Next Article in Journal
The Complete Chloroplast Genome of Purdom’s Rhododendron (Rhododendron purdomii Rehder & E. H. Wilson): Genome Structure and Phylogenetic Analysis
Previous Article in Journal
The Phenophases of Mixed-Forest Species Are Regulated by Photo-Hydro-Thermal Conditions: An Approach Using UAV-Derived and In Situ Data
Previous Article in Special Issue
Histological Analysis of Dothistroma septosporum Infection on Different Provenances of Pinus sylvestris
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 16
Issue 7
10.3390/f16071119
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Mapping the Distribution of Viruses in Wild Apple Populations in the Southeast Region of Kazakhstan

by
Nazym Kerimbek
1,2,
Marina Khusnitdinova
1,
Aisha Taskuzhina
1,2,3,
Anastasiya Kapytina
1,2,
Alexandr Pozharskiy
1,
Abay Sagitov
1 and
Dilyara Gritsenko
1,2,3,*
1
Laboratory of Molecular Biology, Institute of Plant Biology and Biotechnology, Almaty 050040, Kazakhstan
2
Department of Molecular Biology and Genetics, Al Farabi Kazakh National University, Almaty 050040, Kazakhstan
3
Research Center AgriBioTech, Almaty 050040, Kazakhstan
*
Author to whom correspondence should be addressed.
Forests 2025, 16(7), 1119; https://doi.org/10.3390/f16071119
Submission received: 20 May 2025 / Revised: 23 June 2025 / Accepted: 4 July 2025 / Published: 6 July 2025
(This article belongs to the Special Issue Forest Pathogens: Detection, Diagnosis, and Control)
Browse Figures
Versions Notes

Abstract

Kazakhstan is recognized as one of the primary centers of origin of the wild apple Malus sieversii, concentrated mainly in the mountains like Trans-Ile and Zhongar Alatau, as well as parts of the Tarbagatay, Talas Alatau, and Karatau ranges. As the wild progenitor of Malus domestica, M. sieversii harbors a critical genetic diversity essential for apple breeding and conservation efforts. However, its natural populations are increasingly threatened by latent viral infection, which weakens trees, reduces reproduction, and hinders regeneration. In this study, the spread of apple chlorotic leaf spot virus (ACLSV) and apple stem pitting virus (ASPV) was documented in four wild apple populations, with detection rates of 50.2% and 42.2%, respectively. Mixed infections were observed in 28.8% of sampled trees. Apple stem grooving virus (ASGV) was detected exclusively in cultivated orchards, whereas apple mosaic virus (ApMV) and apple necrotic mosaic virus (ApNMV) were not found in either wild forests or cultivated orchards. Using Geographic Information System (GIS) technology, we developed the first spatial distribution maps of these viruses in wild apple forests in the Tian Shan region, revealing site-specific variation and infection rates. These results underscore the importance of monitoring viral infections in wild M. sieversii populations to preserve genetically valuable, virus-free germplasm critical for apple breeding, crop improvement, and sustainable orchard management.

1. Introduction

Malus sieversii, M. kirghisorum, and M. niedzwetzkyana—members of the Rosaceae family—form continuous wild apple forests across five mountain ranges in Kazakhstan, covering approximately 1463 km2 [1,2]. Kazakhstan is recognized as one of the primary centers of origin of M. sieversii and plays a vital role in conserving natural populations of this ancient species [1,3,4,5,6,7].
The majority of the apple forest area is found in the Zhongar Alatau (49%) and Trans-Ile Alatau (25%), with smaller proportions located in the Karatau (12.1%), Talas Alatau (11.7%), and Tarbagatay (2%) ranges [1,2,3]. Additionally, six genetic reserves of M. sieversii have been established in the Zhongar-Alatau State National Nature Park (SNNP), covering a total area of 510 hectares, along with a genetic reserve spanning 31.9 hectares in the Ile-Alatau SNNP [3]. Substantial and intact wild apple forests are also present in a few regions of Eurasia, namely Kyrgyzstan (483 km2), Tajikistan (84 km2), Uzbekistan (42 km2), and China’s Xinjiang region (693 km2). These areas host several wild apple species, including M. sieversii, M. kirghisorum, and M. niedzwetzkyana [7,8,9].
M. sieversii is the dominant species in Central Asian forests and represents the ancestral progenitor of the domesticated apple [7,10,11], harboring valuable genetic resources for breeding apple varieties and rootstocks resistant to biotic and abiotic factors [1]. Genome re-sequencing has revealed that approximately 46% of the M. domestica genome originates from M. sieversii grown in Kazakhstan, 21% originates from M. sylvestris, and 33% originates from unknown sources [12]. Numerous disease resistance loci have been identified in M. sieversii, including those against apple scab, caused by fungal pathogen Venturia inaequalis [13,14], and fire blight, caused by bacterial pathogen Erwinia amylovora [15]. Different levels of fire blight resistance among M. sieversii accessions from Kazakhstan have been reported in several studies [3,16,17,18,19]. In particular, greenhouse inoculation trials have shown that M. sieversii accessions exhibit a wide range of fire blight resistance—from highly resistant (<10% lesion length) to highly susceptible (>75%)—with approximately 46% classified as resistant or highly resistant [20]. In addition, M. sieversii exhibits a high level of genetic diversity and harbors numerous unique alleles absent in cultivated apple varieties, making it a key reservoir of novel traits for enhancing apple quality and disease resistance [19]. However, limited information is available on the resistance or susceptibility of M. sieversii to viral diseases, which can severely compromise tree health and lead to the extinction of entire populations [16]. Nevertheless, M. sieversii has been actively used in breeding programs as a source of resistance to major diseases, including fire blight, apple scab, blue mold, and powdery mildew. Its resistance is linked to key defense pathways and validated resistance genes. QTLs such as Msv_FB7 and Rvi8 have been mapped in M. sieversii backgrounds and applied in marker-assisted selection. Its genetic compatibility with M. domestica, large fruit size, and diverse self-incompatibility alleles make it valuable for both scion and rootstock improvement, including contributions to the Geneva® rootstock series [11].
The main viruses affecting apple populations worldwide—often occurring in mixed infections that lead to significant yield reductions— include apple chlorotic leaf spot virus (ACLSV; Trichovirus mali, family Betaflexiviridae), apple stem grooving virus (ASGV; Capillovirus mali, family Betaflexiviridae), and apple stem pitting virus (ASPV; Foveavirus mali, family Betaflexiviridae). These viruses are widespread in all apple-growing countries, as confirmed by numerous studies [17,18,19,20,21,22,23,24,25,26,27,28,29,30]. The diseases caused by ACLSV, ASGV, and ASPV are typically asymptomatic [31]. However, recent studies have demonstrated that even latent infections can significantly reduce the physiological functions of trees, including photosynthetic efficiency, primary metabolism, and fruit quality, despite the absence of visible symptoms [32]. Co-infections may contribute to physiological decline, as suggested by RNA-seq research revealing 17 novel viruses in apple trees alongside known viruses such as ACLSV and ASPV, indicating potential synergistic effects [33]. Although the full impact on wild apple populations remains unclear, the presence of multiple latent viruses in susceptible genotypes highlights the importance of identifying pathogenicity and preserving virus-free wild germplasm [17,18,33]. As an example, ACLSV has been detected in a range of wild Rosaceous fruit tree relatives, where latent infections may gradually compromise population health and conservation value, and reduce reproductive fitness, fruit quality, and genetic diversity [25,26,27]. The scope of the current research was to detect and map, for the first time, the distribution of the main apple viruses in wild apple populations in southeastern Kazakhstan using a GIS. Understanding and mapping the geographic distribution of apple viruses are essential for tracking the territorial dynamics of viral disease spread in apple populations, facilitating the analysis and assessment of infection scale and dissemination. Another aim was to localize virus-free genotypes for subsequent conservation. To identify viral pathogens, wild and cultivated apple trees were tested for the presence of five major viruses, namely, ACLSV, ApMV, ASGV, ASPV, and ApNMV using RT-qPCR.

2. Materials and Methods

2.1. Botanical Description and Sampling

A set of morphological qualitative descriptors was assessed on the trunks and leaves of apple trees in late summer 2023. Descriptors were retrieved from IBPGR and UPOV [34,35] and included growth form, tree height, crown architecture, leaf size and shape, margin type, and petiole length. In addition, leaves were examined visually for the presence of possibly viral infection symptoms, such as chlorosis, mosaic patterns, ring spots, yellowing, and deformation.
Symptomatic and asymptomatic leaves attached to branches of wild apple trees were collected in summer 2023 from four sides of each tree across four distinct sites in the Tian Shan Mountains of Kazakhstan (Figure 1; Table 1), while plant material from cultivated apple trees was obtained from three orchards in Shelek (Almaty Region) and Taraz (Zhambyl Region) (Figure 1; Table 1). Immediately after collection, all leaf and branch samples were placed in sterile, RNase-free plastic bags and stored in a portable cooler at 4 °C in the field. Samples were transported to the laboratory within 24 h and stored at –80 °C until RNA extraction. The wild apple sampling sites, including Sumbe, Ketpentau, Tauturgen, and the Sievers Apple Reserve, were located in remote forested areas of the Uygur and Enbekshikazakh Districts, at varying distances from the cultivated orchards (Table 1).
A total of 342 apple trees were sampled across the seven locations, comprising 225 wild trees and 117 cultivated orchard trees.
Photo documentation of the study area was carried out using a DJI Mavic 3 Multispectral unoccupied aerial vehicle DJI (DJI Sky City, Shenzhen, China). The DJI Mavic 3M enables the aerial imaging of wild apple forests while accounting for terrain features, including those on sloped landscapes.

2.2. Assessment of Disease Distribution

Disease distribution across populations was assessed following the methodology described in [3], with the prevalence calculated as a percentage using the following formula:
P = H ∗ 100 N
where P is the disease prevalence (%), H is the number of infected trees, and N is the total number of trees evaluated within the population.
Each tree was treated as an independent biological replicate. For each individual, three to five fully expanded leaves were sampled from different canopy positions, including both symptomatic and asymptomatic tissues, and visual assessments were performed in situ. Trees were classified as infected if visible symptoms were present on ≥20% of leaves, including chlorosis, mosaic or mottling, ring spots, deformation, blackening, olive-brown lesions, premature defoliation, bark necrosis, shoot dieback, or wilting.

2.3. RNA Isolation and RT-qPCR Detection

The total RNA was extracted from 100 mg of the leaf fragments using the FastPure Universal Plant Total RNA Isolation Kit (Vazyme, Nanjing, China), following the manufacturer’s protocol, from phloem-rich tissues of leaves (from major veins) and branches (after bark removal). For each tree, samples were collected from all four sides to ensure representative coverage. Approximately 100 mg of combined tissue per tree was used for extraction. The quality of the isolated RNA was verified using 2% TAE agarose gel electrophoresis and a Qubit™ Flex Fluorometer (ThermoFisher Scientific, Waltham, MA, USA). Reverse transcription was conducted using RevertAid Reverse Transcriptase from Thermo Scientific, USA. The first step involved the incubation of a mixture containing 200 ng of total RNA, 0.5 μM of Oligo-dT, and 0.5 μM of random hexamer primers in a final volume of 15 μL at 72 °C for 10 min, followed by cooling on ice for 3 min. In the next step, 5× RT reaction buffer (ThermoFisher Scientific, Waltham, MA, USA), 0.5 mM dNTPs, and 200 U of RevertAid reverse transcriptase (ThermoFisher Scientific, Waltham, MA, USA) were added, and the mixture was incubated at 45 °C for an hour. qPCR was performed using a Luna Universal qPCR Master Mix Kit (New England Biolabs Inc., Ipswich, MA, USA) with the primers listed in Table 2. The reaction mixture was prepared according to the manufacturer’s protocol, and thermal cycling conditions were applied as described in the original publications [36,37,38].

2.4. Mapping of Infected Apple Trees

The geographic coordinates were recorded for each tree in the wild apple populations (225 points) and commercial orchards (117 points) across the study area using a Garmin Montana 750i GPS device (Kansas City, MO, USA). To map of the sampling locations based on the GPS coordinates, the Lat Lon Tools plugin [39] in the Quantum Geographic Information System (QGIS 3.28) [40] was utilized.
Subsequently, seven control point density maps were generated—for wild apple populations and commercial orchards separately—with each population represented in an individual layer.
A unique color scheme was assigned to the sampling points of each population to facilitate the visualization and tracking of dynamic changes. The coordinate reference system used was WGS 84, EPSG: 4326, with Unicode Transformation Format 8-bit encoding.
The data tables for each population layer were then updated with information on all detected viruses. In addition, the sampling points were color-coded to distinguish between trees free from viruses and those infected with one or more viruses. Labels indicating the specific virus or group of viruses identified were added above each infected sampling point.
Finally, seven viral infection rate distribution maps were generated for each site, reflecting the infection status of all sampled trees. Moran’s coefficient I of spatial autocorrelation for each population and virus and the local Pearson correlation coefficient (LPCC) were calculated using R package lctools v. 0.2-10 [41].

3. Results

3.1. Botanical and Phytopathological Descriptions of Wild Apple Populations

Wild apple samples were collected from populations growing under moderately continental mountain conditions, characterized as being 1200–1700 m above sea level, with an annual precipitation between 500 and 1000 mm and seasonal temperature ranges of +18–27 °C in summer and –15 °C or lower in winter. Within these habitats, M. sieversii occurs in mixed-forest communities, alongside species such as Armeniaca vulgaris, Acer semenovii, Populus tremula, and Crataegus spp. The understory is composed of shrubs, including Rosa platyacantha, Lonicera stenantha, Berberis heteropoda, and Rhamnus cathartica, with a ground layer dominated by mesophytic and xerophytic grasses and herbs (Figure 2).
The examined apple trees were characterized by the presence of 3–4 trunks per individual, suggesting a multi-stemmed growth form commonly observed in unmanaged populations. This growth pattern is primarily driven by vegetative renewal mechanisms, primarily the development of root suckers and, to a lesser extent, stool shoots, adventitious root formation and accretion, or self-grafting. Over time, root suckers mature into independent trunks, contributing to the formation of multi-stemmed individuals typical of natural M. sieversii populations [2]. The tree height averaged approximately 9 m, indicating mature individuals that had not been subjected to pruning. The crown architecture was predominantly pyramidal, reflecting a vertical growth tendency. Leaf traits included medium-sized leaves with an ovate-to-elliptical shape and dark green coloration. The leaf margins were predominantly serrated, and the petiole length ranged from moderate to long, facilitating efficient leaf arrangement and light interception in dense canopy environments. The wild apple trees were estimated to be 30 to 70 years old based on morphological indicators and field-based age classification frameworks, such as those developed by Dzhangaliev [2], as well as tree-ring analysis where feasible. Tree spacing was irregular, with distances ranging from closely clustered individuals to trees separated by several meters, depending on the terrain and density.
During the survey, apple leaves exhibiting possible viral infection symptoms, such as chlorosis, yellowing, olive-brown lesions with feathery margins, necrosis, and deformation, were considered indicative of phytopathogenic infections, as previously described for diseases such as apple scab [42], bitter rot and black rot [43], alternaria blotch [44], and fire blight [45] (Figure 3). Only trees exhibiting symptoms on at least 20% of their emerged leaves were taken into account. Trees showing mechanical damage, including broken branches, bark lesions, or trunk wounds resulting from wind or animal interference, were excluded from the analysis. Although no quantitative measurements (e.g., trunk diameter, leaf dimensions, disease severity scores) were collected, qualitative observations offer valuable insight into the structural and health status of wild apple populations. Infection symptoms were frequently observed in Tauturgen, Sumbe, and Ketpentau populations, where approximately 45%–50% of the wild apple trees displayed visible signs of disease. The least infected populations were identified in the Sievers Apple Reserve (15%–20%), as well as in fields located in Taraz (1%–5%) and Shelek (1%–3%). Future studies using standardized morphometric and disease scoring methods would improve resolution of these findings.

3.2. Distribution of Viruses in Wild Apple Populations

A comprehensive analysis was conducted on a total of 342 apple samples, comprising 225 wild apple samples collected from Sumbe, Ketpentau, Tauturgen, and the Sievers Apple Reserve and 103 and 14 cultivated apple samples sourced from Taraz and Shelek, respectively.
Among the 225 wild apple trees tested, 33.7% (76 samples) were infected with at least one of the monitored viruses. ACLSV was detected in 50.2% (113 samples) of the trees, while ASPV was present in 42.2% (95 samples). ASGV was not detected in any of the samples. Mixed infections involving both ACLSV and ASPV were identified in 28.8% (65 samples) of the trees (Figure 4). These findings clearly indicate that the surveyed viruses are prevalent within wild apple populations in the region.
Cartographic models were developed for each population, indicating sample collection points and the corresponding infection status, to understand the spatial distribution of viruses in wild apple populations in the Tian Shan region.
Among the 50 samples tested from Ketpentau (Figure 5 and Table 1), 32% (16 samples) were virus-free, while 30% (15 samples) were infected with a single virus. Mixed infections involving both ACLSV and ASPV were found in 38% (19 samples) of the tested trees (Figure 4). ACLSV was detected in 46% (23 samples) of the trees, and ASPV was detected in 60% (30 samples). ASGV was not detected.
Of the 50 samples tested from Sumbe (Figure 5 and Table 1), 24% (12 samples) were virus-free, and 40% (20 samples) were infected with a single virus. ACLSV and ASPV were each detected in 56% (28 samples) of the tested trees. ASGV was not detected. Mixed infections involving ACLSV and ASPV were found in 36% (18 samples) of the samples (Figure 4).
Among the 55 samples tested from Tauturgen (Figure 5 and Table 1), 25.4% (14 samples) were virus-free, and 30.9% (17 samples) were infected with a single virus. ACLSV was detected in 60% (33 samples) of the samples, and ASPV was detected in 58.1% (32 samples). ASGV was not detected. Mixed infections involving both ACLSV and ASPV were identified in 43.6% (24 samples) of the tested trees (Figure 4).
Of the 70 samples tested from the Sievers Apple Reserve (Figure 5 and Table 1), 57.1% (40 samples) were virus-free and 37.1% (26 samples) were infected with a single virus. ACLSV was detected in 41.4% (29 samples) of the trees, and ASPV was detected in 7.1% (5 samples). ASGV was not detected. Mixed infections involving ACLSV and ASPV were found in 5.7% (four samples) of the tested trees (Figure 4).
A total of 14 M. domestica samples from an orchard located in Shelek, Enbekshikazakh District (Figure 6 and Table 1), were analyzed for the presence of apple viruses.
Among the 14 samples tested, 64% (nine samples) were free of viral infection. The survey revealed a moderate infection rate, with 28.6% (four samples) of the samples testing positive for at least one of the monitored viruses (Figure 4). ACLSV was not detected. ASPV was the most frequently identified virus, present in 35.7% (five samples) of the trees, followed by ASGV, which was detected in 7.1% (one sample). Mixed infections involving both ASPV and ASGV were observed in 7.1% (one sample) of the sampled trees.
The two cultivated apple orchards were located in Taraz (Figure 6 and Table 1). Among the 103 samples tested, 32% (33 samples) were free of viral infection. The survey revealed a moderate infection rate, with 27.2% (28 out of 103) of the samples testing positive for at least one of the monitored viruses (Figure 4). ACLSV was detected in 40.7% (42 samples). ASPV was the most frequently detected virus, present in 59.2% (61 samples) of the trees, followed by ASGV at 26.2% (27 samples). Mixed infections were also observed, with the following combinations: ACLSV + ASPV in 32% (33 samples) of the samples, ACLSV + ASPV + ASGV in 17.4% (18 samples), ACLSV + ASGV in 5.8% (6 samples), and ASPV + ASGV in 2.9% (3 samples).
To detect possible spatial effects in the distribution of the viruses, two spatial correlation tests were performed for all populations except Shelek, which had a low sample number (Table 3). Morgan’s autocorrelation test for the occurrence of ACLSV and ASPV revealed significant results for two viruses only in one population: Tauturgen—moderate correlation (0.5121, p-value 3.59 × 10−12) for ACLSV and weak correlation (0.217, p-value 0.002; threshold p < 0.05) for ASPV. The Local Pearson correlation test revealed a significant (threshold p < 0.05) positive correlation between the distribution of two viruses in two populations—Ketpentau (LPCC = 0.4259, p-value = 0.002) and Tauturgen (LPCC = 0.2750, p-value = 0.042)—and a significant weak negative correlation was found in Taraz samples of M. domestica (LPCC = −0.3294, p-value = 6.8 × 10−4). The population from Tauturgen demonstrated significant correlations for both viruses as well as their mutual distribution.

4. Discussion

The current study revealed, for the first time, the widespread occurrence of ACLSV and ASPV in wild apple populations in southeastern Kazakhstan, with significant variations in infection rates and co-infection patterns among four sites. Although these viruses have been previously known to be transmitted exclusively through grafting [16,46,47,48], recent research indicates that seed transmission may also play a role in their dissemination. Previous studies have reported the low-frequency seed transmission of ACLSV and ASPV in apple and pear species, suggesting that vertical transmission may contribute to their persistence and spread, particularly in unmanaged or wild populations [47,49]. Nevertheless, the prevalence of ACLSV and ASPV in the current research, considering the Sumbe and Tauturgen populations, ranged from 40% to 60%, which can hardly be regarded as a low-frequency occurrence. In comparison, the apple trees in the studied orchards, which consisted of cultivated apples, had fewer trees infected with ACLSV and ASPV. Notably, the Sievers Apple Reserve showed the lowest virus incidence among the four wild populations, with ACLSV being the dominant virus. However, the prevalence of ACLSV was still about 40%. A possible explanation for the widespread occurrence of these viruses is seed transmission, considering the history of the development of the tested wild populations. It is known historically that the Sievers Apple Reserve was established through the selection of healthy planting material without symptoms of infections. Thus, the initial infection load of this population including viruses was expected to be lower. To maintain and preserve M. sieversii diversity, several genetic reserves were created in different mountain ranges in Kazakhstan. The Tauturgen and Sievers Apple Reserve populations in Ile-Alatau were established at various times through seed propagation and are located about 700 m apart from each other. The Sievers Apple Reserve population is the oldest, ranging from 60 to 70 years old, among the investigated populations, and it was formed by various parental genotypes collected from diverse mountain ranges. In contrast, Tauturgen is a relatively young population, with the trees being only 30 to 40 years old, and it was created using several parental genotypes, where seeds from one tree were planted over a large area. The Sumbe and Ketpentau populations are the same age, approximately 40–50 years old, and they were planted with seeds from a limited number of parental genotypes collected from up to three different populations.
The use of seeds as primary material from infected apple trees increases the likelihood of virus dissemination, particularly when a single infected parent tree serves as the source for a substantial portion of the population. Previously, Wunsch et al. and Li et al. [46,47] showed the presence of ACLSV and ASPV in the seeds of Pyrusbetulifolia, P. calleryana, and M. domestica. Additionally, the transmission of these viruses to seedlings was confirmed for pear but not for apple. In the case of M. domestica, seeds treated with sodium hypochlorite were used for seedling propagation, which has been suggested as a possible explanation for the absence of viruses in the resulting plants [49,50]. ACLSV and ASPV contaminate the seed coat and are considered transmitted during the process of seed germination. Seed treatment is therefore considered an effective method for eliminating pathogens localized on the seed surface [50]. The initial introduction of ACLSV and ASPV into wild apple populations remains debatable. One likely route is the historical grafting of cultivated M. domestica varieties onto wild M. sieversii rootstocks in Kazakhstan’s mountain forests, as part of the mid-20th-century domestication efforts under Soviet programs. These interventions had significant ecological consequences. Grafting overlooked key biological principles—scions grafted onto poorly developed root-sucker trees showed high mortality and long-term instability due to physiological incompatibility, impaired nutrient flow, and increased susceptibility to disease and desiccation.
Additionally, anthropogenic pressures such as tree thinning, grazing, shrub removal, and hay mowing disrupted both seed-based and vegetative regeneration processes, leading to reduced recruitment, altered microhabitats, and the loss of protective understory layers. Fortunately, grafting was carried out in a limited number of populations, primarily those located in easily accessible mountainous areas. The genetic integrity of M. sieversii was largely preserved despite domestication efforts, as the species in wild habitats was predominantly propagated through vegetative reproduction, specifically via root suckers [2].
However, it is also possible that wild apple trees served as the original source of viral pathogens, given that the primary sources of ACLSV and ASPV have not yet been confirmed, as well as considering that M. sieversii is the progenitor of M. domestica [7,10,11]. Another point of interest is the absence of ASGV in wild apple populations, even though it is present in up to 27% of cultivated apple trees. It is likely that, 50–80 years ago, this virus was also less prevalent in apple orchards and was therefore not transmitted to wild trees through grafting, or that M. sieversii is not among the original host species of ASGV.
While seedborne transmission remains a plausible route for the initial establishment of viruses in the genetically conserved wild populations examined in this study, the long-term persistence and unnoticed spread of ACLSV and ASPV are further facilitated by their predominantly latent nature. This underlines the need for molecular-based analyses and highlights the diagnostic challenges associated with relying solely on visual surveys, which are commonly used in wild habitats. Notably, infected apple trees in wild populations and cultivated orchards have not displayed specific symptoms of viral diseases [32,51,52]. The most common symptoms identified are those of fungal or bacterial infections, including mottling, necrotic spots, irregular yellow-green patterns, brown lesions, and margin deformation [53].
Previous studies have also demonstrated that ACLSV and ASPV often cause latent or asymptomatic infections, especially in tolerant cultivars or unmanaged trees, which complicates early detection and facilitates silent spread [32,54,55]. The ongoing introduction of ACLSV and ASPV from wild apple trees into M. domestica in Kazakhstan is facilitated by the widespread use of M. sieversii as a rootstock for grafting. It is noteworthy that in two populations, Ketpentau and Tauturgen, the distribution of ACLSV and ASPV demonstrated a significant positive correlation, indicating their mixed infection, whereas in Taraz orchards, a weak negative correlation was observed. Currently, large orchards are being established by grafting apple cultivars on M. sieversii from genetic reserves. Understanding the evolution and adaptation of these viruses in cultivated apples following their long-term circulation in wild apple trees is crucial for uncovering the molecular mechanisms underlying host–pathogen interactions.
To visualize the spatial distribution of apple viruses, we employed GIS-based mapping, which revealed clear site-specific patterns across wild populations. In Sumbe and Tauturgen, infected trees—particularly those with co-infections—were densely clustered, indicating localized hotspots of viral presence. In contrast, the Sievers Apple Reserve exhibited a scattered distribution of virus-free trees, while the Ketpentau apple population showed a moderate level of aggregation, with infected trees interspersed among healthy ones (Figure 5 and Figure 6). We presume that the clustered infected trees are the offspring of primarily virus-infected parental genotypes, resulting from the seeding of seeds in a single location derived from one genotype. This indicates that the clustering of these infected trees could significantly influence the genetic dynamics within the population, as viral infections may impact fruit-bearing ability and resilience to environmental stressors. At the same time, certain genotypes may be more vulnerable to viral infections, and they might also possess advantageous traits that contribute to higher yields or better fruit quality. The resulting homogeneity of apple populations leads to less resilience to environmental stresses and disease pressures. The absence of genetic diversity may increase the likelihood of the extinction of entire populations within a few generations. Such a scenario underscores the critical importance of preserving genetic diversity to enhance the overall resilience of these ecosystems. Additionally, it is noteworthy that virus-free trees among the infected ones may be offspring of the infected trees, bearing resistant loci to viral pathogens. These trees are of significant interest for further investigations due to their potential implications for understanding genetic dynamics, disease resistance, and overall ecosystem health.
However, the use of GIS-based mapping specifically for apple virus distribution remains limited, with one example being a recent study on ApNMV conducted in Southwest China, where it was used to illustrate the incidence of apple mosaic disease across orchards in 12 towns within major apple-producing regions [24].
This highlights the need for the continuous monitoring of wild apple population health using remote sensing (RS) and GIS in order to enable timely responses to disease spread across various spatial and temporal scales, particularly in hard-to-reach areas such as those inhabited by the apple populations under study. GIS-based mapping facilitates the collection, visualization, comparison, and analysis of spatial data related to the spread of plant pathogens and pests, among other applications [56,57]. It also allows for the spread of plant diseases to be traced from their point of origin and for potential outcomes to be predicted [58]. To enhance the detection, monitoring, and prediction of plant disease spread, as well as the evaluation of various control strategies, the integration of RS and GIS can provide a powerful tool.

5. Conclusions

This study revealed a high viral load in wild apple populations of the Tian Shan Mountains in southeastern Kazakhstan. Among the 225 wild apple trees tested, 63.6% (143 samples) were infected. Of these, 33.7% (76 samples) were infected with at least one of the monitored viruses, and 28.8% (65 samples) showed mixed infections. Mapping the distribution of viruses in apple populations provides a valuable spatial perspective on dynamic infection and supports the development of strategies aiming to preserve biodiversity and prevent the spread of viral diseases.

Author Contributions

Conceptualization and methodology, D.G.; software, D.G., N.K., M.K., and A.P.; validation and formal analysis, A.P., N.K., and M.K.; investigation D.G., N.K., A.T., A.S., and M.K.; data curation, D.G., N.K., A.T., and A.K.; writing—original draft preparation, N.K. and M.K.; writing—review and editing, D.G., N.K., and M.K.; visualization, M.K. and A.K.; supervision, project administration, and funding acquisition, D.G. All authors have read and agreed to the published version of the manuscript.

Funding

The study was funded by the Ministry of Science and Higher Education of the Republic of Kazakhstan within the framework of a targeted funding program BR21882269 “Using genome editing technology to increase the productivity of economically important crop plants”.

Data Availability Statement

The data obtained in the present work can be provided upon request to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Panyushkina, I.; Mukhamadiev, N.; Lynch, A.; Ashikbaev, N.; Arizpe, A.; O’Connor, C.; Abjanbaev, D.; Mengdibayeva, G.; Sagitov, A. Wild Apple Growth and Climate Change in Southeast Kazakhstan. Forests 2017, 8, 406. [Google Scholar] [CrossRef]
  2. Janick, J. (Ed.) Horticultural Reviews: Volume 29: Wild Apple and Fruit Trees of Central Asia; Horticultural Reviews; Wiley: New York, NY, USA; Chichester, UK, 2003; ISBN 978-0-471-21968-2. [Google Scholar]
  3. Taskuzhina, A.; Pozharskiy, A.; Gritsenko, D. The Contribution of Malus sieversii to the Emergence and Diversity of Domesticated Apple Varieties. In Malus Domestica—New Insights; Ebru Yaşa Kafkas, N., İmrak, B., Eds.; IntechOpen: London, UK, 2024; ISBN 978-0-85014-766-7. [Google Scholar]
  4. Cornille, A.; Giraud, T.; Smulders, M.J.M.; Roldán-Ruiz, I.; Gladieux, P. The Domestication and Evolutionary Ecology of Apples. Trends Genet. 2014, 30, 57–65. [Google Scholar] [CrossRef]
  5. Feurtey, A.; Guitton, E.; De Gracia Coquerel, M.; Duvaux, L.; Shiller, J.; Bellanger, M.-N.; Expert, P.; Sannier, M.; Caffier, V.; Giraud, T.; et al. Asian Wild Apples Threatened by Gene Flow from Domesticated Apples and by Their Pestified Pathogen. Available online: https://www.biorxiv.org/content/10.1101/2020.04.15.042242v1 (accessed on 5 March 2025). [CrossRef]
  6. Feurtey, A.; Guitton, E.; De Gracia Coquerel, M.; Duvaux, L.; Shiller, J.; Bellanger, M.; Expert, P.; Sannier, M.; Caffier, V.; Giraud, T.; et al. Threat to Asian Wild Apple Trees Posed by Gene Flow from Domesticated Apple Trees and Their “Pestified” Pathogens. Mol. Ecol. 2020, 29, 4925–4941. [Google Scholar] [CrossRef]
  7. Tian, Z.; Song, H.; Wang, Y.; Li, J.; Maimaiti, M.; Liu, Z.; Zhang, H.; Zhang, J. Wild Apples Are Not That Wild: Conservation Status and Potential Threats of Malus sieversii in the Mountains of Central Asia Biodiversity Hotspot. Diversity 2022, 14, 489. [Google Scholar] [CrossRef]
  8. Uzun, A.; Turgunbaev, K.; Pınar, H.; Yılmaz, K.U. Apple genetic resources in Kyrgyzstan geography: Determination, evaluation, and conservation. Int. J. Agric. Nat. Sci. 2022, 15, 221–225. [Google Scholar]
  9. Xu, X.; Huai, W.; Hamiti; Zhang, X.; Zhao, W. Phytophthora Species from Xinjiang Wild Apple Forests in China. Forests 2019, 10, 927. [Google Scholar] [CrossRef]
  10. Velasco, R.; Zharkikh, A.; Affourtit, J.; Dhingra, A.; Cestaro, A.; Kalyanaraman, A.; Fontana, P.; Bhatnagar, S.K.; Troggio, M.; Pruss, D.; et al. The Genome of the Domesticated Apple (Malus × Domestica Borkh.). Nat. Genet. 2010, 42, 833–839. [Google Scholar] [CrossRef] [PubMed]
  11. Tegtmeier, R.; Švara, A.; Gritsenko, D.; Khan, A. Malus sieversii: A Historical, Genetic, and Conservational Perspective of the Primary Progenitor Species of Domesticated Apples. Hortic. Res. 2025, 12, uhae244. [Google Scholar] [CrossRef]
  12. Duan, N.; Bai, Y.; Sun, H.; Wang, N.; Ma, Y.; Li, M.; Wang, X.; Jiao, C.; Legall, N.; Mao, L.; et al. Genome Re-Sequencing Reveals the History of Apple and Supports a Two-Stage Model for Fruit Enlargement. Nat. Commun. 2017, 8, 249. [Google Scholar] [CrossRef]
  13. Bus, V.G.M.; Laurens, F.N.D.; Van De Weg, W.E.; Rusholme, R.L.; Rikkerink, E.H.A.; Gardiner, S.E.; Bassett, H.C.M.; Kodde, L.P.; Plummer, K.M. The Vh8 Locus of a New Gene-for-gene Interaction between Venturia inaequalis and the Wild Apple Malus sieversii Is Closely Linked to the Vh2 Locus in Malus Pumila R12740-7A. New Phytol. 2005, 166, 1035–1049. [Google Scholar] [CrossRef]
  14. Bus, V.G.M.; Rikkerink, E.H.A.; Caffier, V.; Durel, C.-E.; Plummer, K.M. Revision of the Nomenclature of the Differential Host-Pathogen Interactions of Venturia inaequalis and Malus. Annu. Rev. Phytopathol. 2011, 49, 391–413. [Google Scholar] [CrossRef]
  15. Kostick, S.A.; Norelli, J.L.; Evans, K.M. Novel Metrics to Classify Fire Blight Resistance of 94 Apple Cultivars. Plant Pathol. 2019, 68, 985–996. [Google Scholar] [CrossRef]
  16. Barba, M.; Ilardi, V.; Pasquini, G. Control of Pome and Stone Fruit Virus Diseases. In Advances in Virus Research; Elsevier: Amsterdam, The Netherlands, 2015; Volume 91, pp. 47–83. ISBN 978-0-12-802762-2. [Google Scholar]
  17. Wunsch, A.O.; Miranda Sazo, M.; Van Zoeren, J.; Lamour, K.H.; Hurtado-Gonzales, O.P.; Khan, A.; Fuchs, M. Investigating the Role of Viruses in the Rapid Decline of Young Apple Trees in High-Density Orchards in New York. Plants 2024, 13, 2866. [Google Scholar] [CrossRef] [PubMed]
  18. Grimová, L.; Winkowska, L.; Zíka, L.; Ryšánek, P. Distribution of Viruses in Old Commercial and Abandoned Orchards and Wild Apple Trees. J. Plant Pathol. 2016, 98, 549–554. [Google Scholar] [CrossRef]
  19. Kuzmitskaya, P.V.; Urbanovich, O.Y. Distribution and genetic diversity of three apple viruses in Belarus. Vestn. VOGiS 2016, 20, 673–682. [Google Scholar] [CrossRef]
  20. Harshman, J.M.; Evans, K.M.; Allen, H.; Potts, R.; Flamenco, J.; Aldwinckle, H.S.; Wisniewski, M.E.; Norelli, J.L. Fire Blight Resistance in Wild Accessions of Malus sieversii. Plant Dis. 2017, 101, 1738–1745. [Google Scholar] [CrossRef]
  21. Collum, T.D.; Stone, A.L.; Sherman, D.J.; Damsteegt, V.D.; Schneider, W.L.; Rogers, E.E. Viral Reservoir Capacity of Wild Prunus Alternative Hosts of Plum Pox Virus Through Multiple Cycles of Transmission and Dormancy. Plant Dis. 2022, 106, 101–106. [Google Scholar] [CrossRef]
  22. Rana, T.; Chandel, V.; Hallan, V.; Zaidi, A.A. Himalayan Wild Cherry (Prunus cerasoides D. Don): A New Host of Apple Chlorotic Leaf Spot Virus. For. Pathol. 2008, 38, 73–77. [Google Scholar] [CrossRef]
  23. Katsiani, A.T.; Maliogka, V.I.; Candresse, T.; Katis, N.I. Host-range Studies, Genetic Diversity and Evolutionary Relationships of ACLSV Isolates from Ornamental, Wild and Cultivated Rosaceous Species. Plant Pathol. 2014, 63, 63–71. [Google Scholar] [CrossRef]
  24. Shi, W.; Yao, R.; Sunwu, R.; Huang, K.; Liu, Z.; Li, X.; Yang, Y.; Wang, J. Incidence and Molecular Identification of Apple Necrotic Mosaic Virus (ApNMV) in Southwest China. Plants 2020, 9, 415. [Google Scholar] [CrossRef]
  25. EPPO Global Database. Available online: https://https://gd.eppo.int/ (accessed on 29 January 2025).
  26. Jashenko, R.; Tanabekova, G.; Lu, Z. Assessment of Biological and Ecological Characteristics of Sievers Apple Tree Pests in Trans-Ili Alatau, Kazakhstan. Sustainability 2023, 15, 11303. [Google Scholar] [CrossRef]
  27. Svoboda, J.; Polák, J. Relative Concentration of Apple Mosaic Virus Coat Protein in Different Parts of Apple Tree. Hortic. Sci. 2010, 37, 22–26. [Google Scholar] [CrossRef]
  28. Alemzadeh, E.; Katsiani, A.T.; Efthimiou, K.; Katis, N.I. Occurrence of Apple Chlorotic Leaf Spot Virus in Apple and Quince in Southern Iran. J. Plant Pathol. 2016, 98, 171–185. [Google Scholar] [CrossRef]
  29. Rana, T.; Chandel, V.; Hallan, V.; Zaidi, A.A. Characterisation of Apple Chlorotic Leaf Spot Virus Infecting Almonds in India. Austral. Plant Dis. Notes 2008, 3, 65. [Google Scholar] [CrossRef]
  30. Zhang, Y.-Y.; Yan, J.-M.; Zhou, X.-B.; Zhang, Y.-M.; Tao, Y. Effects of N and P Additions on Twig Traits of Wild Apple (Malus sieversii) Saplings. BMC Plant Biol. 2023, 23, 257. [Google Scholar] [CrossRef]
  31. Nemeth, C.J. Differential Contributions of Majority and Minority Influence. Psychol. Rev. 1986, 93, 23–32. [Google Scholar] [CrossRef]
  32. Pedrelli, A.; Nali, C.; Panattoni, A.; Pellegrini, E.; Cotrozzi, L. Apple Chlorotic Leaf Spot Virus Infection Affects the Physiology and Biochemistry of Leaves and the Quality of Fruits of Tuscany (Italy) Autochthonous Apple Varieties. Plant Pathol. 2025, 74, 158–170. [Google Scholar] [CrossRef]
  33. Wright, A.A.; Cross, A.R.; Harper, S.J. A Bushel of Viruses: Identification of Seventeen Novel Putative Viruses by RNA-Seq in Six Apple Trees. PLoS ONE 2020, 15, e0227669. [Google Scholar] [CrossRef]
  34. Descriptor List for Apple (MALUS); International Board for Plant Genetic Resources: Rome, Italy, 1982; ISBN 92-9043-101-6.
  35. International Union for the Protection of New Varieties of Plants. Apple (Fruit Varieties): Guidelines For The Conduct Of Tests For Distinctness, Uniformity And Stability. Available online: https://www.upov.int/edocs/tgdocs/en/tg014.pdf (accessed on 2 October 2024).
  36. Ma, L.; Zeng, Q.; Huang, W.; Wang, S.; Zhang, Y.; Cheng, Y.; Zhang, Q.; Wang, S.; Hao, L.; Xu, C.; et al. Incidence of Major Pome Fruit Tree Viruses and Viroids in Commercial Pear Orchards in China and in Pyrus betulifolia Seedlings. Plant Pathol. 2021, 70, 1467–1475. [Google Scholar] [CrossRef]
  37. Nabi, S.U.; Mir, J.I.; Sharma, O.C.; Singh, D.B.; Zaffer, S.; Sheikh, M.A.; Masoodi, L.; Khan, K.A. Optimization of Tissue and Time for Rapid Serological and Molecular Detection of Apple Stem Pitting Virus and Apple Stem Grooving Virus in Apple’. Phytoparasitica 2018, 46, 705–713. [Google Scholar] [CrossRef]
  38. Nabi, S.U.; Mir, J.I.; Yasmin, S.; Din, A.; Raja, W.H.; Madhu, G.S.; Parveen, S.; Mansoor, S.; Chung, Y.S.; Sharma, O.C.; et al. Tissue and Time Optimization for Real-Time Detection of Apple Mosaic Virus and Apple Necrotic Mosaic Virus Associated with Mosaic Disease of Apple (Malus domestica). Viruses 2023, 15, 795. [Google Scholar] [CrossRef] [PubMed]
  39. Lat Lon Tools. QGIS Plugins. Available online: https://plugins.qgis.org/plugins/latlontools/#plugin-versions (accessed on 1 February 2025).
  40. QGIS Association. QGIS Geographic Information System. Available online: http://www.qgis.org (accessed on 1 January 2024).
  41. Kalogirou, S. lctools: Local Correlation, Spatial Inequalities, Geographically Weighted Regression and Other Tools. R Package Version 0.2-10. 2024. Available online: https://CRAN.R-project.org/package=lctools (accessed on 20 June 2025).
  42. MacHardy, W.E. Apple Scab: Biology, Epidemiology, and Management; American Phytopathological Society (APS Press): St. Paul, MN, USA, 1996; ISBN 978-0-89054-206-4. [Google Scholar]
  43. Crusius, L.U.; Forcelini, C.A.; Sanhueza, R.M.V.; Fernandes, J.M.C. Epidemiology of Apple Leaf Spot. Fitopatol. Bras. 2002, 27, 65–70. [Google Scholar] [CrossRef]
  44. Simmons, E.G. Alternaria Themes and Variations (73). Mycotaxon 1993, 48, 109–140. [Google Scholar]
  45. Van der Zwet, T.; Keil, H.L. Fire Blight: A Bacterial Disease of Rosaceous Plants; United States Department of Agriculture: Washington, DC, USA, 1979. [Google Scholar]
  46. Fuchs, M. Virus transmission and grafting practices. N. Y. Fruit Q. 2016, 24, 25–27. [Google Scholar]
  47. Li, L.; Wen, L.; Wang, G.; Lyu, Y.; Yang, Z.; Yang, X.; Li, Q.; Hong, N. Seed Transmission of Three Viruses in Two Pear Rootstock Species Pyrus betulifolia and P. calleryana. Viruses 2022, 14, 599. [Google Scholar] [CrossRef]
  48. Yoshikawa, N.; Matsuda, H.; Oda, Y.; Isogai, M.; Takahashi, T.; Ito, T.; Yoshida, K. Genome Heterogeneity Of Apple Stem Pitting Virus in Apple Trees. Acta Hortic. 2001, 550, 285–290. [Google Scholar] [CrossRef]
  49. Wunsch, A.; Hoff, B.; Sazo, M.M.; Van Zoeren, J.; Lamour, K.H.; Hurtado-Gonzales, O.P.; Fuchs, M. Viruses of Apple Are Seedborne but Likely Not Vertically Transmitted. Viruses 2024, 16, 95. [Google Scholar] [CrossRef]
  50. Escalante, C.; Sanz-Saez, A.; Jacobson, A.; Otulak-Kozieł, K.; Kozieł, E.; Balkcom, K.S.; Zhao, C.; Conner, K. Plant Virus Transmission during Seed Development and Implications to Plant Defense System. Front. Plant Sci. 2024, 15, 1385456. [Google Scholar] [CrossRef]
  51. Canales, C.; Morán, F.; Olmos, A.; Ruiz-García, A.B. First Detection and Molecular Characterization of Apple Stem Grooving Virus, Apple Chlorotic Leaf Spot Virus, and Apple Hammerhead Viroid in Loquat in Spain. Plants 2021, 10, 2293. [Google Scholar] [CrossRef]
  52. Eastwell, K.C.; Petrzik, K. Instant Insights: Viruses Affecting Horticultural Crops; Burleigh Dodds Science Publishing: Cambridge, UK, 2024; Volume 106. [Google Scholar]
  53. Naqvi, S.A.M.H. Diseases of Fruits and Vegetables; Kluwer Academic Publishers: Dordrecht, The Netherlands, 2004; ISBN 1-4020-1822-3. [Google Scholar]
  54. Manzoor, S.; Nabi, S.U.; Ayaz, A.; Rasool, B.; Sharma, S.K.; Chesti, M.H.; Parveen, S.; Verma, M.K.; Diab, M.A.; Rabbee, M.F. Unveiling Viral Threats to Temperate Pome Fruits: Characterization, Transmission, and Sustainable Management Strategies. Front. Microbiol. 2025, 16, 1560720. [Google Scholar] [CrossRef]
  55. Nabi, S.U.; Baranwal, V.K.; Rao, G.P.; Mansoor, S.; Vladulescu, C.; Raja, W.H.; Jan, B.L.; Alansi, S. High-Throughput RNA Sequencing of Mosaic Infected and Non-Infected Apple (Malus × Domestica Borkh.) Cultivars: From Detection to the Reconstruction of Whole Genome of Viruses and Viroid. Plants 2022, 11, 675. [Google Scholar] [CrossRef] [PubMed]
  56. Savary, S.; Willocquet, L.; Pethybridge, S.J.; Esker, P.; McRoberts, N.; Nelson, A. The Global Burden of Pathogens and Pests on Major Food Crops. Nat. Ecol. Evol. 2019, 3, 430–439. [Google Scholar] [CrossRef] [PubMed]
  57. Nizamani, M.M.; Zhang, Q.; Muhae-Ud-Din, G.; Awais, M.; Qayyum, M.; Farhan, M.; Jabran, M.; Wang, Y. Application of GIS and Remote-Sensing Technology in Ecosystem Services and Biodiversity Conservation. In Deep Learning for Multimedia Processing Applications; CRC Press: Boca Raton, FL, USA, 2023; pp. 284–321. ISBN 978-1-032-64626-8. [Google Scholar]
  58. White, S.M.; Bullock, J.M.; Hooftman, D.A.P.; Chapman, D.S. Modelling the Spread and Control of Xylella Fastidiosa in the Early Stages of Invasion in Apulia, Italy. Biol. Invasions 2017, 19, 1825–1837. [Google Scholar] [CrossRef] [PubMed]
Forests 16 01119 g001
Figure 1. Study areas: A—Sievers Apple Reserve; B—Tauturgen; C—Shelek; D—Sumbe; E—Ketpentau; F—Taraz 1; G—Taraz 2. Colored dots indicate different populations.
Figure 1. Study areas: A—Sievers Apple Reserve; B—Tauturgen; C—Shelek; D—Sumbe; E—Ketpentau; F—Taraz 1; G—Taraz 2. Colored dots indicate different populations.
Forests 16 01119 g001
Forests 16 01119 g002
Figure 2. Wild apple forests in southeastern Kazakhstan. Views of a dense M. sieversii forest stand on a mountain slope showing a mosaic structure with mixed-species trees and diverse vegetation layers (A,C,D). A mature multi-stemmed M. sieversii individual (B).
Figure 2. Wild apple forests in southeastern Kazakhstan. Views of a dense M. sieversii forest stand on a mountain slope showing a mosaic structure with mixed-species trees and diverse vegetation layers (A,C,D). A mature multi-stemmed M. sieversii individual (B).
Forests 16 01119 g002
Forests 16 01119 g003
Figure 3. Symptoms of leaf yellowing, mottling, necrotic spots, and margin deformation, with irregular yellow-green patterns and brown lesions observed on infected leaves (A,B). The healthy leaves were classified as shown in (C).
Figure 3. Symptoms of leaf yellowing, mottling, necrotic spots, and margin deformation, with irregular yellow-green patterns and brown lesions observed on infected leaves (A,B). The healthy leaves were classified as shown in (C).
Forests 16 01119 g003
Forests 16 01119 g004
Figure 4. Percentage of apple trees infected with three viruses and their combinations in six populations.
Figure 4. Percentage of apple trees infected with three viruses and their combinations in six populations.
Forests 16 01119 g004
Forests 16 01119 g005
Figure 5. Viral infection rate map of wild apple trees, with infected trees shown in red and virus-free trees shown in green: (A)—Ketpentau; (B)—Sumbe; (C)—Tauturgen; (D)—Sievers Apple Reserve.
Figure 5. Viral infection rate map of wild apple trees, with infected trees shown in red and virus-free trees shown in green: (A)—Ketpentau; (B)—Sumbe; (C)—Tauturgen; (D)—Sievers Apple Reserve.
Forests 16 01119 g005
Forests 16 01119 g006
Figure 6. Viral infection rate map of wild apple trees, with infected trees shown in red and virus-free trees shown in green: (A)—Shelek; (B)—Taraz 1; (C)—Taraz 2.
Figure 6. Viral infection rate map of wild apple trees, with infected trees shown in red and virus-free trees shown in green: (A)—Shelek; (B)—Taraz 1; (C)—Taraz 2.
Forests 16 01119 g006
Table 1. Apple tree sampling locations in the southeast region of Kazakhstan.
Table 1. Apple tree sampling locations in the southeast region of Kazakhstan.
PopulationCoordinatesNumber of SamplesDistance (km) Between Orchards and Wild Apple Populations
Wild appleKetpentau (E)43.296568333, 79.51507833350100–1 *
670–2 *
650–3 *
Sumbe (D)43.289246667, 79.47724333350101–1 *
665–2 *
650–3 *
Tauturgen (B)43.364244848, 77.6804073925550–1 *
520–2 *
500–3 *
Sievers Apple Reserve (A)43.366810848, 77.6730123937050–1 *
520–2 *
505–3 *
OrchardShelek (C)43.554083835, 78.28092439414570–2 *
550–3 *
Taraz 1 (F)42.923489300, 71.49823408420570–1 *
16–3 *
Taraz 2 (G)42.868237638, 71.30983075083550–1 *
16–2 *
* Distance: 1—Shelek orchard; 2—Taraz orchard 1; 3—Taraz orchard 2.
Table 2. The primers used in this study for the detection of apple viruses.
Table 2. The primers used in this study for the detection of apple viruses.
Primer NameSequence (5′-3′)Source
ACLSV-FTGAGAGGCTCTATTCACATCTTG[36]
ACLSV-RCAATTGGAATATCCCCTTCTGCGAT
ASPV-FGAGAGAGTAGCCAATGCCACAAGCAA[36]
ASPV-RCGCCGAAGTTCACAGCCTGAGTACC
ASGV-FCATATGTTCACTGAGGCAAAAGCTG[37]
ASGV-RCGATCCAGAAACCCATCAAAGACTT
ApMV-FATCCGAGTGAACAGTCTATCCCTC[38]
ApMV-RGTAACTCACTCGTTATCACGTAC
ApNMV-FATGGTGTGCAATCGCTGTCA[38]
ApNMV-RCATCGACCATAAGGATATCA
Table 3. Results of the tests of Moran’s spatial autocorrelation and the Local Pearson Correlation of ACLSV and ASPV distributions. Results that are significant at the p < 0.05 threshold are shown bold.
Table 3. Results of the tests of Moran’s spatial autocorrelation and the Local Pearson Correlation of ACLSV and ASPV distributions. Results that are significant at the p < 0.05 threshold are shown bold.
PopulationACLSVASPVLocal Pearson Correlation ACLSV and ASPV
Moran’s Ip-ValueMoran’s Ip-Value ResamplingLPCCp-Value
Ketpentau0.057330.337590.016670.647410.425940.00204
Sumbe0.087660.17728−0.077270.477760.188310.19032
Tauturgen0.512123.59 * 10−120.216530.002070.275010.04215
Sievers Apple Reserve−0.002590.182590.079380.156370.215010.07603
Taraz0.093200.067140.096440.05897−0.329380.00068
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kerimbek, N.; Khusnitdinova, M.; Taskuzhina, A.; Kapytina, A.; Pozharskiy, A.; Sagitov, A.; Gritsenko, D. Mapping the Distribution of Viruses in Wild Apple Populations in the Southeast Region of Kazakhstan. Forests 2025, 16, 1119. https://doi.org/10.3390/f16071119

AMA Style

Kerimbek N, Khusnitdinova M, Taskuzhina A, Kapytina A, Pozharskiy A, Sagitov A, Gritsenko D. Mapping the Distribution of Viruses in Wild Apple Populations in the Southeast Region of Kazakhstan. Forests. 2025; 16(7):1119. https://doi.org/10.3390/f16071119

Chicago/Turabian Style

Kerimbek, Nazym, Marina Khusnitdinova, Aisha Taskuzhina, Anastasiya Kapytina, Alexandr Pozharskiy, Abay Sagitov, and Dilyara Gritsenko. 2025. "Mapping the Distribution of Viruses in Wild Apple Populations in the Southeast Region of Kazakhstan" Forests 16, no. 7: 1119. https://doi.org/10.3390/f16071119

APA Style

Kerimbek, N., Khusnitdinova, M., Taskuzhina, A., Kapytina, A., Pozharskiy, A., Sagitov, A., & Gritsenko, D. (2025). Mapping the Distribution of Viruses in Wild Apple Populations in the Southeast Region of Kazakhstan. Forests, 16(7), 1119. https://doi.org/10.3390/f16071119

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop