232 | 232 | 214 | 214 | 190 | 190 | 185 | 185 | 82 | 82 |
| P.d._07 | 232 | 232 | 214 | 214 | 193 | 193 | 185 | 185 | 82 | 82 |
| P.d._08 | 232 | 232 | 214 | 214 | 190 | 190 | 185 | 185 | 82 | 82 |
| P.d._09 | 232 | 232 | 214 | 214 | 193 | 193 | 185 | 185 | 82 | 82 |
| P.d._10 | 232 | 232 | 214 | 214 | 193 | 193 | 185 | 185 | 82 | 82 |
| P.d._11 | 232 | 232 | 214 | 214 | 193 | 193 | 185 | 185 | 82 | 82 |
| P.d._12 | 232 | 232 | 214 | 214 | 193 | 193 | 185 | 185 | 82 | 82 |
| P.d._13 | 232 | 232 | 214 | 214 | 193 | 193 | 185 | 185 | 82 | 82 |
| P.d._14 | 232 | 232 | 214 | 214 | 193 | 193 | 185 | 185 | 82 | 82 |
| Microsatellite Loci | WPMS09 | WPMS18 | PMGC14 | PMGC2163 | PMGC456 | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| Reference Samples | Allele Sizes (bp) | Allele Sizes (bp) | Allele Sizes (bp) | Allele Sizes (bp) | Allele Sizes (bp) | |||||
| ’Robusta’ | 232 | 250 | 214 | 214 | 190 | 223 | 185 | 223 | 76 | 82 |
| SP-01 | 232 | 260 | 214 | 229 | 190 | 223 | 185 | 223 | 76 | 82 |
| SP-02 | 250 | 250 | 214 | 226 | 193 | 202 | 185 | 243 | 78 | 82 |
| SP-03 | 232 | 250 | 214 | 214 | 190 | 223 | 185 | 223 | 76 | 82 |
| SP-04 | 232 | 260 | 214 | 229 | 193 | 211 | 185 | 223 | 76 | 82 |
| SP-05 | 232 | 258 | 214 | 229 | 190 | 205 | 185 | 239 | 76 | 82 |
| SP-06 | 232 | 250 | 214 | 214 | 190 | 223 | 185 | 249 | 76 | 82 |
| SP-07 | 252 | 252 | 214 | 223 | 190 | 199 | 185 | 227 | 76 | 82 |
| SP-08 | 232 | 250 | 214 | 223 | 190 | 208 | 185 | 239 | 76 | 82 |
| SP-09 | 250 | 250 | 214 | 226 | 193 | 205 | 185 | 243 | 76 | 82 |
| Range of Allele Sizes in Number of Base Pairs (bp) | ||||
|---|---|---|---|---|
| Loci | P. nigra | Populus deltoides Reference Samples | Populus ×euroamericana Reference Samples | Hybrid Poplars from Nature Localities |
| WPMS01 | 119–168 | 111, 113 | 111–151 | 111–151 |
| WPMS04 | 231–319 | – | 249–275 | 249–289 |
| WPMS07 | 213–271 | 223–269 | 221–259 | 221–267 |
| WPMS09 | 240–294 | 232 | 232–260 | 232–264 |
| WPMS10 | 224–266 | 230–236 | 230–244 | 230–258 |
| WPMS11 | 175–227 | 173–177 | 175–197 | 175–189 |
| WPMS13 | 108–144 | 102, 104 | 102–140 | 102–138 |
| WPMS14 | 228–285 | 234–288 | 231–276 | 246–279 |
| WPMS16 | 136–163 | 133, 139 | 133–148 | 133–151 |
| WPMS18 | 217–241 | 214 | 214–229 | 214–229 |
| WPMS19 | 185–245 | 203–224 | 188–236 | 203–236 |
| WPMS21 | 258–327 | 267–327 | 264–312 | 270–312 |
| WPMS22 | 82–160 | 121–139 | 82–145 | 85–133 |
| PMGC14 | 196–226 | 190,193 | 190–223 | 190–223 |
| PMGC2163 | 215–253 | 185 | 185–249 | 185–249 |
| PMGC456 | 76, 78 | 82 | 76, 82 | 76, 82 |
| Locus/Repeat Motif | Primer Sequence (5′–3′) | Allelic Size Range in bp | Na | Ne | I | Ho | He | PIC | The Highest Allele Frequencies |
|---|---|---|---|---|---|---|---|---|---|
| WPMS01 (GA)20 | F: AACCACTATGCCACCTTCTT R: AACTAACTCCATTCATTGCTAAA | 119–168 | 22 | 14.03 | 2.82 | 0.83 | 0.93 | 0.92 | 12% for allele 131 |
| WPMS04 (GT)25 | F: TACACGGGTCTTTTATTCTCT R: TGCCGACATCCTGCGTTCC | 231–319 | 41 | 13 | 3.05 | 0.88 | 0.92 | 0.92 | 19% for allele 255 |
| WPMS07 (GT)24 | F: ACTAAGGAGAATTGTTGACTAC R: TATCTGGTTTCCTCTTATGTG | 213–271 | 26 | 10.78 | 2.68 | 0.82 | 0.91 | 0.90 | 18% for allele 259 |
| WPMS09 (GT)21 (GA)24 | F: CTGCTTGCTACCGTGGAACA R: AAGCAATTTGGGTCTGAGTATCTG | 240–294 | 18 | 6.67 | 2.2 | 0.76 | 0.85 | 0.84 | 28% for allele 250 |
| WPMS10 (GT)23 | F: GATGAGAAACAGTGAATAGTAAGA R: GATTCCCAACAAGCCAAGATAAAA | 224–266 | 17 | 8.52 | 2.39 | 0.71 | 0.88 | 0.87 | 19% for alleles 244, 250 |
| WPMS11 (GT)26 | F: TAAAGATGATGGACTGAAAAGGTA R: TAAAGGAGAATATAAGTGACAGTT | 175–227 | 25 | 9.54 | 2.57 | 0.64 | 0.9 | 0.89 | 22% for allele 187 |
| WPMS13 (GT)22 | F: GATCCTGAACAATGTCGTACTTC R: ACGATAACCTGCGAGAAATGT | 108–144 | 17 | 10.7 | 2.52 | 0.91 | 0.91 | 0.90 | 15% for allele 132 |
| WPMS14 (CGT)28-3 | F: CAGCCGCAGCCACTGAGAAATC R: GCCTGCTGAGAAGACTGCCTTGAC | 228–285 | 19 | 8.12 | 2.38 | 0.94 | 0.88 | 0.87 | 23% for allele 228 |
| WPMS16 (GTC)8(ATCCTC)5 | F: CTCGTACTATTTCCGATGATGACC R: AGATTATTAGGTGGGCCAAGGACT | 136–163 | 9 | 5.25 | 1.77 | 0.75 | 0.81 | 0.78 | 28% for allele 136 |
| WPMS18 (GTG)13 | F: CTTCACATAGGACATAGCAGCATC R: CACCAGAGTCATCACCAGTTATTG | 217–241 | 10 | 4.1 | 1.6 | 0.42 | 0.76 | 0.72 | 34% for allele 223 |
| WPMS19 (CAG)28-3 | F: AGCCACAGCAAATTCAGATGATGC R: CCTGCTGAGAAGACTGCCTTGACA | 185–245 | 17 | 6.51 | 2.14 | 0.84 | 0.85 | 0.83 | 24% for allele 185 |
| WPMS21 (GCT)45-12 | F: TGCTGATGCAAAAGATTTAG R: TTGGAACTTCAACATTCAGAT | 258–327 | 23 | 9.65 | 2.56 | 0.82 | 0.9 | 0.89 | 19% for allele 281 |
| WPMS22 (TGA)23 | F: ACATGCTACGTGTTTGGAATG R: ATCGTATGGATGTAATTGTCTTA | 82–160 | 28 | 14.3 | 2.89 | 0.8 | 0.93 | 0.93 | 12% for allele 121 |
| P. nigra | P. deltoides | Populus ×euroamericana | Hybrid Poplars | |
|---|---|---|---|---|
| P. nigra | 0 | |||
| P. deltoides | 0.223 | 0 | ||
| Populus ×euroamericana | 0.075 | 0.183 | 0 | |
| Hybrid poplars | 0.079 | 0.200 | 0.057 | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cvrčková, H.; Máchová, P.; Čížková, L.; Vítová, K.; Trčková, O.; Fulín, M. Microsatellite Markers as a Useful Tool for Species Identification and Assessment of Genetic Diversity of the Endangered Species Populus nigra L. in the Czech Republic. Forests 2025, 16, 1389. https://doi.org/10.3390/f16091389
Cvrčková H, Máchová P, Čížková L, Vítová K, Trčková O, Fulín M. Microsatellite Markers as a Useful Tool for Species Identification and Assessment of Genetic Diversity of the Endangered Species Populus nigra L. in the Czech Republic. Forests. 2025; 16(9):1389. https://doi.org/10.3390/f16091389
Chicago/Turabian StyleCvrčková, Helena, Pavlína Máchová, Luďka Čížková, Kateřina Vítová, Olga Trčková, and Martin Fulín. 2025. "Microsatellite Markers as a Useful Tool for Species Identification and Assessment of Genetic Diversity of the Endangered Species Populus nigra L. in the Czech Republic" Forests 16, no. 9: 1389. https://doi.org/10.3390/f16091389
APA StyleCvrčková, H., Máchová, P., Čížková, L., Vítová, K., Trčková, O., & Fulín, M. (2025). Microsatellite Markers as a Useful Tool for Species Identification and Assessment of Genetic Diversity of the Endangered Species Populus nigra L. in the Czech Republic. Forests, 16(9), 1389. https://doi.org/10.3390/f16091389

