Next Article in Journal
Recruitment of Dry Tropical Woody Species After Fire: Germination Phase and Seedling Establishment
Previous Article in Journal
Advanced Technologies in Physical and Mechanical Wood Modification
Previous Article in Special Issue
Reproductive Ecology of Lecythis Pisonis in Brazilian Agroforestry Systems: Implications for Conservation and Genetic Diversity
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Microsatellite Markers as a Useful Tool for Species Identification and Assessment of Genetic Diversity of the Endangered Species Populus nigra L. in the Czech Republic

Forestry and Game Management Research Institute, Strnady 136, 252 02 Jíloviště, Czech Republic
*
Author to whom correspondence should be addressed.
Forests 2025, 16(9), 1389; https://doi.org/10.3390/f16091389
Submission received: 30 July 2025 / Revised: 19 August 2025 / Accepted: 26 August 2025 / Published: 30 August 2025
(This article belongs to the Special Issue Genetic Diversity of Forest: Insights on Conservation)

Abstract

The population size of black poplar (Populus nigra L.), once an important part of floodplain forests in the Czech Republic, has greatly declined due to human activity. In this study, we applied microsatellite (SSR) markers to identify species and assess genetic diversity, with the aim of supporting conservation of this endangered species. A total of 378 poplar trees were analyzed following field surveys. Five diagnostic SSR markers with species-specific alleles for P. deltoides Bartr. ex Marsh. enabled the identification of 39 interspecific hybrids, which were distinguished from native P. nigra. Thirteen SSR loci were used to evaluate genetic diversity among confirmed P. nigra individuals. The results revealed high genetic variation, with 66% of pairwise genotype comparisons differing at all loci. After excluding 45 genetically similar individuals, 292 genetically verified and polymorphic P. nigra trees were selected as potential sources of reproductive material. Genetic differentiation (Fst) was highest between P. nigra and P. deltoides (0.27), and lowest between reference Populus ×euroamericana clones and detected hybrid poplars (0.05) from natural localities. Distinct genetic structures were identified among P. nigra, P. deltoides, and hybrid individuals. These findings provide essential data for the protection, reproduction, and planting of black poplar.

1. Introduction

The impacts of climate change on forestry in the Czech Republic have caused the mass dieback of forest stands in recent years, including in floodplain forests, where there has been a significant decline in alder and ash stands due to fungal pathogens [1]. The regeneration of forest stands can be achieved more quickly through the use of deciduous pioneer tree species, whose ameliorative function improves the nutrition and stability of the stands and their adaptability to ongoing environmental changes. Black poplar, native to Europe, Southwest and Central Asia, and Northwest Africa [2], is a pioneer deciduous tree with ameliorative function and a suitable substitute tree for the lower altitudes of riparian ecosystems. In the past, this species was naturally abundant in the Czech Republic along large rivers and their tributaries in floodplain forests. It is a fast-growing, dioecious tree species that requires ample light and does not tolerate shading, even in its youth. Its root system consists of two types: one reaching deep to groundwater and another spreading near the soil surface, both contributing to its high vitality. Black poplar has a high sprouting capacity from the trunk and stump and can be easily propagated by cuttings. Its timber has been used in carpentry, cooperage, carving, and for fuel [2,3]. This species has been neglected, and black poplar stands have been strongly reduced over the past few decades by human influences in the Czech Republic, similar to in other European riparian forests [4,5,6]. To save its genetic resources, the Populus nigra Network was established in 1995 as part of the European Forest Genetic Resources Programme (EUFORGEN). For its use in the restoration of floodplain forest ecosystems, it is essential to ensure a sufficient number of high-quality sources of reproductive material. Monitoring genetic diversity using DNA analyses for the conservation of black poplar has been carried out in European countries for more than two decades [4,5,6,7]. Based on morphological characteristics, an inventory of the remaining presumed black poplar trees was carried out, and the genetic variability of phenotypically high-quality trees was verified by DNA analysis using microsatellite markers. Knowledge of the level of genetic diversity is important for assessing the ability of trees to adapt to changing environmental conditions and for the long-term survival of the populations [5,7]. To ensure the variability of reproductive material sources established from the remaining black poplars, it is necessary to exclude genetically closely related trees and also identical trees that may occur due to the ease of vegetative propagation or artificial planting of clones. Bred interspecific hybrids of black poplar (Populus nigra L.) and cottonwood (Populus deltoides Bartr. ex Marsh.) are planted in large numbers. Since spontaneous crossing of black poplar with these hybrids can occur [8,9,10], we also focused on the detection of possible spontaneous hybrids. In this study, we employed a set of microsatellite (SSR) markers to identify black poplar trees, assess their genetic diversity, and detect spontaneous hybrids. Eleven microsatellite markers with a high level of polymorphism and balanced allele frequency were selected to determine genetic relatedness and clonal identity. To detect possible introgression of cultivated hybrids into native black poplar trees, WPMS09 and WPMS18 microsatellites were added as diagnostic markers containing species-specific alleles in a homozygous state for reference samples of P. deltoides, as reported in several publications [5,11,12]. Three additional diagnostic markers—PMGC14, PMGC2163, and PMGC456—were used to more precisely verify the classification of our samples into black poplars and hybrid poplars. These microsatellites have also been used by other authors in their studies [5,10,11,13,14,15].
The main objective of this study was to genetically identify native black poplar trees and evaluate their genetic variability using SSR markers. The resulting data contribute to the conservation of the native gene pool and the development of genetically diverse reproductive material sources.

2. Materials and Methods

A total of 378 presumed adult black poplars were surveyed at various localities across the Czech Republic, specifically in the river basins of the Dyje, Morava, Olše, Jihlava, Odra, Labe, and Ohře, including their tributaries. For the inventory of black poplar, areas of its natural occurrence [2] were selected where a frequent co-occurrence of P. nigra and P. ×euroamericana was expected, with the aim of identifying potential influences on the gene pool of black poplar. The focus was placed on phenotypically high-quality adult trees. The geographical coordinates of the sampled localities were re-corded (Table S3), and their distribution is illustrated on the map (Figure 1). In addition, 14 genetically distinct samples of Populus deltoides and 10 bred hybrid clones of Populus ×euroamericana (ori-ginating from controlled crosses between the North American species Populus deltoides and the European species Populus nigra), cultivated in the gene bank of the Forestry and Game Management Research Institute in the Czech Republic, were used as reference samples to detect possible introgression in the monitored black poplar individuals. Microsatellite markers were employed for the genetic analyses.

Analyses of Microsatellite Markers

Sampling for DNA analysis was carried out between 2018 and 2023 from individual trees in the remaining stands of black poplar. DNA was isolated either from leaves flushed on short twigs collected in early spring and treated in the laboratory, or from leaves collected later in the field and preserved in silica gel. Total genomic DNA was extracted from either 100 mg of fresh young leaves or 20 mg of lyophilized leaves using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. The quality of DNA eluates was verified spectrophotometrically using a micro-volume spectrophotometer (MaestroGen, Las Vegas, NV, USAn). Eleven nuclear microsatellite markers (WPMS01, WPMS04, WPMS07, WPMS10, WPMS11, WPMS13, WPMS14, WPMS16, WPMS19, WPMS21, WPMS22) described by [16,17] were selected to study the genetic diversity of black poplar individuals. The selection prioritized markers with sufficient polymorphism and a balanced distribution of allele frequencies to ensure reliable diversity assessment. Additionally, microsatellites WPMS09 [16] and WPMS18 [17], which contain P. deltoides-specific alleles, were used as diagnostic markers to detect possible hybrid individuals. Allele 214 bp at WPMS18 and 232 bp at WPMS09, both in a homozygous state, were consistently found in our 14 reference samples of P. deltoides. The 214 bp allele at WPMS18 (in homozygous or heterozygous state) was present in all reference samples of cultivated Populus ×euroamericana hybrids, while the 232 bp allele at WPMS09 occurred in heterozygous state in seven reference hybrid clones. These diagnostic allele sizes were used to identify potential hybrids among candidate P. nigra individuals. Microsatellite loci were amplified by polymerase chain reaction (PCR) using specific fluorescent dye-labeled primers (FAM, VIC, PET, and NED). The 13 nuclear microsatellites were organized into three multiplexes based on target allele sizes and amplification conditions. Each 15 µL PCR mixture contained 1 µL of template DNA (≈10–50 ng/µL), 1.5 µL of 10× Mg-free PCR buffer, 2 mM MgCl2, 0.37 U Platinum® Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA), 0.13 mM dNTP mixture (Takara Bio Inc., Otsu, Shiga, Japan), and a specific combination of forward and reverse primers. For first multiplex, the primer concentration for each locus was 0.1 µM for WPMS07, WPMS10, WPMS16, WPMS18, and WPMS22. For second multiplex, it was 0.1 µM for loci WPMS01 and WPMS04, 0.15 µM for locus WPMS11, and 0.05 µM for loci WPMS13 and WPMS19. For third multiplex, it was 0.1 µM for loci WPMS09 and WPMS21 and 0.05 µM for locus WPMS14. Thermocycling was performed according to a modified version of the protocol from [16,17], where the second multiplex had longer times for denaturation (94 °C for 30 s) and for annealing temperature (53 °C for 30 s). The annealing temperatures were 55 °C for first multiplex and 60 °C for third multiplex. Three additional diagnostic markers (PMGC14, PMGC2163 [10], and PMGC456 [18]) with P. deltoides-specific allele sizes were used to verify the division of our samples into black poplar, cottonwood and hybrid poplars. The PCR amplification was conducted together as a fourth multiplex using the Multiplex PCR Kit (Qiagen, Hilden, Germany), as described by [15]. The primer concentration for each locus was 0.025 µM. The PCR cycling conditions included initial denaturation at 95 °C for 15 min, followed by 30 cycles of 94 °C for 30 s, 52 °C for 90 s (annealing), and 72 °C for 60 s (extension), with a final extension at 60 °C for 30 min. PCR amplifications were carried out using a Veriti thermal cycler (Applied Biosystems, Foster City, CA, USA). Sizing of amplified loci was performed using fragmentation analysis on a genetic analyzer (Applied Biosystem 3500, Foster City, CA, USA). GeneScanTM 600LIZ® (Applied Biosystems, Foster City, CA, USA) was used as size standard. Markers from each multiplex were evaluated in one run. Allele sizing was performed using GeneMapper® 4.1 software (Applied Biosystems). The processed data were subjected to statistical analysis using the GenAlEx 6.503 program [19,20]. Genetic characteristics of microsatellite markers and species assignments of the analyzed poplar individuals were assessed. Genetic relatedness among confirmed P. nigra samples was determined based on multilocus genotype matching. The polymorphic information content (PIC) of each marker was calculated using the program CERVUS [21]. Evaluation of genetic differentiation among the studied poplar species (Populus nigra, hybrid poplars and reference samples of P. deltoides and Populus ×euroamericana) was performed on the basis of the pairwise FST values which were visualized using principal coordinate analysis (PCoA). Genetic differences among species and hybrids were further investigated through comparison of population structures. The Bayesian clustering method implemented in the STRUCTURE 2.3.4 software [22,23,24,25] was used to derive structures based on multilocus data of monitored microsatellite markers. The admixture model was used with correlated allele frequencies and Lockprior specification. The burn-in period was set to 50,000, followed by 500,000 Markov Chain Monte Carlo (MCMC) repetitions. Simulations were run for values of K from 1 to 10, each repeated ten times. The most likely number of clusters was assessed on the basis of ΔK method [26] using the web-based StructureSelector tool [27]. StructureSelector generates graphical representations of the results by integrating the CLUMPAK program [28].

3. Results

3.1. Evaluation of Genetic Diversity of Poplar Trees and Detection of Possible Hybrids

The genetic investigation of 378 black poplar trees across the territory of the Czech Republic was conducted using analyses of nuclear microsatellite markers—WPMS01, WPMS04, WPMS07, WPMS09, WPMS10, WPMS11, WPMS13, WPMS14, WPMS16, WPMS18, WPMS19, WPMS21, and WPMS22—as described by [16,17]. Hybrid detection in the sampled poplars was performed by comparing allele sizes at five diagnostic markers (WPMS09, WPMS18, PMGC14, PMGC2163, and PMGC456), using 14 reference samples of Populus deltoides (Table 1) and 10 reference samples of Populus ×euroamericana (Table 2) as standard samples. We consistently detected allele values of 214 bp in a homozygous state at the WPMS18 locus, 232 bp in a homozygous state at WPMS09, 190 bp or 193 bp in a homozygous state at PMGC14, 185 bp in a homozygous state at PMGC2163, and 82 bp in a homozygous state at PMGC456 in all 14 reference samples of Populus deltoides. Additionally, no amplification products were obtained at the WPMS04 locus for this species. Amplification at the WPMS04 locus was observed in all other analyzed poplar samples (both hybrids and black poplars). Alleles of 214 bp at WPMS18, in either homozygous or heterozygous states, were present in all reference samples of Populus ×euroamericana. The 232 bp allele at WPMS09 was found only in the heterozygous state in seven hybrid clones. Specific alleles 190 bp or 193 bp at PMGC14, 185 bp at PMGC2163, and 82 bp at PMGC456 were detected in the heterozygous state in all Populus ×euroamericana reference samples (Table 2).
The assessment of genetic diversity among the poplars was carried out through pairwise comparisons of multilocus genotypes based on the results from the statistical program GenAlex 6.503 [19,20]. Poplars with identical multilocus genotypes (i.e., the same allele sizes at all analyzed markers) were mainly found in the Labe and Ohře river basins. Among the 378 poplars, one group of 17 genetically identical individuals was identified (labeled as TPC_21, TPC_22, TPC_23, TPC_32, TPC_33, TPC_34, TPC_35, TPC_36, TPC_54, TPC_55, TPC_59, TPC_68, TPC_73, TPC_76, TPC_77, TPC_78, TPC_87) (Table S2), as well as a second group of seven genetically identical trees (TPC_7, TPC_8, TPC_27, TPC_60, TPC_67, TPC_70, TPC_71). Both clonal groups shared the following heterozygous allele combinations: 214 bp at the WPMS18 locus, 190 bp at the PMGC14 locus, 185 bp at the PMGC2163 locus, and 82 bp at the PMGC456 locus (Table S2). Two poplars from Libický luh (Labe basin), labeled TPC_29 and TPC_31, were genetically identical to the reference sample of Populus ×euroamericana ‘Robusta’ (Table S2). The 214 bp allele at the WPMS18 locus was also present in seven genetically distinct poplars: six individuals (TPC_6, TPC_28, TPC_30, TPC_95, P_764, P_767) from the Labe basin, and one (TPC_50) from the Ohře basin. The hybrid origin of these individuals was confirmed by the presence of P. deltoides-specific alleles in heterozygous state at the PMGC14, PMGC2163, and PMGC456 loci, except for sample TPC_95 (Table S2). In the Olše river basin, two genetically distinct hybrid trees (OL_1, OL_11) were identified, both with only the 214 bp allele at the WPMS18 locus in homozygous state. Only four samples lacked the 214 bp allele at the WPMS18 locus: sample 126_DRN from the Dyje basin and three poplars (TPC_93, TPC_94, TPC_96) from the Labe basin. Their hybrid character was indicated by the presence of diagnostic alleles in heterozygous state at the PMGC14 marker (126 DRN—allele 193 bp), at the PMGC2163 marker (allele 185 bp at samples 126 DRN, TPC_94) and at the PMGC456 marker (allele 82 bp at samples 126 DRN, TPC_93, TPC_96) (Table S2).
The markers WPMS09, WPMS18, PMGC14, PMGC2163, and PMGC456 proved effective for species identification among the examined black poplar samples and for detecting hybrid individuals. The allele 232 bp at marker WPMS09 was found exclusively in two samples from Libický luh (TPC_29, TPC_31). An overview of allele size ranges for all analyzed markers across the studied poplars is provided in Table 3.
We identified a total of 35 poplar trees with a 214 bp allele at the WPMS18 locus, seven of which were homozygous for this marker. Only four poplars lacked the 214 bp allele at the WPMS18 locus, and their hybrid origin was confirmed based on other diagnostic markers. These 39 detected hybrid trees were excluded from the statistical analysis of the genetic diversity of the investigated black poplars. In addition, two trees (labeled PO_44 in the Odra basin and 135 DRN in the Dyje basin) were excluded from the evaluation due to identical multilocus genotypes with other trees in the same localities (PO_44 with PO_45 and 135 DRN with 136 DRN), indicating clonal vegetative reproduction. The multilocus genotypes of the remaining 337 genetically distinct black poplar trees (Table S1) were subjected to statistical evaluation.

3.2. Evaluation of Genetic Diversity Among Selected 337 Black Poplar Genotypes

Genotyping using diagnostic markers in the 337 genetically distinct black poplars revealed allele sizes ranging from 240 bp to 294 bp at locus WPMS09, from 217 bp to 241 bp at locus WPMS18, from 196 bp to 226 bp at locus PMGC14, and from 215 bp to 253 bp at locus PMGC2163. All these allele sizes were larger than those found in the reference samples of P. deltoides. Smaller allele sizes than those in P. deltoides reference samples were detected at marker PMGC456, where two alleles of 76 bp and 78 bp were observed in the homozygous state in black poplar trees. An overview of allele size ranges for all 16 microsatellite markers analyzed in the poplar trees is presented in Table 3. A significant level of genetic diversity among most of the black poplar pairs was observed based on the results of pairwise multilocus analysis of the 337 genotypes using thirteen nuclear microsatellite markers: WPMS01, WPMS04, WPMS07, WPMS09, WPMS10, WPMS11, WPMS13, WPMS14, WPMS16, WPMS18, WPMS19, WPMS21, and WPMS22. In all thirteen loci, 66% of pairwise combinations of black poplar genotypes differed in allele sizes; in twelve loci, it was 26%; in eleven loci, 5.7%; in 10 loci, 1.6%, and only 0.7% pairwise combinations differed in allele sizes from 1 to 9 loci. To ensure a diverse source of reproductive material, only those black poplars that differed in allele size at a minimum of five microsatellite loci were selected. Based on this criterion, 45 of the 337 black poplar trees are not recommended for use as sources of reproductive material.

3.3. Genetic Characteristics of Microsatellite Markers

The genetic characteristics of the microsatellite markers (WPMS01, WPMS04, WPMS07, WPMS09, WPMS10, WPMS11, WPMS13, WPMS14, WPMS16, WPMS18, WPMS19, WPMS21, WPMS22) used in the diversity study were obtained from the analysis of 337 black poplar trees (Table 4) and indicate a high level of variability. The number of alleles (Na) ranged from 9 (WPMS16) to 41 (WPMS04) and the mean number of effective alleles (Ne) ranged from 4.1 (WPMS18) to 14.3 (WPMS22). Shannon’s information index, which reflects allelic and genetic diversity, ranged from 1.60 at locus WPMS18 to 3.05 at WPMS04. Observed heterozygosity values ranged from 0.42 (WPMS18) to 0.94 (WPMS14), and expected heterozygosity ranged from 0.76 (WPMS18) to 0.93 (WPMS01 and WPMS22). Based on the selection of microsatellite markers with a more even distribution of allele frequencies, the highest allele frequencies among the 13 analyzed markers ranged from 12% to 34% (Table 4). The highest value, 34%, was found at the WPMS18 locus for the 223 bp allele. This marker was selected as an important diagnostic marker for species identification. The use of polymorphic markers with a more balanced allele frequency distribution enabled more accurate genotype identification and a more reliable assessment of genetic diversity among the examined poplar trees. The high level of diversity observed was further supported by the values of the polymorphic information content (PIC), which ranged from 0.72 (WPMS18) to 0.93 (WPMS22), with a mean value of 0.87 (Table 4).

3.4. Genetic Differences Among Poplar Species and Hybrids

The evaluation of genetic differentiation among identified P. nigra, hybrid poplars, and reference samples of P. deltoides and Populus ×euroamericana was carried out based on result of pairwise comparisons of Fst values obtained from the analysis of 13 selected microsatellites (Table 5). The highest value of genetic differentiation was observed between P. deltoides and P. nigra (0.223). Differentiation between P. nigra and Populus ×euroamericana was lower (0.075) than that between P. deltoides and Populus ×euroamericana (0.183). The lowest Fst value was found between samples of P. ×euroamericana and the hybrid poplars (0.057). These genetic differences are graphically represented by Principal coordinate analysis (PCoA) in Figure 2.
The genetic structures of observed poplar trees P. deltoides, P. nigra, Populus ×euroamericana and hybrid poplars were obtained by the Bayesian clustering. The proportions of individual genetic clusters were quantified as percentages to compare the genetic structures of the different poplar taxa. The optimal number of clusters Delta K = 2 was determined using the StructureSelector program. A secondary peak at K = 4 provided a more detailed resolution of the genetic profiles, allowing for clearer differentiation among the studied poplar species (Figure 3). For K = 2, the average cluster proportions were as follows: blue cluster 99.92% in P. nigra, 0.15% in P. deltoides, 11.93% in Populus ×euroamericana, and 14.19% in hybrid poplars; orange cluster 0.08% in P. nigra, 99.85% in P. deltoides, 88.07% in P. ×euroamericana, and 85.81% in hybrid poplars (Figure 4). For K = 4, the mean proportions were as follows: blue cluster 73.66% in P. nigra, 0.3% in P. deltoides, 10.94% in to Populus ×euroamericana, and 9.42% in hybrid poplars; orange cluster 0.02% in P. nigra, 99.48% in P. deltoides, 57.77% in P. ×euroamericana, and 34.46% in hybrid poplars; green cluster 10.13% in P. nigra, 0.1% in P. deltoides, 31.11% in P. ×euroamericana, and 53.88% in hybrid poplars; and purple cluster 16.32% in P. nigra, 0.12% in P. deltoides, 0.18% in P. ×euroamericana, and 2.24% in hybrid poplars (Figure 5). No hybrid poplar exhibited a genetic structure identical to that of P. nigra.
For the purpose of preserving genetic resources and using them for the reproduction of black poplar, a collection of 292 genetically verified polymorphic trees was assembled. Five diagnostic markers were used to identify Populus nigra, and 13 selected microsatellite markers were applied to assess genetic diversity. Thanks to the high level of genetic diversity and the exclusion of clonal duplicates identified using the developed methodological procedures of molecular analyses, it will be possible to preserve a substantial part of the genetic variability of P. nigra in the studied areas. The first steps have been taken in line with the European conservation strategy for black poplar. A total of 127 genetically polymorphic and morphologically high-quality trees are currently maintained in the field gene bank of the Forestry and Game Management Research Institute in the Czech Republic. This collection is being further expanded, with priority given to old, endangered trees. Short-term ex situ conservation aimed at preserving a broad range of genotypes is carried out in cooperation with forest owners. Selected genotypes have been propagated, and their growth is currently being evaluated in research plots established in the Morava River basin as an example of native poplar plantations replacing non-native hybrids. Technical guidelines for the use of black poplar in forestry have been published as an open-access resource for landowners and other stakeholders in the Czech Republic [29].

4. Discussion

Our study focused on identifying suitable black poplar trees to serve as sources of reproductive material for use in the restoration of floodplain forests in the Czech Republic, where native Populus nigra populations have been significantly reduced in the past. The remaining individuals were inventoried at sites along river basins and their tributaries according to conservation strategy for European black poplar led by Technical Guidelines EUFORGEN [30]. This Guidelines confirmed that most of the genetic diversity in black poplar is found within river systems. Morphologically high-quality trees were selected for genetic analysis. Species-specific markers for P. deltoides were used to detect hybrid individuals among the studied poplars, and the level of genetic diversity in the confirmed black poplars was assessed using thirteen microsatellite markers. Out of 378 analyzed poplar trees, 35 individuals carried the P. deltoides-specific allele of 214 bp at the WPMS18 microsatellite locus. In 32 of these 35 individuals, hybrid origin was also confirmed by the presence of diagnostic alleles at markers PMGC14, PMGC2163, and PMGC456. In the remaining four hybrid samples, the presence of P. deltoides-specific alleles was confirmed at only a subset of the PMGC14, PMGC2163, and PMGC456 markers (Table S2). Groups of 17 and 7 genetically identical hybrid trees were found at various locations in the Labe and Ohře river basins. This finding strongly suggests that these trees originated from the planting of vegetatively propagated hybrid clones. Several authors have investigated genetic differences between black poplars and their hybrids using P. deltoides-specific microsatellite alleles. In their identification of commercial clones of Populus ×euroamericana, P. deltoides, and P. nigra, ref. [31] obtained very similar allele size results for the same markers—WPMS09, WPMS18, and PMGC14—as those found in our study. For Populus deltoides, they reported an allele of 232 bp in the homozygous state at the WPMS09 locus, consistent with our findings, and an allele of 215 bp in the homozygous state at the WPMS18 locus, while our study found a value of 214 bp. For this shift of one bp, we assume a different subtraction of the allele value of the identical amplified locus. Furthermore, the authors found that in Populus ×euroamericana hybrid clones, the 215 bp allele at the WPMS18 locus occurred in both homozygous and heterozygous states, and the 232 bp allele at the WPMS09 locus appeared only in the heterozygous state—results that are also consistent with our findings. The allele sizes of 190 bp and 193 bp at the PMGC14 marker for P. deltoides reported by these authors also match the values observed in our study. This consistency in DNA analysis results is likely due to the use of similar electrophoresis equipment from the same manufacturer—their ABI PRISM 310 genetic analyzer and our Applied Biosystems 3500. It has been reported that allele size estimates can vary depending on the laboratory procedures used for DNA analysis, particularly the type of electrophoretic separation applied to amplified DNA fragments. For example, ref. [14] reported differences of up to 5 base pairs in allele sizes for the diagnostic markers WPMS09 and WPMS18 of P. deltoides between laboratories using MegaBACE and ABI PRISM 310 instruments. Similarly, ref. [11,18], using the LI-COR 4300 system, reported identical allele sizes of 234 bp (homozygous) at WPMS09 and 220 bp (homozygous) at WPMS18. The authors of [11] also found these diagnostic alleles in the heterozygous state in P. ×euroamericana samples, while they were absent from reference P. nigra samples. However, these alleles were detected in an old natural Populus subpopulation along the Ticino River, indicating possible introgression. Higher allele sizes at the WPMS18 and WPMS09 loci in black poplar trees compared to P. deltoides were confirmed not only in the results of Fossati [11] but also in other studies [5,14,31], including our own (Table 3). At the diagnostic marker PMGC2163, we obtained the same allele size of 185 bp for P. deltoides as reported by [13], who included this marker in genetic studies of seven Populus species, including P. nigra, with an allele sizes range from 219 bp to 235 bp. In our study, the black poplars showed a broader allele size range at this marker, from 215 bp to 253 bp. The authors of [15] reported a different allelic ladder for P. deltoides at the species-specific markers PMGC14, PMGC456, and PMGC2163, using a Beckman Coulter CEQ 8000 capillary sequencer. Compared to our results, the allele sizes were shifted: 192 bp and 195 bp at PMGC14 by two nucleotides, 86 bp at PMGC456 by four nucleotides, and 188 bp at PMGC2163 by three nucleotides. For several genetically distinct poplars identified as hybrids (Table S2) found at various sites in the Labe basin, as well as single individuals from the Ohře and Dyje basins, introgression through spontaneous crossing with planted cultivated poplars cannot be ruled out. Evidence of P. deltoides gene introgression has been reported by multiple authors [8,10,11,12,32,33]. Populus nigra is listed as a Critically Endangered species in the Red List of Threatened Plant Species of the Czech Republic [34]. To preserve the genetic resources of this native species, it is essential to evaluate the level of its genetic diversity. The use of molecular markers is a valuable tool in conservation strategies for the remaining populations of black poplar. Many authors have employed microsatellite markers to study the genetic diversity of P. nigra populations [35,36,37,38]. For example, ref. [12] reported high levels of polymorphism at seven microsatellite loci in a black poplar population from the Eder River basin. Similarly, our study also revealed a high level of genetic diversity in black poplars from the Czech Republic. When comparing the same loci as those analyzed by [12] (WPMS09, WPMS14, and WPMS18), we found slightly higher levels of diversity in standard genetic parameters (Na, Ne, Ho, He), except for the observed heterozygosity (Ho) at the WPMS18 marker. Our Ho value for this marker was 0.40, compared to 0.62 reported in the aforementioned study. We did not obtain any amplification products at the WPMS04 locus for P. deltoides, which is consistent with the findings of [10]. Their study confirmed polymorphism in 12 microsatellite markers (with an average allele number of 11.92) in P. nigra trees from the vicinity of the Melendiz River, and also included reference samples of P. deltoides and hybrid trees (Populus ×euroamericana) for species identification. In a study of the genetic diversity of black poplar in Czech populations in the Morava River basin monitored 20 years ago, higher levels of diversity were also observed. The mean observed heterozygosity for twelve analyzed microsatellite loci ranged from 0.67 to 0.93, and in accordance with our results, the most variable locus was WPMS04 [39]. Higher levels of observed heterozygosity, ranging from 0.59 to 0.82, were also identified by [12] in a large-scale study with wider geographic coverage, which tracked the genetic diversity of 17 populations from 11 river valleys (Danube, Ebro, Elbe, Po, Rhine, Rhône, and Usk). In an analysis of the genetic structure of 26 remnant populations located along the largest river valleys in Poland, it was found that certain populations exhibited reduced genetic variation and that 261 trees were identified as clones [40].
The authors of [10] reported the highest observed heterozygosity (Ho = 0.91) at the WPMS14 locus. In our study, this marker also showed the highest level of heterozygosity (Ho = 0.94). The lowest number of alleles in our dataset was found at the WPMS16 locus (Na = 9) across the 337 Czech black poplar trees analyzed. Similarly, ref. [6], in a study of 120 adult black poplars from four Serbian populations, also found the lowest number of alleles (Na = 8) at this locus, although it still exhibited sufficient polymorphism for genetic studies. The WPMS18 locus, which also had a relatively low number of alleles (Na = 10), showed the lowest values for other genetic parameters among the microsatellites we analyzed. However, this marker proved indispensable for the detection of hybrid poplars. In our study, microsatellite markers with a more even distribution of allele frequencies were selected to allow a more accurate evaluation of the genetic characteristics of black poplar individuals. The results of DNA analyses showed that adult black poplar trees are characterized by higher levels of genetic diversity at the 13 selected microsatellite loci. This characteristic was further supported by the high values of Shannon’s information index, ranging from 1.6 to 3.05 (Table 4). In contrast, ref. [10] reported lower values for this index (0.63–1.48), even for some of the same markers used in our study (e.g., WPMS04—0.63, WPMS09—1.05, WPMS10—0.84, WPMS14—1.48, WPMS18—0.97).
In the Czech Republic, the natural regeneration of black poplar is insufficient. To ensure its inclusion in the species composition of floodplain forests, artificial regeneration using genetically diverse planting material is necessary. Microsatellite markers have proven to be effective tools for assessing the polymorphism of reproductive material sources and for reliable species identification.

5. Conclusions

The application of selected microsatellite markers has proven to be a highly effective tool for studying the genetic diversity of black poplar and for detecting possible hybrids, and it can support the conservation of the remaining genetic resources of native Populus nigra in the Czech Republic. Our research activities follow the EUFORGEN guidelines for genetic conservation, which recommend a preliminary assessment of genetic diversity among adult trees in candidate populations in order to preserve a high level of diversity [30].
Based on the high level of genetic diversity detected in black poplars from the Dyje, Morava, Olše, Jihlava, Odra, Labe, and Ohře river basins in the Czech Republic, standard ex situ conservation was initiated. The first group of 127 genetically polymorphic individuals was collected for the field gene bank of the Forestry and Game Management Research Institute in the Czech Republic. This gene bank can maintain hundreds of genotypes and ensure the availability of genetic resources for reproduction. The protection and reproduction of scattered, endangered, and old trees is a priority of ongoing research. The establishment of clonal or progeny trials, as well as the reintroduction of P. nigra into protected natural areas along rivers, is a key priority that will build on the results of this study. Special attention will also be given to the use of P. nigra in forestry.
The developed molecular analysis procedures are currently being applied to additional candidate trees from other river basins in the Czech Republic, supporting the expansion of conservation efforts. The utilization of genetically diverse black poplar material in restoration and afforestation projects has the potential to increase the adaptability and resilience of floodplain forests under changing climatic conditions. Enriching forest stands with well-adapted native genotypes contributes to the stability and multifunctionality of these ecosystems, aligning with broader ecological, social, and economic goals. Verification of genetic diversity and species identification of forest tree genetic resources using molecular methods is one of the requirements for their inclusion in the National Program in conservation and the reproduction of forest tree gene pool in the Czech Republic.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/f16091389/s1, Table S1: List of investigated poplar samples, with allele sizes of all 16 microsatellite markers and their locations; Table S2: List of detected hybrid poplars; Table S3: Geographical coordinates of the localities of the sampled poplar trees.

Author Contributions

Designation and supervision of the experiments and discussion of the results, H.C., P.M. and L.Č.; performing the experiments and data analysis, O.T. and K.V.; collection and processing the field data, L.Č. and M.F.; interpretation of the results, H.C. and P.M.; writing—original draft preparation, H.C.; writing—review and editing, H.C., P.M. and L.Č. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Agriculture of the Czech Republic: Institutional support MZE-RO0123.

Data Availability Statement

The data presented in this study are available within the article and in Supplementary Materials Tables S1–S3.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Čížková, L.; Barnet, P.; Máchová, P. Využití topolu šedého jako náhrady jasanu a olše při obnově zejména lužních lesů (The use of grey poplar as a substitute for ash and alder in the restoration of floodplain forests). Lesn. Průvodce 2018, 3, 27. [Google Scholar]
  2. Hejný, S.; Slavík, B. Květena České Republiky, 2nd ed.; Academia: Praha, Czech Republic, 1990; p. 540. [Google Scholar]
  3. Úradníček, L.; Maděra, P.; Tichá, S.; Koblížek, J. Dřeviny České republiky; Lesnická práce, s.r.o.: Kostelec nad Černými lesy, Czech Republic, 2009; p. 367. [Google Scholar]
  4. Heinze, B. Genetic traces of cultivated hybrid poplars in the offspring of native Populus nigra in Austria. Preslia 2008, 80, 365–374. [Google Scholar]
  5. Smulders, M.J.M.; Cottrell, J.E.; Lefèvre, F.; Van der Schoot, J.; Arens, P.; Vosman, B.; Tabbener, H.E.; Grassi, F.; Fossati, T.; Castiglione, S.; et al. Structure of the genetic diversity in black poplar (Populus nigra L.) populations across European river systems: Consequences for conservation and restoration. For. Ecol. Manag. 2008, 255, 1388–1399. [Google Scholar] [CrossRef] [Scilit]
  6. Čortan, D.; Schroeder, H.; Šijačić-Nikolić, M.; Wehenkel, C.; Fladung, M. Genetic structure of remnant black poplar (Populus nigra L.) populations along biggest rivers in Serbia assessed by SSR markers. Silvae Genet. 2016, 65, 12–19. [Google Scholar] [CrossRef] [Scilit]
  7. Booy, G.; Hendriks, R.J.J.; Smulders, M.J.M.; Van Groenendael, J.M.; Vosman, B. Genetic diversity and the survival of populations. Plant Biol. 2000, 2, 379–395. [Google Scholar] [CrossRef] [Scilit]
  8. Vanden Broeck, A.; Storme, V.; Cottrell, J.E.; Boerjan, W.; Van Bockstaele, E.; Quataert, P.; Van Slycken, J. Gene flow between cultivated poplars and native black poplar (Populus nigra L.): A case study along the river Meuse on the Dutch-Belgian border. For. Ecol. Manag. 2004, 197, 307–310. [Google Scholar] [CrossRef] [Scilit]
  9. Smulders, M.J.M.; Beringen, R.; Volosyanchuk, R.; Vanden Broeck, A.; Van der Schoot, J.; Arens, P.; Vosman, B. Natural hybridisation between Populus nigra L. and P. × canadensis Moench. Hybrid offspring competes for niches along the Rhine river in the Netherlands. Tree Genet. Genomes 2008, 4, 663–675. [Google Scholar] [CrossRef] [Scilit]
  10. Uluğ, A. Detection and confirmation of diagnostic microsatellite loci in Populus nigra and Populus deltoides to identify their hybrids (P. × canadensis). Turk. J. Bot. 2022, 46, 603–613. [Google Scholar] [CrossRef] [Scilit]
  11. Fossati, T.; Grassi, F.; Sala, F.; Castiglione, S.S. Molecular analysis of natural populations of Populus nigra L. intermingled with cultivated hybrids. Mol. Ecol. 2003, 12, 2033–2043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Rathmacher, G.; Niggemann, M.; Köhnen, M.; Ziegenhagen, B.; Bialozyt, R. Short-distance gene flow in Populus nigra L. accounts for small-scale spatial genetic structures: Implications for in situ conservation measures. Conserv. Genet. 2010, 11, 1327–1338. [Google Scholar] [CrossRef] [Scilit]
  13. Khasa, D.; Nadeem, S.; Thomas, B.; Robertson, A.; Bousquet, J. Application of SSR markers for parentage analysis of Populus clones. For. Genet. 2003, 10, 273–281. [Google Scholar]
  14. Rathmacher, G.; Niggemann, M.; Wypukol, H.; Gebhardt, K.; Ziegenhagen, B.; Bialozyt, R. Allelic ladders and reference genotypes for a rigorous standardization of poplar microsatellite data. Trees 2009, 23, 573–583. [Google Scholar] [CrossRef] [Scilit]
  15. Liesebach, H.; Schneck, V.; Ewald, E. Clonal fingerprinting in the genus Populus L. by nuclear microsatellite loci regarding differences between sections, species and hybrids. Tree Genet. Genomes 2010, 6, 259–269. [Google Scholar] [CrossRef] [Scilit]
  16. Van der Schoot, J.; Pospíšková, M.; Vosman, B.; Smulders, M.J.M. Development and characterization of microsatellite markers in black poplar (Populus nigra L.). Theor. Appl. Genet. 2000, 101, 317–322. [Google Scholar] [CrossRef] [Scilit]
  17. Smulders, M.J.M.; Van der Schoot, J.; Arens, P.; Vosman, B. Trinucleotide repeat microsatellite markers for black poplar (Populus nigra L.). Mol. Ecol. Notes 2001, 1, 188–190. [Google Scholar] [CrossRef] [Scilit]
  18. Khasa, D.; Pollefeys, P.; Navarro-Quezada, A.; Perinet, P.; Bousquet, J. Species-specific microsatellite markers to monitor gene flow between exotic poplars and their natural relatives in eastern North America. Mol. Ecol. Notes 2005, 5, 920–923. [Google Scholar] [CrossRef] [Scilit]
  19. Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef] [Scilit]
  20. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Scilit]
  21. Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef] [Scilit]
  22. Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [Scilit]
  23. Falush, D.; Stephens, M.; Pritchard, J.K. Inference of population structure using multilocus genotype data: Linked loci and correlated allele frequencies. Genetics 2003, 164, 1567–1587. [Google Scholar] [CrossRef] [Scilit]
  24. Falush, D.; Stephens, M.; Pritchard, J.K. Inference of population structure using multilocus genotype data: Dominant markers and null alleles. Mol. Ecol. 2007, 7, 574–578. [Google Scholar] [CrossRef] [Scilit]
  25. Hubisz, M.J.; Falush, D.; Stephens, M.; Pritchard, J.K. Inferring weak population structure with the assistance of sample group information. Mol. Ecol. Resour. 2009, 9, 1322–1332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Scilit]
  27. Li, Y.L.; Liu, J.X. StructureSelector: A web based software to select and visualize the optimal number of clusters using multiple methods. Mol. Ecol. Resour. 2018, 18, 176–177. [Google Scholar] [CrossRef] [Scilit]
  28. Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. CLUMPAK: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef] [Scilit]
  29. Čížková, L.; Cvrčková, H.; Máchová, P. Možnosti využití domácích druhů rodu Populus v lesnické praxi (Possibilities for the use of native Populus species in forestry practice). Lesn. Průvodce 2020, 2, 33. [Google Scholar]
  30. Vanden Broeck, A. EUFORGEN Technical Guidelines for Genetic Conservation and Use for European Black Poplar (Populus nigra); International Plant Genetic Resources Institute: Rome, Italy, 2003; p. 6. [Google Scholar]
  31. De-Lucas, A.I.; Santana, J.C.; Recio, P.; Hidalgo, E. SSR-based tool for identification and certification of commercial Populus clones in Spain. Ann. For. Sci. 2008, 65, 107. [Google Scholar] [CrossRef] [Scilit]
  32. Ziegenhagen, B.; Gneuss, S.; Rathmacher, G.; Leyer, I.; Bialozyt, R.; Heinze, B.; Liepelt, S. A fast and simple genetic survey reveals the spread of poplar hybrids at natural Elbe river site. Conserv. Genet. 2008, 9, 373–379. [Google Scholar] [CrossRef] [Scilit]
  33. Chenault, N.; Arnaud-Haond, S.; Juteau, M.; Valade, R.; Almeida, J.-L.; Villar, M.; Bastien, C.; Dowkiw, A. SSR-based analysis of clonality, spatial genetic structure and introgression from the Lombardy poplar into a natural population of Populus nigra L. along the Loire River. Tree Genet. Genomes 2011, 7, 1249–1262. [Google Scholar] [CrossRef] [Scilit]
  34. Holub, J.; Procházka, F. Red List of vascular plants of the Czech Republic—2000. Preslia 2000, 72, 187–230. [Google Scholar]
  35. Pospíšková, M.; Šálková, I. Population structure and parentage analysis of black poplar along the Morava River. Can. J. For. Res. 2006, 36, 1067–1076. [Google Scholar] [CrossRef] [Scilit]
  36. Wójkiewicz, B.; Lewandowski, A.; Żukowska, W.B.; Litkowiec, M.; Wachowiak, W. Low effective population size and high spatial genetic structure of black poplar populations from the Oder valley in Poland. Ann. For. Sci. 2021, 78, 37. [Google Scholar] [CrossRef] [Scilit]
  37. Tröber, U.; Wolf, H. Erhaltung der Schwarz–Pappel (Populus nigra L.) in Sachsen: Erfassung, Charakterisierung und Vermehrung auf genetischer Grundlage. Forstarchiv 2015, 86, 166–173. [Google Scholar]
  38. Ciftci, A.; Karatay, H.; Küçükosmanoğlu, F.; Karahan, A.; Kaya, Z. Genetic differentiation between clone collections and natural populations of European black poplar (Populus nigra L.) in Turkey. Tree Genet. Genomes 2017, 13, 69. [Google Scholar] [CrossRef] [Scilit]
  39. Pospíšková, M.; Bartáková, I. Genetic diversity of a black poplar population in the Morava river basin assessed by microsatellite analysis. For. Genet. 2004, 11, 257–262. [Google Scholar]
  40. Żukowska, W.B.; Lewandowski, A. Genetic structure and divergence of marginal populations of black poplar (Populus nigra L.) in Poland. Sci. Rep. 2025, 15, 3014. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Localities of the studied poplar trees (Descriptions of localities are in Supplementary Material Table S3). The base map is the Fundamental Topographic Map of the Czech Republic at a scale of 1:50,000 (source: Czech Office for Surveying, Mapping and Cadastre—ČÚZK).
Figure 1. Localities of the studied poplar trees (Descriptions of localities are in Supplementary Material Table S3). The base map is the Fundamental Topographic Map of the Czech Republic at a scale of 1:50,000 (source: Czech Office for Surveying, Mapping and Cadastre—ČÚZK).
Forests 16 01389 g001
Figure 2. Graphical representation of Fst differences among P. nigra, hybrid poplars and reference samples of P. deltoides, Populus ×euroamericana.
Figure 2. Graphical representation of Fst differences among P. nigra, hybrid poplars and reference samples of P. deltoides, Populus ×euroamericana.
Forests 16 01389 g002
Figure 3. The optimal number of clusters.
Figure 3. The optimal number of clusters.
Forests 16 01389 g003
Figure 4. Structure analysis results with K = 2 for P. nigra, P. deltoides, Populus ×euroamericana and hybrid poplars.
Figure 4. Structure analysis results with K = 2 for P. nigra, P. deltoides, Populus ×euroamericana and hybrid poplars.
Forests 16 01389 g004
Figure 5. Structure analysis results with K = 4 for P. nigra, P. deltoides, Populus ×euroamericana and hybrid poplars.
Figure 5. Structure analysis results with K = 4 for P. nigra, P. deltoides, Populus ×euroamericana and hybrid poplars.
Forests 16 01389 g005
Table 1. The specific sizes of alleles in diagnostic markers WPMS09, WPMS18, PMGC14, PMGC2163, PMGC456 for reference samples P. deltoides.
Table 1. The specific sizes of alleles in diagnostic markers WPMS09, WPMS18, PMGC14, PMGC2163, PMGC456 for reference samples P. deltoides.
Microsatellite LociWPMS09WPMS18PMGC14PMGC2163PMGC456
Reference SamplesAllele Sizes (bp)Allele Sizes (bp)Allele Sizes (bp)Allele Sizes (bp)Allele Sizes (bp)
P.d._012322322142141901901851858282
P.d._022322322142141931931851858282
P.d._032322322142141931931851858282
P.d._042322322142141901901851858282
P.d._052322322142141931931851858282
P.d._062322322142141901901851858282
P.d._072322322142141931931851858282
P.d._082322322142141901901851858282
P.d._092322322142141931931851858282
P.d._102322322142141931931851858282
P.d._112322322142141931931851858282
P.d._122322322142141931931851858282
P.d._132322322142141931931851858282
P.d._142322322142141931931851858282
Table 2. The sizes of alleles in diagnostic markers WPMS09, WPMS18, PMGC14, PMGC2163, PMGC456 for reference samples Populus ×euroamericana.
Table 2. The sizes of alleles in diagnostic markers WPMS09, WPMS18, PMGC14, PMGC2163, PMGC456 for reference samples Populus ×euroamericana.
Microsatellite LociWPMS09WPMS18PMGC14PMGC2163PMGC456
Reference SamplesAllele Sizes (bp)Allele Sizes (bp)Allele Sizes (bp)Allele Sizes (bp)Allele Sizes (bp)
’Robusta’2322502142141902231852237682
SP-012322602142291902231852237682
SP-022502502142261932021852437882
SP-032322502142141902231852237682
SP-042322602142291932111852237682
SP-052322582142291902051852397682
SP-062322502142141902231852497682
SP-072522522142231901991852277682
SP-082322502142231902081852397682
SP-092502502142261932051852437682
Table 3. Allele size ranges of microsatellite markers in studied poplar trees (Number of analysed individual is 339 P. nigra trees and 39 hybrid poplars trees and reference samples: 14 P. deltoides, 10 Populus ×euroamericana).
Table 3. Allele size ranges of microsatellite markers in studied poplar trees (Number of analysed individual is 339 P. nigra trees and 39 hybrid poplars trees and reference samples: 14 P. deltoides, 10 Populus ×euroamericana).
Range of Allele Sizes in Number of Base Pairs (bp)
LociP. nigraPopulus deltoides
Reference Samples
Populus ×euroamericana
Reference Samples
Hybrid Poplars
from Nature Localities
WPMS01119–168111, 113111–151111–151
WPMS04231–319249–275249–289
WPMS07213–271223–269221–259221–267
WPMS09240–294232232–260232–264
WPMS10224–266230–236230–244230–258
WPMS11175–227173–177175–197175–189
WPMS13108–144102, 104102–140102–138
WPMS14228–285234–288231–276246–279
WPMS16136–163133, 139133–148133–151
WPMS18217–241214214–229214–229
WPMS19185–245203–224188–236203–236
WPMS21258–327267–327264–312270–312
WPMS2282–160121–13982–14585–133
PMGC14196–226190,193190–223190–223
PMGC2163215–253185185–249185–249
PMGC45676, 788276, 8276, 82
Table 4. Genetic characteristics of 13 nuclear microsatellite loci across selected 337 poplars black.
Table 4. Genetic characteristics of 13 nuclear microsatellite loci across selected 337 poplars black.
Locus/Repeat MotifPrimer Sequence (5′–3′)Allelic Size Range in bpNaNeIHoHePICThe Highest Allele Frequencies
WPMS01
(GA)20
F: AACCACTATGCCACCTTCTT
R: AACTAACTCCATTCATTGCTAAA
119–1682214.032.820.830.930.9212% for allele 131
WPMS04
(GT)25
F: TACACGGGTCTTTTATTCTCT
R: TGCCGACATCCTGCGTTCC
231–31941133.050.880.920.9219% for allele 255
WPMS07
(GT)24
F: ACTAAGGAGAATTGTTGACTAC
R: TATCTGGTTTCCTCTTATGTG
213–2712610.782.680.820.910.9018% for allele 259
WPMS09
(GT)21 (GA)24
F: CTGCTTGCTACCGTGGAACA
R: AAGCAATTTGGGTCTGAGTATCTG
240–294186.672.20.760.850.8428% for allele 250
WPMS10
(GT)23
F: GATGAGAAACAGTGAATAGTAAGA
R: GATTCCCAACAAGCCAAGATAAAA
224–266178.522.390.710.880.8719% for alleles 244, 250
WPMS11
(GT)26
F: TAAAGATGATGGACTGAAAAGGTA
R: TAAAGGAGAATATAAGTGACAGTT
175–227259.542.570.640.90.8922% for allele 187
WPMS13
(GT)22
F: GATCCTGAACAATGTCGTACTTC
R: ACGATAACCTGCGAGAAATGT
108–1441710.72.520.910.910.9015% for allele 132
WPMS14
(CGT)28-3
F: CAGCCGCAGCCACTGAGAAATC
R: GCCTGCTGAGAAGACTGCCTTGAC
228–285198.122.380.940.880.8723% for allele 228
WPMS16
(GTC)8(ATCCTC)5
F: CTCGTACTATTTCCGATGATGACC
R: AGATTATTAGGTGGGCCAAGGACT
136–16395.251.770.750.810.7828% for allele 136
WPMS18
(GTG)13
F: CTTCACATAGGACATAGCAGCATC
R: CACCAGAGTCATCACCAGTTATTG
217–241104.11.60.420.760.7234% for allele 223
WPMS19
(CAG)28-3
F: AGCCACAGCAAATTCAGATGATGC
R: CCTGCTGAGAAGACTGCCTTGACA
185–245176.512.140.840.850.8324% for allele 185
WPMS21
(GCT)45-12
F: TGCTGATGCAAAAGATTTAG
R: TTGGAACTTCAACATTCAGAT
258–327239.652.560.820.90.8919% for allele 281
WPMS22
(TGA)23
F: ACATGCTACGTGTTTGGAATG
R: ATCGTATGGATGTAATTGTCTTA
82–1602814.32.890.80.930.9312% for allele 121
Na—number of different alleles, Ne—mean number of effective alleles I—Shannon’s information index, Ho—observed heterozygosity, He—expected heterozygosity, PIC—polymorphic information content.
Table 5. Pairwise Fst values between P. nigra, hybrid poplars and reference samples of P. deltoides, and Populus ×euroamericana.
Table 5. Pairwise Fst values between P. nigra, hybrid poplars and reference samples of P. deltoides, and Populus ×euroamericana.
P. nigra P. deltoides Populus ×euroamericana Hybrid Poplars
P. nigra 0
P. deltoides 0.223 0
Populus ×euroamericana 0.075 0.183 0
Hybrid poplars 0.079 0.200 0.057 0
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cvrčková, H.; Máchová, P.; Čížková, L.; Vítová, K.; Trčková, O.; Fulín, M. Microsatellite Markers as a Useful Tool for Species Identification and Assessment of Genetic Diversity of the Endangered Species Populus nigra L. in the Czech Republic. Forests 2025, 16, 1389. https://doi.org/10.3390/f16091389

AMA Style

Cvrčková H, Máchová P, Čížková L, Vítová K, Trčková O, Fulín M. Microsatellite Markers as a Useful Tool for Species Identification and Assessment of Genetic Diversity of the Endangered Species Populus nigra L. in the Czech Republic. Forests. 2025; 16(9):1389. https://doi.org/10.3390/f16091389

Chicago/Turabian Style

Cvrčková, Helena, Pavlína Máchová, Luďka Čížková, Kateřina Vítová, Olga Trčková, and Martin Fulín. 2025. "Microsatellite Markers as a Useful Tool for Species Identification and Assessment of Genetic Diversity of the Endangered Species Populus nigra L. in the Czech Republic" Forests 16, no. 9: 1389. https://doi.org/10.3390/f16091389

APA Style

Cvrčková, H., Máchová, P., Čížková, L., Vítová, K., Trčková, O., & Fulín, M. (2025). Microsatellite Markers as a Useful Tool for Species Identification and Assessment of Genetic Diversity of the Endangered Species Populus nigra L. in the Czech Republic. Forests, 16(9), 1389. https://doi.org/10.3390/f16091389

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop