Cryptobiosis Enables Pine Wood Nematode Resistance to Low-Temperature Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Nematode Strains and Cultures
2.2. Investigation of Overwintering Temperatures of Pine Wood Nematodes in Liaoning Province
2.3. Molecular Identification of Pine Wood Nematodes
2.4. Induction of Cryptobiosis and Pine Wood Nematode Survival
2.5. Changes in Fat Content of Pine Wood Nematodes After Cryptobiosis and Cold Treatment Analysis
2.6. RNA Extraction and Transcriptome Analysis
2.7. qRT-PCR Analysis
2.8. Phylogenetic Analysis of Nematode COL Gene Family
3. Results
3.1. Internal Temperature Between the Healthy and PWN-Infested P. tabuliformis
3.2. The Survival Rate of PWNs Following the Cryptobiosis Procedure Under Low-Temperature Conditions
3.3. Morphological and Fat Content Changes in Pine Wood Nematodes Under Cryptobiosis Treatment
3.4. Differential Gene Expression and Pathway Enrichment During Dehydration and Rehydration
3.5. Identification and Expression Regulation Analysis of Key Genes
3.6. qRT-PCR Validation
3.7. Phylogenetic Analysis of the COL Gene Family
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Sample | Raw Reads | Raw Bases | Clean Reads | Clean Bases | Error Rate (%) | Q20 (%) | Q30 (%) | GC Content (%) |
|---|---|---|---|---|---|---|---|---|
| CK1 | 42,366,036 | 6.4 × 109 | 42,000,684 | 6.3 × 109 | 0.0119 | 98.79 | 96.29 | 47.38 |
| CK2 | 42,327,428 | 6.39 × 109 | 41,895,908 | 6.28 × 109 | 0.012 | 98.71 | 96.03 | 47.41 |
| CK3 | 41,481,986 | 6.26 × 109 | 41,103,824 | 6.17 × 109 | 0.0119 | 98.78 | 96.22 | 47.39 |
| CK4 | 43,104,072 | 6.51 × 109 | 42,751,718 | 6.42 × 109 | 0.012 | 98.71 | 96.03 | 47.42 |
| Rehydration1 | 44,403,712 | 6.7 × 109 | 43,921,778 | 6.59 × 109 | 0.012 | 98.73 | 96.09 | 47.26 |
| Rehydration2 | 42,551,754 | 6.43 × 109 | 42,117,982 | 6.31 × 109 | 0.0119 | 98.78 | 96.24 | 47.09 |
| Rehydration3 | 40,757,948 | 6.15 × 109 | 40,331,136 | 6.05 × 109 | 0.0119 | 98.79 | 96.27 | 47.3 |
| Rehydration4 | 45,797,680 | 6.92 × 109 | 44,626,930 | 6.6 × 109 | 0.0127 | 98.33 | 94.88 | 47.27 |
| Dehydration1 | 42,028,322 | 6.35 × 109 | 41,613,696 | 6.26 × 109 | 0.0119 | 98.76 | 96.17 | 47.5 |
| Dehydration2 | 41,409,928 | 6.25 × 109 | 41,049,692 | 6.16 × 109 | 0.0121 | 98.68 | 95.91 | 47.47 |
| Dehydration3 | 48,823,610 | 7.37 × 109 | 48,412,074 | 7.26 × 109 | 0.012 | 98.69 | 95.98 | 47.49 |
| Dehydration4 | 49,590,206 | 7.49 × 109 | 49,189,402 | 7.34 × 109 | 0.012 | 98.71 | 96.02 | 47.52 |
| Sample | Total Reads | Total Mapped | Multiple Mapped | Uniquely Mapped |
|---|---|---|---|---|
| CK1 | 42,000,684 | 38,254,750 (91.08%) | 848,209 (2.02%) | 37,406,541 (89.06%) |
| CK2 | 41,895,908 | 38,231,385 (91.25%) | 790,980 (1.89%) | 37,440,405 (89.37%) |
| CK3 | 41,103,824 | 37,428,910 (91.06%) | 690,410 (1.68%) | 36,738,500 (89.38%) |
| CK4 | 42,751,718 | 38,381,943 (89.78%) | 802,785 (1.88%) | 37,579,158 (87.9%) |
| Rehydration1 | 43,921,778 | 39,244,377 (89.35%) | 875,453 (1.99%) | 38,368,924 (87.36%) |
| Rehydration2 | 42,117,982 | 37,320,080 (88.61%) | 752,388 (1.79%) | 36,567,692 (86.82%) |
| Rehydration3 | 40,331,136 | 36,077,967 (89.45%) | 775,102 (1.92%) | 35,302,865 (87.53%) |
| Rehydration4 | 44,626,930 | 39,020,139 (87.44%) | 849,493 (1.9%) | 38,170,646 (85.53%) |
| Dehydration1 | 41,613,696 | 37,499,060 (90.11%) | 797,006 (1.92%) | 36,702,054 (88.2%) |
| Dehydration2 | 41,049,692 | 36,955,748 (90.03%) | 944,981 (2.3%) | 36,010,767 (87.72%) |
| Dehydration3 | 48,412,074 | 39,154,428 (80.88%) | 1,473,524 (3.04%) | 37,680,904 (77.83%) |
| Dehydration4 | 49,189,402 | 42,819,615 (87.05%) | 2,239,725 (4.55%) | 40,579,890 (82.5%) |
| Species | Gene Name | Sequence Accession Number | Data Type | Source |
|---|---|---|---|---|
| C. elegans | col-40 | L15419.1 | Genomic DNA | NCBI Gene |
| B. xylophilus | col-1 | LC033885.1 | Genomic DNA | NCBI Gene |
| B. xylophilus | col-3 | LC033886.1 | Genomic DNA | NCBI Gene |
| B. xylophilus | col-4 | LC034169.1 | Genomic DNA | NCBI Gene |
| B. xylophilus | col-5 | LC034170.1 | Genomic DNA | NCBI Gene |
| B. xylophilus | col-2 | LC034171.1 | Genomic DNA | NCBI Gene |
| C. elegans | col-40 | NM_061512.5 | Transcript | NCBI Nucleotide |
| C. briggsae | col-12 | U84501.1 | Genomic DNA | NCBI Gene |
| C. briggsae | col-40 | XM_002632263.1 | Transcript | NCBI Nucleotide |
| C. briggsae | col-2 | XM_002633689.1 | Transcript | NCBI Nucleotide |
| C. briggsae | col-12.1 | XM_002637066.1 | Transcript | NCBI Nucleotide |
| C. elegans | col | AAA27991.1 | Protein | NCBI Protein |
| M. javanica | col | AAK83075.1 | Protein | NCBI Protein |
| M. incognita | col-5 | AOG74800.1 | Protein | NCBI Protein |
| M. graminicola | col-5 | KAF7629959.1 | Protein | NCBI Protein |
| D. destructor | col | KAI1707436.1 | Protein | NCBI Protein |
| A. besseyi | col | KAI6231065.1 | Protein | NCBI Protein |
| T. canis | cuticle-col-6 | KHN75644.1 | Protein | NCBI Protein |
| C. elegans | cuticle-col | CAB02849.1 | Protein | NCBI Protein |
| C. elegans | col-19 | CCD71633.1 | Protein | NCBI Protein |
| C. elegans | dpy-5 | CCD66289.1 | Protein | NCBI Protein |
| C. elegans | cuticle-col | CAB00860.2 | Protein | NCBI Protein |
| C. elegans | col-10 | CCD61421.1 | Protein | NCBI Protein |
| C. elegans | cuticle-col | CAA84800.1 | Protein | NCBI Protein |
| C. elegans | cDNA 5′ similar to K02D7.3 | CK582588.1 | Transcript | NCBI Nucleotide |
| C. elegans | cuticle-col | CCD65399.1 | Protein | NCBI Protein |
| C. elegans | cuticle-col | CAA92453.1 | Protein | NCBI Protein |
| C. elegans | col-155 | CAA98487.2 | Protein | NCBI Protein |
| C. elegans | cuticle-col | CAA93499.1 | Protein | NCBI Protein |
| C. elegans | dpy-7 | CCD71295.1 | Protein | NCBI Protein |
| C. elegans | dpy-10 | CCD65275.2 | Protein | NCBI Protein |
| C. elegans | dpy-2 | CCD65274.1 | Protein | NCBI Protein |
| C. elegans | cuticle-col | CCD66330.1 | Protein | NCBI Protein |
| M. javanica | col | AAC47745.1 | Protein | NCBI Protein |
| C. elegans | cuticle-col | CAA92476.1 | Protein | NCBI Protein |
| C. elegans | cuticle-col | CCD71292.1 | Transcript | NCBI Nucleotide |
| G. pallida | col-1 | AJ277425.1 | Protein | NCBI Protein |
| G. pallida | col-2 | AJ277426.1 | Protein | NCBI Protein |
| G. pallida | col-t | AJ277427.1 | Protein | NCBI Protein |
| C. elegans | col-8 | NP_001370389.1 | Protein | NCBI Protein |
| C. elegans | sqt-1 | CAA90084.1 | Protein | NCBI Protein |
| H. contortus | col-3A3 | AAA29173.1 | Protein | NCBI Protein |
| H. contortus | col-2C | AAA29172.1 | Protein | NCBI Protein |
References
- Futai, K. Pine Wood Nematode, Bursaphelenchus xylophilus. Annu. Rev. Phytopathol. 2013, 51, 61–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wharton, D.A.; Goodall, G.; Marshall, C.J. Freezing survival and cryoprotective dehydration as cold tolerance mechanisms in the Antarctic nematode Panagrolaimus davidi. J. Exp. Biol. 2003, 206, 215–221. [Google Scholar] [CrossRef] [Scilit]
- Farman, A.; Wharton, D.A. Intracellular Freezing in the Infective Juveniles of Steinernema feltiae: An Entomopathogenic Nematode. PLoS ONE 2014, 9, e94179. [Google Scholar] [CrossRef] [Scilit]
- Naya, D.E.; Veloso, C.; Bozinovic, F. Physiological flexibility in the Andean lizard Liolaemus bellii: Seasonal changes in energy acquisition, storage and expenditure. J. Comp. Physiol. B Biochem. Syst. Environ. Physiol. 2008, 178, 1007. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tunnacliffe, A.; Lapinski, J. Resurrecting Van Leeuwenhoek’s rotifers: A reappraisal of the role of disaccharides in anhydrobiosis. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2003, 358, 1755–1771. [Google Scholar] [CrossRef] [Scilit]
- Gade, V.R.; Traikov, S.; Oertel, J.; Fahmy, K.; Kurzchalia, T.V. C. elegans possess a general program to enter cryptobiosis that allows dauer larvae to survive different kinds of abiotic stress. Sci. Rep. 2020, 10, 13466. [Google Scholar] [CrossRef] [Scilit]
- Huang, R.; Gao, R.; Shi, J.; Song, D.; Li, Z. Cold Tolerance of Bursaphelenchus xylophilus in the Three Gorges Region of Hubei Province. J. Northeast For. Univ. 2014, 42, 138–141. [Google Scholar] [CrossRef]
- Chen, Q.; Zhang, R.; Li, D.; Wang, F.; Jiang, S.; Wang, J. Trehalose in pine wood nematode participates in DJ3 formation and confers resistance to low-temperature stress. BMC Genom. 2021, 22, 524. [Google Scholar] [CrossRef] [Scilit]
- Pan, L.; Cui, R.; Li, Y.; Zhang, W.; Bai, J.; Li, J.; Zhang, X. Third-Stage Dispersal Juveniles of Bursaphelenchus xylophilus Can Resist Low-Temperature Stress by Entering Cryptobiosis. Biology 2021, 10, 785. [Google Scholar] [CrossRef] [Scilit]
- Chen, Z.; Chen, Q.; Zhang, R.; Li, D.; Wang, F. Bx-tre-1 and Bx-daf-2 coordinately regulate trehalose to promote resistance of Bursaphelenchus xylophilus against low temperature. J. Hunan Agric. Univ. (Nat. Sci.) 2020, 46, 21–27. [Google Scholar] [CrossRef]
- Wang, B.; Liu, W.; Wang, F.; Ma, L.; Li, D. Fat Accumulation in Bursaphelenchus xylophilus by Positively Regulating Bx-SCD under Low Temperature. J. Northeast For. Univ. 2017, 45, 89–93. [Google Scholar] [CrossRef]
- Wang, B.; Ma, L.; Wang, F.; Wang, B.; Hao, X.; Xu, J.; Ma, Y. Low Temperature Extends the Lifespan of Bursaphelenchus xylophilus through the cGMP Pathway. Int. J. Mol. Sci. 2017, 18, 2320. [Google Scholar] [CrossRef] [Scilit]
- Wang, B.; Hao, X.; Xu, J.; Wang, B.; Ma, W.; Liu, X.; Ma, L. Cytochrome P450 metabolism mediates low-temperature resistance in pinewood nematode. FEBS Open Bio 2020, 10, 1171–1179. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Zhang, J.; Gu, J. Method of extract DNA from a single nematode. Plant Quar. 2011, 25, 32–35. [Google Scholar] [CrossRef]
- Tian, Z.-L.; Maria, M.; Barsalote, E.M.; Castillo, P.; Zheng, J.-W. Morphological and molecular characterization of the rice root-knot nematode, Meloidogyne graminicola, Golden and Birchfeild, 1965 occurring in Zhejiang, China. J. Integr. Agric. 2018, 17, 2724–2733. [Google Scholar] [CrossRef] [Scilit]
- Brooks, K.K.; Liang, B.; Watts, J.L. The Influence of Bacterial Diet on Fat Storage in C. elegans. PLoS ONE 2009, 4, e7545. [Google Scholar] [CrossRef] [Scilit]
- Tsai, I.J.; Tanaka, R.; Kanzaki, N.; Akiba, M.; Yokoi, T.; Espada, M.; Jones, J.T.; Kikuchi, T. Transcriptional and morphological changes in the transition from mycetophagous to phytophagous phase in the plant-parasitic nematode Bursaphelenchus xylophilus. Mol. Plant Pathol. 2016, 17, 77–83. [Google Scholar] [CrossRef] [Scilit]
- Cao, H.Y.; Miao, Z.; Hao, Y.S.; Dong, L.H. Stemmoisture content prediction model for Larix olgensis based on betaregression. Chin. J. Appl. Ecol. 2024, 35, 578–596. [Google Scholar]
- Ali, F.; Wharton, D.A. Infective Juveniles of the Entomopathogenic Nematode, Steinernema feltiae Produce Cryoprotectants in Response to Freezing and Cold Acclimation. PLoS ONE 2015, 10, e0141810. [Google Scholar] [CrossRef] [Scilit]
- Ali, F.; Wharton, D.A. Ice-Active Substances from the Infective Juveniles of the Freeze Tolerant Entomopathogenic Nematode, Steinernema feltiae. PLoS ONE 2016, 11, e0156502. [Google Scholar] [CrossRef] [Scilit]
- Abusharkh, S.E.; Erkut, C.; Oertel, J.; Kurzchalia, T.V.; Fahmy, K. The Role of Phospholipid Headgroup Composition and Trehalose in the Desiccation Tolerance of Caenorhabditis elegans. Langmuir 2014, 30, 12897–12906. [Google Scholar] [CrossRef] [Scilit]
- Erkut, C.; Gade, V.R.; Laxman, S.; Kurzchalia, T.V. The glyoxylate shunt is essential for desiccation tolerance in C. elegans and budding yeast. Elife 2016, 5, e13614. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shatilovich, A.; Gade, V.R.; Pippel, M.; Hoffmeyer, T.T.; Tchesunov, A.V.; Stevens, L.; Winkler, S.; Hughes, G.M.; Traikov, S.; Hiller, M.; et al. A novel nematode species from the Siberian permafrost shares adaptive mechanisms for cryptobiotic survival with C. elegans dauer larva. PLoS Genet. 2023, 19, e1010798. [Google Scholar] [CrossRef] [Scilit]
- Erkut, C.; Penkov, S.; Khesbak, H.; Vorkel, D.; Verbavatz, J.M.; Fahmy, K.; Kurzchalia, T.V. Trehalose renders the dauer larva of Caenorhabditis elegans resistant to extreme desiccation. Curr. Biol. 2011, 21, 1331–1336. [Google Scholar] [CrossRef] [Scilit]
- Lapinski, J.; Tunnacliffe, A. Anhydrobiosis without trehalose in Bdelloid rotifers. FEBS Lett. 2003, 553, 387–390. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.; Li, Y.; Pan, L.; Meng, F.; Zhang, X. Cold adaptive potential of pine wood nematodes overwintering in plant hosts. Biol. Open 2019, 8, bio041616. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wharton, D.A.; Petrone, L.; Duncan, A.; McQuillan, A.J. A surface lipid may control the permeability slump associated with entry into anhydrobiosis in the plant parasitic nematode Ditylenchus dipsaci. J. Exp. Biol. 2008, 211, 2901–2908. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prockop, D.J.; Kivirikko, K.I. Collagens: Molecular biology, diseases, and potentials for therapy. Annu. Rev. Biochem. 1995, 64, 403–434. [Google Scholar] [CrossRef]
- Johnstone, I.L. Cuticle collagen genes: Expression in Caenorhabditis elegans. Trends Genet. 2000, 16, 21–27. [Google Scholar] [CrossRef] [Scilit]
- Ho, N.F.H.; Geary, T.G.; Raub, T.J.; Barsuhn, C.L.; Thompson, D.P. Biophysical transport properties of the cuticle of Ascaris suum. Mol. Biochem. Parasitol. 1990, 41, 153–165. [Google Scholar] [CrossRef] [Scilit]
- Wharton, D.A. Parasitism. In A Functional Biology of Nematodes; Wharton, D.A., Ed.; Springer: Boston, MA, USA, 1986; pp. 88–117. [Google Scholar]
- Ogilvie, B.M.; Philipp, M.T.; Jungery, M.; Maizels, R.M.; Worms, M.J.; Parkhouse, R. The Surface of Nematodes and the Immune Response of the Host; Elsevier: Amsterdam, The Netherlands, 1980. [Google Scholar]
- Ekino, T.; Kirino, H.; Kanzaki, N.; Shinya, R. Ultrastructural plasticity in the plant-parasitic nematode, Bursaphelenchus xylophilus. Sci. Rep. 2020, 10, 11576. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Hao, X.; Wang, B.; Ma, L. Transcriptomics and coexpression network profiling of the effects of levamisole hydrochloride on Bursaphelenchus xylophilus. Pestic. Biochem. Physiol. 2022, 181, 105019. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, Q.Q.; Du, G.C.; Zhang, T.T.; Wang, M.J.; Wang, C.; Qi, H.T.; Li, R.G. Transcriptomic analysis of Bursaphelenchus xylophilus treated by a potential phytonematicide, punicalagin. J. Nematol. 2020, 52, e2020-01. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Zhou, X.; Guo, K.; Chen, S.-N.; Su, X. Transcriptomic insights into the effects of CytCo, a novel nematotoxic protein, on the pine wood nematode Bursaphelenchus xylophilus. BMC Genom. 2021, 22, 394. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Zhao, R.; Jing, T.; Lin, S.; Ding, X. Identification and Transcriptome Analysis of Bursaphelenchus xylophilus with Excellent Low Temperature Resistance. Int. J. Mol. Sci. 2024, 25, 13732. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, J.; Li, J.; Liang, L.; Tian, B.; Zhang, Y.; Cheng, C.; Zhang, K.-Q. Cloning and characterization of an extracellular serine protease from the nematode-trapping fungus Arthrobotrys conoides. Arch. Microbiol. 2007, 188, 167–174. [Google Scholar] [CrossRef] [Scilit]
- The C. elegans Sequencing Consortium. Genome sequence of the nematode C. elegans: A platform for investigating biology. Science 1998, 282, 2012–2018. [Google Scholar] [CrossRef] [Scilit]
- Peixoto, C.A.; Alves, L.C.; de Melo, J.V.; de Souza, W. Ultrastructural analyses of the Caenorhabditis elegans sqt-1(sc13) left roller mutant. J. Parasitol. 2000, 86, 269–274. [Google Scholar] [CrossRef] [Scilit]








| Gene Name | NR Description | Primers: Sequence (5′–3′) |
|---|---|---|
| BXYJ_LOCUS13864 | collagen 1 | F:CGTCACCTTGATCTCCTCGG R:TCTTTCGCGGGTTTCATGGA |
| BXYJ_LOCUS14004 | VAP1 | F:CAGGCCTGCAATTTTGAGCA R:GGCGTCCCCAGAATAACGAT |
| BXYJ_LOCUS15404 | arginine kinase | F:CTACCCATTCAACCCGTGCT R:CCTCCTTGGTCATTCCGGTC |
| BXYJ_LOCUS4755 | collagen 4 | F:TCCGAGGTCAACCAAATCCG R:CAGACAGCAGCCGTCACAG |
| BXYJ_LOCUS5028 | arginine kinase | F:GAAGGCCGAGGATTACGAGG R:TGAGTCTCCTTGCTCATGCC |
| BXYJ_LOCUS7479 | cysteine proteinase inhibitor | F:AATTCCAGAGGCTCGCCAAG R:CGGACTCAAATTACGGGCCT |
| BXYJ_LOCUS8232 | collagen 3 | F:CCGTCCATCCACTCAACCAT R:CTTGTCTCCTGGAGCTCCTG |
| BXYJ_LOCUS14936 | alpha cardiac muscle 1 | F:CATCTCGGTGCTCCTAGCTG R:AAGGTCATCAGCGTTCGGTT |
| Healthy Group | Infested Group | Environmental Group | ||||
|---|---|---|---|---|---|---|
| Mean Temperature (°C) | Minimum Temperature (°C) | Mean Temperature (°C) | Minimum Temperature (°C) | Mean Temperature (°C) | Minimum Temperature (°C) | |
| November | 0.43 ± 5.01 | −10.98 | 0.25 ± 5.39 | −10.5 | −1.21 ± 7.17 | −14.9 |
| December | −8.57 ± 6.49 | −24.26 | −8.43 ± 6.31 | −23.65 | −8.51 ± 7.61 | −28.78 |
| January | −9.1 ± 4.16 | −22.68 | −8.96 + 3.89 | −21.3 | −9.48 ± 6.40 | −27.86 |
| February | −7.75 ± 7.90 | −24.65 | −6.39 ± 6.32 | −22.6 | −7.74 ± 7.38 | −25.7 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hou, Q.; Li, J.; Cheng, L.; Ren, L.; Luo, Y. Cryptobiosis Enables Pine Wood Nematode Resistance to Low-Temperature Stress. Forests 2025, 16, 910. https://doi.org/10.3390/f16060910
Hou Q, Li J, Cheng L, Ren L, Luo Y. Cryptobiosis Enables Pine Wood Nematode Resistance to Low-Temperature Stress. Forests. 2025; 16(6):910. https://doi.org/10.3390/f16060910
Chicago/Turabian StyleHou, Qidi, Jiaxing Li, Ling Cheng, Lili Ren, and Youqing Luo. 2025. "Cryptobiosis Enables Pine Wood Nematode Resistance to Low-Temperature Stress" Forests 16, no. 6: 910. https://doi.org/10.3390/f16060910
APA StyleHou, Q., Li, J., Cheng, L., Ren, L., & Luo, Y. (2025). Cryptobiosis Enables Pine Wood Nematode Resistance to Low-Temperature Stress. Forests, 16(6), 910. https://doi.org/10.3390/f16060910

