Next Article in Journal
The Effects of Drought Timing on Height Growth and Leaf Phenology in Pedunculate Oak (Quercus robur L.)
Previous Article in Journal
Comparative Analysis of Drought-Driven Water-Use Strategies in Mangroves and Forests
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Heat Shock Proteins of Pistacia chinensis Could Promote Floral Development Under Drought Stress

1
College of Forestry, Beijing Forestry University, Beijing 100083, China
2
State Key Laboratory of Efficient Production of Forest Resources, Ministry of Education Key Laboratory of Silviculture and Conservation, National Energy R&D Center for Non-Food Biomass, Beijing 100083, China
3
National Energy R&D Center for Non-Food Biomass, Beijing 100083, China
*
Authors to whom correspondence should be addressed.
Forests 2025, 16(3), 395; https://doi.org/10.3390/f16030395
Submission received: 26 January 2025 / Revised: 18 February 2025 / Accepted: 21 February 2025 / Published: 23 February 2025
(This article belongs to the Section Forest Ecophysiology and Biology)

Abstract

:
Understanding the complex mechanisms underlying sex differentiation in dioecious plants is fundamental to elucidating plant reproductive strategies and their adaptive responses to environmental stresses. Pistacia chinensis, previously considered a strictly dioecious species, has been found to exhibit monoecy, with sex differentiation closely linked to environmental stress during floral development. However, the underlying molecular mechanisms remain poorly understood. This study explores the influence of environmental stress on sex differentiation with a focus on heat shock proteins (Hsps). Biochemical analyses revealed higher proline content and SOD activity in dioecious and monoecious females compared to males during the sex differentiation phase. Two key genes, PcHsp70-1 and PcHsp90, were identified as differentially expressed between sexes. Subcellular localization analysis showed that these proteins are present in both the nucleus and cytoplasm. Overexpression of PcHsp70-1 in Arabidopsis promoted bolting and flowering by upregulating flowering-related genes and also enhanced drought resistance. Similarly, PcHsp90 contributed to drought tolerance through multiple mechanisms. These findings suggest that Hsps play a key role in linking environmental stress responses to sex differentiation, thus laying the foundation for further research on plant–environment interactions and stress-adaptive mechanisms in P. chinensis.

1. Introduction

Sex differentiation plays a critical role in the reproductive success and productivity of dioecious plants, particularly in non-wood-product forest species. Understanding the mechanisms behind sex determination is essential for optimizing the yield and sustainability of such species in forestry practices. Pistacia chinensis Bunge is widely distributed in China owing to its deep roots and strong resistance to drought [1]. Previously, it was mainly used for afforestation, as an ornamental, and as a source of wood and medicinal products; therefore, its dioecious characteristics and the male–female configuration were ignored. In contrast, in recent years, it has become the preferred fuel species in northern China because of the fruit’s high oil content [2]. However, the disproportionate ratio of males to females leads to an extremely low yield, which seriously restricts its development. Moreover, Pistacia species have a long juvenile period, and the sex is unrecognizable before flowering [3].
To identify the sex at the seedling stage, sex-specific differences have been investigated and sex-related markers have been studied at the morphological, physiological, cytological, and molecular levels [3,4,5,6,7,8,9,10,11]. Unfortunately, the sex-associated markers of morphological and physiological characteristics are hard to define because they are mutable in different stages or environments, and no sex-determination-related genes have been identified [12]. The isozyme patterns indicate that only polyphenol oxidase could always identify the sex [4]. Additionally, differentially expressed protein spots between the two sexes indicated that ascorbate peroxidase, phosphoglycerate kinase, and temperature-induced lipocalin might be candidate sex-determination-related markers [11]. Therefore, all of these promising markers are related to environmental stress responses, indicating a link between sex and environmental stress. Although P. chinensis has been widely used in studies on resistance, the selected materials were mainly 1- or 2-year-old seedlings of which the sex types were unknown [13,14,15,16], so neither sex differences nor molecular mechanisms were investigated.
Rare monoecious P. chinensis have been found in a natural population, providing excellent models for studying sex differentiation. The sex expressions of single shoots on monoecious trees were unstable in successive years [17], suggesting that sex may be affected by the environment. Both male and female floral buds on monoecious individuals undergo a bisexual phase and then the opposing sex organs degrade, resulting in a unisexual phase, indicating that sexes were differentiated during floral development [18]. To screen for sex-determination-related genes, comparative transcriptome of floral buds for different sexes on dioecious and monoecious P. chinensis during the sex differentiation periods (asexual phase to bisexual phase, bisexual phase to unisexual phase, and sex organ developmental phase) were performed (BioProject: PRJNA525265). Heat shock factors (Hsfs) and heat shock proteins (Hsps) were upregulated in multiple enriched pathways during the bisexual to unisexual phase (Figures S1–S3), indicating that they may play important roles in sex differentiation. Hsfs are the transcriptional activators of Hsps, and Hsps are a ubiquitously expressed group of conserved proteins that play a pivotal role in cell homeostasis under both non-stress and stress conditions [19]. Based on their molecular weights, sequence homologies, and functions, the plant Hsps are classified into five families, the Hsp100s, Hsp90s, Hsp70s, Hsp60s, and the small Hsps [20,21]. Previous studies have shown that Hsps may also be related to floral development and sex [19,22,23]. For example, HSP70, as a key regulator of male fertility, regulates male fertility in cotton by mediating ROS homeostasis, and its antisense gene fragment induces male sterility in transgenic tobacco flowers [23,24]. Additionally, the ectopic expression of a male sterility gene (BnaA7.mtHSP70-1-like) from rapeseed in Arabidopsis can negatively regulate gene functions in tapetum degeneration [25]. Furthermore, HSP90 is essential during the vegetative-to-reproductive phase transition and floral development in Arabidopsis [26]. However, the Hsf and Hsp families have not been studied in P. chinensis.
Based on the previous studies, we hypothesized that the sex differentiation of P. chinensis was influenced by environmental stresses and was probably related to Hsf and Hsp genes. Here, we used female and male floral buds on monoecious and dioecious trees to explore their responses to drought. The expression patterns of Hsf and Hsp genes among different sexes at different developmental stages were investigated to screen for candidate genes related to sex. Moreover, the cloning; characterization, including the developmental phenotypes; and functional identification focusing on drought resistance of PcHsp70-1 and PcHsp90 are reported, which could provide a greater understanding of floral development and drought resistance in P. chinensis.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions

Floral bud samples of P. chinensis were collected from three female, three male, and three monoecious individuals located in Tang County, Hebei Province, China (114°27′–115°03′ E, 38°37′–39°09′ N). The annual rainfall of Tang County is only 460 mm [27], and P. chinensis mainly distributes in the dry, sunny slopes of limestone mountains [1]. Due to a lack of irrigation, P. chinensis is susceptible to drought stress. Fresh floral buds of female (F), male (M), monoecious female (MF), and monoecious male (MM) were sampled at three stages covering the critical periods of sex differentiation: A, asexual phase to bisexual phase, in mid-May; B, bisexual phase to unisexual phase, in late May; and C, sex organ developmental phase, in mid-March of the next year [18]. All samples were harvested from fresh floral buds at the same developmental stage to ensure biological consistency. The samples were immediately frozen in liquid nitrogen and stored at −80 °C until use. For each sex type, we collected >1.5 g of biological material per developmental phase to meet analytical requirements. Previous studies have shown that proline content and superoxide dismutase (SOD) activity had the highest correlation with drought resistance [13,14,15,16], so these two indices were detected for drought responses. The expression profiles of five genes (one Hsf and four Hsp) were tested at these three stages of floral bud development.
The Arabidopsis thaliana accession Columbia was used as the wild type, and the mutant and transgenic plants used in this work were generated on a Columbia background. Two mutants with a T-DNA insertion in AT1G16030 (hsp70, WISCDSLOX384E12) and AT5G52640 (hsp90, SALK_075596C) were obtained from the Arabidopsis Biological Resource Center at Ohio State University (Columbus, OH, USA) [28,29]. Their genotypes were identified by PCR, and T-DNA inserted fragments were obtained through SIGnAL iSect (http://signal.salk.edu/isect.2.html, accessed on 13 January 2023).
All seeds of Arabidopsis were surface-sterilized and plated on Petri dishes containing Murashige and Skoog basal salts with 0.5% agar. After 3 d of stratification at 4 °C, the dishes were transferred to an artificial climate box at 22/21 °C under long-day conditions (16 h light/8 h dark cycle) for 14 d. The seedlings of Arabidopsis were then transplanted into soil and grown under the same conditions.

2.2. RNA Isolation and Quantitative Real-Time PCR Analysis

The differentiation of P. chinensis floral buds used for RNA isolation involves stage A, asexual phase to bisexual phase, in mid-May; stage B, bisexual phase to unisexual phase, in late May; and stage C, sex organ developmental phase, in mid-March of the next year. Total RNA from P. chinensis and Arabidopsis tissues was isolated from each sample using an EASYspin Plus Plant RNA Kit (Tiangen Biotech Co., Beijing, China) and monitored on 1% agarose gels. Then, RNA purity was checked using a NanoDrop 2000C spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and integrity was assessed using an RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). For reverse transcription PCR, 2 μg of total RNA digested with RQ1 RNase-Free DNase (Promega Corporation, Madison, WI, USA) was used with M-MLV Reverse Transcriptase (Promega), following the manufacturer’s instructions. The resulting cDNA was used as the template to clone a specific gene and for quantitative real-time PCR (qRT-PCR) analysis. For the qRT-PCR experiments, GoTaq qPCR Master Mix was used according to the manufacturer’s instructions (Promega) using ABI StepOne Plus (Applied Biosystems, Foster City, CA, USA). The experiments were carried out in three replicates. Specific primers used in this study are listed in Table S1. For the P. chinensis samples, PcGAPDH and Pcactin screened from our transcriptome data were used as reference genes [30,31]. For the Arabidopsis samples, ACTIN2 (ACT2, At3g18780) was used as the reference gene. Relative expression levels of each gene were calculated using the 2−ΔΔCT method [32].

2.3. Bioinformatics Analyses

The sequence data of PcHsp70-1 and PcHsp90 have been submitted to the GenBank databases under accession numbers MK033598 and MK033599. The deduced amino acid sequences were analyzed with ORF (open reading frame) Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html, accessed on 5 March 2023). The similarity analyses of nucleotide and protein sequences were carried out by BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 5 March 2023). The motif sequences were searched using Motif Scan (http://myhits.isb-sib.ch/cgi-bin/motif_scan, accessed on 5 March 2023). The amino acid sequences of homologous proteins were aligned using ClustalX [33] with default parameters.

2.4. Cloning Procedures, Plasmid Construction, and Plant Transformation

The pCAMBIA1300 vector was modified by inserting a CaMV35S promoter synthesized by the Sangon Company (Shanghai, China) into the multi-cloning site (between EcoRI and SacI) and by cloning the NOS terminator from the pBI121 vector into the multi-cloning site (between SphI and HindIII).
The ORFs of the PcHsp70-1 and PcHsp90 genes were amplified by PCR using the primers ATGGCGAGTACAAGCGAAGGCAAAG/TTAATTTTAATCAACTTCTTCAATCTTCG and ATGGCAGAAGAAGCCAAAGCCAAAG/TTATCTCATTTGGACAATTCCAGCATTG, respectively. PcHsp70-1 was integrated into the KpnI and PstI restriction sites of the pCAMBIA1300 vector and named 35S::PcHsp70-1, and 35S::PcHsp90 was obtained in the same manner. To visualize the subcellular localization of PcHsp70-1 and PcHsp90, the 35S::PcHsp70-1-enhancedGFP (eGFP) and 35S::PcHsp90-eGFP vectors were constructed. All essential amplicons were sequenced by BGI Life Tech Co. Ltd. (Beijing, China).
To generate transgenic Arabidopsis plants, the appropriate binary plasmids were transferred individually into Agrobacterium tumefaciens strain GV3101. Stable transgenic plants were obtained using the floral-dip method [34]. Antibiotic-resistant T0 transgenic lines were analyzed by PCR. T1 plants containing single transgene integration events were confirmed by their approximate 3:1 segregation ratio for hygromycin resistance. Among the T2 plants, homozygous lines were selected by observing their hygromycin resistance after self-pollination. T3 homozygous seeds of Arabidopsis were used for subsequent experiments.

2.5. Subcellular Localization in Arabidopsis Roots

To examine the subcellular localization of the PcHsp70 and PcHsp90 proteins, their full-length cDNAs were independently fused with eGFP. The constructs and the positive control, containing only eGFP, were independently transformed into Arabidopsis. The roots of 1–2-week-old Arabidopsis were stained with 4′,6′-diamidino-2-phenylindole (DAPI, 5 μM) for 30 min. Green and blue fluorescence states were observed using a Leica SP8 confocal microscope (Leica Microsystems GmbH, Wetzlar, Germany) with the following confocal settings: excitation at 488 nm (GFP) and 340 nm (DAPI) and emission at 505–535 nm (GFP) and 460–485 nm (DAPI).

2.6. Drought Treatments for Transgenic Plants

Arabidopsis plants of the various genotypes were grown in soil under normal conditions as described. Initially, the hypocotyl and primary root lengths were recorded after germination for 4, 7, 10, and 14 d. When most of the seedlings began to bolt, the rosette leaf numbers, bolting numbers, and fresh weights were recorded.
For the drought-tolerance test, the wild type and mutants were sown 2 d in advance to ensure that the physiological states of the seedlings were more consistent during the drought treatment. The 14 d old non-transgenic seedlings and mutants, as well as 12 d old transgenic seedlings, were initially grown in soil under normal watering conditions for 2 weeks. The watering conditions were as follows: after the surface soil is dry, water it again to ensure that the roots have breathing space, approximately every 3 days. Then, watering was stopped for an additional 2 weeks. We observed the drought response of each line plant after drought treatment, took samples in a wilted state for physiological indicators, and calculated the survival rate. A plant was determined to be a survivor if its leaves remained green 3 days after re-watering. These experiments were repeated at least three times.

2.7. Physiological Index Measurement and Phenotype Observation

When wild-type plants started to exhibit the lethal effects of dehydration, rosette leaves from the same part of each genotype were collected for chlorophyll, proline, and relative water content (RWC) determinations. Leaves of each genotype after not being watered for 10 days were used to measure.
The chlorophyll concentration was measured using a SPAD-502Plus chlorophyll meter (Konica-Minolta Holdings, Inc., Tokyo, Japan). Five mature rosette leaves in the central region from at least three individual plants of each line were selected to measure as follows: when measuring, avoid leaf veins, leaf tips, and petioles to ensure the accuracy of the data. After calibrating the equipment, gently place the sensor on the blade surface, then measure and record the data.
The proline content of both P. chinensis and Arabidopsis was determined by using a proline assay kit (A107, Nanjing Jiancheng, Nanjing, China), as follows: Accurately weigh the plant tissue, add 9 times the volume of extract according to the ratio of weight (g)/volume (mL) = 1:9, mechanically homogenize in ice water bath to prepare a 10% tissue homogenate, centrifuge at 3500 rpm for 10 min, take the supernatant for detection, boil in water for 30 min, cool down, measure, and record at a wavelength of 520 nm.
SOD activity of P. chinensis was determined by using a SOD assay kit (A001-2, Nanjing Jiancheng, Nanjing, China) as follows: Weigh the sample, and add 1-fold volume of extraction solution according to the ratio of weight (g)/volume (mL) = 1:1; after homogenization, centrifuge at 3500–4000 rpm for 15 min. Then the supernatant was taken for SOD measurement as follows: after adding the reagents according to the reaction system, mix thoroughly and put them in a constant-temperature water bath at 37 °C for 40 min. Afterwards, the color developer was added, mixed well, let stand at room temperature for 10 min, and then measured at a wavelength of 550 nm. The same reaction treatment was performed with physiological saline as a control.
Leaf RWC was examined by the weighing method according to Turner’s method [35] as follows: take out approximately 10 leaves, weigh their fresh weight using a one-ten thousandth scale, dry them in an oven at 105 °C to a constant weight, then weigh them and calculate RWC. In addition, trypan blue staining and 3,3′-diaminobenzidine (DAB) staining were performed to display the dead cells and reactive oxygen species (ROS), respectively, as described previously [36], as follows: Dye with trypan blue, put 10 slices of leaves into a beaker, add an appropriate amount of trypan blue dye, boil in a water bath for 1 min, then decolorize with decolorization solution until the tissue is transparent. For DAB staining, 10 leaves were incubated in DAB staining solution (0.5 mg/mL) for 24 h as follows: Discard the DAB solution, add 80% ethanol, soak in boiling water for 5 min, pour out the waste liquid, and add 80% ethanol until the leaves are completely decolorized. All the stained leaves were observed under a microscope. In addition, to show the degree of drought, the soil water content (SWC) was detected by drying method [14] as follows: take out the soil samples and dry them at 105 ± 2 °C until they reach a constant weight, then weigh them and calculate SWC.

2.8. Statistical Analysis

The significant differences were statistically analyzed by ANOVA using IBM SPSS Statistics v20. Multiple comparisons were performed using Duncan’s test. At the level of p < 0.05, significant differences are indicated by lowercase letters.

3. Results

3.1. Sex-Related Responses and Expression Profile Analyses of Hsp Genes During Sex Differentiation

During floral development in dioecious and monoecious P. chinensis, both male and female florets form bisexual primordia, and the selective abortion of the opposite organ results in unisexual florets [18]. The B stage may be the key period of sex differentiation; meanwhile, according to the rainfall at the sampling time, the drought degree is B > A > C. When drought intensified, proline content and SOD activity increased in all sexes, and female and monoecious types showed greater drought resistance than male types, especially expressed in proline content (Figure 1). All five studied genes were upregulated in all the sexes in stage B (Figure 1). Although c69939_g1 (Hsf), c54009_g1 (Hsp70-90), and c68810_g1 (Hsp70-2) showed sex-dependent differences in expression in stages A and B, the increases were gradual and coincided with floral development. The expression levels of c58871_g1 (Hsp70-1) and c68954_g1 (Hsp90) showed significant differences among the sexes, especially in stage B (p < 0.05). Thus, these genes may be associated with female and monoecious floral buds’ development, which was investigated further.

3.2. Molecular Cloning and Sequence Analyses of Hsp70-1 and Hsp90 cDNAs from P. chinensis

To further verify the functions of c58871_g1 (Hsp70-1) and c68954_g1 (Hsp90), their ORFs were obtained using 5′- and 3′-end primers and DNAMAN software. The ORF of Hsp70-1 was 1974 bp and predicted to encode a protein of 657 amino acids (Figure S4). There were three conserved signatures of the Hsp70 family (signature 1, IDLGTTYS; signature 2, IFDLGGGTFDVSLL; and signature 3, VVLVGGSTRIPKVQSL), a characteristic cytoplasmic motif, EEVD, two additional specific motifs, the putative adenosine triphosphate (ATP)-guanosine triphosphate (GTP)-binding domain (AEAYLG), and the potential bipartite nuclear localization signal RRKNKKDISGNARALRR (residues 252–268) in Hsp70-1 (Figure S4).
The Hsp90 ORF (2106 bp) encoded a protein of 701 amino acids (Figure S5). Five signature motifs were identified in the Hsp90 amino acid sequence (signature 1, YSNKEIFLRE; signature 2, LGTIARSGT; signature 3, IGQFGVGFYSAYLVAE; signature 4, IKLYVRRVFI; and signature 5, GVVDSDDLPLNISRE) (Figure S5), which represent highly conserved regions present in all Hsp90 family members. Additionally, the C-terminal motif was MEEVD (Figure S5), which is cytoplasmic Hsp90-specific. The deduced amino acid sequence of PcHsp90 shared high homology levels with those of other known Hsp90s proteins, especially in the regions containing Hsp90-family signatures (Figure S5).

3.3. Subcellular Localization of the PcHsp70-1 and PcHsp90 Genes

According to the Plant-PLoc computational results, PcHsp70-1 is predicted to be localized in the nucleus, while PcHsp90 is predicted to be localized in the cytoplasm. To confirm their predicted localizations, their proteins were expressed in Arabidopsis as fusions with eGFP under the control of the CaMV35S promoter. The control proteins had signals in the cytoplasm and the nucleus, and the nuclei were counterstained with DAPI (Figure 2a–d). Like those of the control protein, the signals of 35S::PcHsp70-1-eGFP and 35S::PcHsp90-eGFP were also observed in both the cytoplasm and the nucleus (Figure 2e–l).

3.4. Phenotypic Characteristics of Transgenic Arabidopsis

The phenotypic characteristics of two transgenic lines OX-PcHsp70-L2 (70-L2) and OX-PcHsp70-L19 (70-L19) containing PcHsp70-1; transgenic lines OX-PcHsp90-L5 (90-L5) and OX-PcHsp90-L6 (90-L6) containing PcHsp90; as and wild type and two mutants were observed. The growth rates of the mutant plants were similar to those of the wild type. However, the hypocotyl and root lengths are not shown in Figure 3a owing to their irregular root growth patterns (Figure 3b). On the contrary, the expression levels in other plants having the same genotype were relatively consistent; consequently, the average values of the measured data of the two lines are presented in Figure 3a. In the first week, there were no phenotypic differences between transgenic plants and wild type. However, the hypocotyls of PcHsp70-1 transgenic plants were longer than those of wild-type and PcHsp90 transgenic plants, and the root lengths of PcHsp70-1 and PcHsp90 transgenic plants were significantly greater than those of the wild type on day 10. The 2-week-old transgenic seedlings were stronger than the wild type and mutants, with longer main roots, especially those of PcHsp70-1 transgenic plants, which grew lateral roots (Figure 3b). Additionally, the PcHsp70-1 transgenic Arabidopsis differentiated into multiple meristems at this point (Figure 3c) and then formed large amounts of vegetative tissue (Figure 3d). Finally, almost every meristem could bear a bolting, resulting in one to five boltings per seedling (Figure 3e). Moreover, they flowered earlier than the other genotypes (Figure 3e). In addition, both PcHSP70-1 and PcHSP90 were highly expressed in the transgenic lines (Figure 3f,g). AtHsp70 was lowly expressed in the wild type and almost not expressed in the hsp70 line, while AtHsp90 was barely expressed in the wild-type and hsp90 lines.
More indices were measured to detail the characteristics of flowering and bolting. Although the roots of the mutants were untidy, there was no significant difference between their aboveground parts and those of the wild type (Figure 3h–k). The flowering of PcHsp70-1 transgenic plants was advanced by 4 d compared with that of wild type (Figure 3h). In addition, their rosette leaf numbers at bolting were as great as 14.12 (70-L2) and 15.52 (70-L19), while those of other genotypes ranged from 9.37 (wild type) to 10.00 (hsp90) (Figure 3i). Additionally, they generally produced more than two boltings (Figure 3j), and their fresh weights were ~1.5 times greater than those of the other plants (Figure 3k). Although the root systems of PcHsp90 transgenic plants were more developed than those of the wild type (Figure 3a,b), their aerial parts were not significantly different at bolting (Figure 3c–e,h–k).
To determine whether the early flowering and increased bolting characteristics of PcHSP70-1 transgenic plants are related to flowering-related genes, the expression profiles of Hsp70 and seven flowering-related genes were analyzed by qRT-PCR. The transcript levels of FLOWERING LOCUS T (FT), SUPPRESSOR OF CONSTANS OVEREXPRESSOR 1 (SOC1), SQUAMOSA PROMOTER-BINDING PROTEIN-LIKE 3 (SPL3), APETALA 1 (AP1), FRUITFULL (FUL), LEAFY (LFY), and AGAMOUS-LIKE 24 (AGL24) of wild type, hsp70, 70-L2, and 70-L19 were detected 6, 10, and 14 d after germination. The expression levels were not significantly different between hsp70 and wild type. The PcHSP70-1 transcript levels were consistently highly expressed in the transgenic lines (Figure 4). With the growth and development of the plant, the expression levels of flowering-related genes increased in all the genotypes, especially in the transgenic plants (Figure 4). Typically, the transcript levels of AP1 and FUL in 70-L2 and 70-L19 were greater than those in the wild type 6 d after germination and reached 88.1 and 91.6 times those of wild type, respectively, in 70-L19 14 d after germination. Thus, overexpression of PcHSP70-1 could upregulate the expression of flowering-related genes and promote bolting and flowering.

3.5. Overexpression of PcHSP70-1 Enhanced Drought Resistance in Arabidopsis

To further analyze the roles of the PcHsp70-1 and PcHsp90 genes under drought stress, ~4-week-old seedlings of wild type, hsp70, 70-L2, 70-L19, hsp90, 90-L5, and 90-L6 were used for drought treatment. The soil water content was 43.1% before treatment. Phenotypically, both 70-L2 and 70-L19 maintained the characteristics of more rosette leaves and bolting during drought stress (Figure 5a). Moreover, all of the transgenic lines showed remarkable drought resistance compared with wild type and mutants (Figure 5a). When the water was stopped for 14 d (SWC: 19.1%), the whole wild-type and mutant plants were seriously wilted and the bolting drooped, while the new leaves of transgenic plants remained green. After being re-watered for 3 d (SWC: 33.9%), the survival rates of both PcHsp70-1 and PcHsp90 transgenic Arabidopsis were significantly greater than those of the wild type and mutants (Figure 5b).
After watering had been stopped for 10 d (SWC: 23.0%), the rosette leaves from the same sections of each genotype under normal conditions and under drought stress were collected to evaluate the physiological indices. The trypan blue staining of old rosette leaves showed that the wild type and mutants accumulated more blue dye, indicating that their cell membranes suffered more damage than those of the transgenic plants (Figure 6a). Similarly, the DAB staining revealed that the brown areas of wild type and mutants were larger and darker, indicating that they accumulated more active oxygen (Figure 6a). The proline contents in all of the plants increased significantly after drought stress, especially in PcHsp70-1 and PcHsp90 transgenic plants, which contained more than 2.5 times and 2 times, respectively, the amount of proline than non-transgenic plants (Figure 6b). Under normal conditions, the chlorophyll content of PcHsp70-1 transgenic Arabidopsis was significantly greater than that of other genotypes. Moreover, the chlorophyll contents of PcHsp70-1 transgenic plants under drought stress were slightly greater than those of normal seedlings, but the difference was not significant. In the mutants, wild type, and PcHsp90 transgenic plants, the decreases were significant under drought stress, with the decline in the mutants being the greatest followed by that of the wild type (Figure 6c). For the RWC, none of the genotypes showed a difference under control conditions. Under drought stress, the non-transgenic plants wilted earlier, and their RWC values decreased by nearly half. However, the PcHsp70-1 transgenic plants maintained the greatest RWC, 81.9% (70-L2) and 83.1% (70-L19), which were not significantly different from the values of non-stressed plants, and the RWC of PcHsp90 transgenic plants only declined by ~10% (Figure 6d).

4. Discussion

4.1. P. chinensis Hsps Are Directly or Indirectly Involved in Multiple Processes

Previous works have focused on Hsp responses to stresses such as heat shock, drought, chilling, and salinity [37,38], and our study verified the drought-resistance functions of PcHsp70-1 and PcHsp90. Furthermore, both the transcriptome data and qRT-PCR results in P. chinensis suggested that Hsps may play roles in sex differentiation (Figure 1). Additionally, PcHSP70-1 transgenic Arabidopsis could develop more rosette leaves and boltings through greater meristem levels and also advance the flowering time. More importantly, these phenotypes can also be maintained under drought stress. These findings clearly indicated that Hsps can have extensive effects on plant morphology, development, and adaptability. The floral development of P. chinensis was exposed to various stresses such as drought and high temperature, and the PcHSP70-1 can both enhance drought resistance and promote flowering, thus being of great significance for improving the yield of P. chinensis in the future.

4.2. Possible Mechanisms of PcHSP70-1 Promoting the Growth and Flowering of Arabidopsis

Early flowering is often accompanied by fewer rosette leaves [39], but our PcHsp70-1 transgenic plants formed more rosette leaves when the flowering was earlier. However, every bolting was allocated ~seven rosette leaves on average (Figure 3), which fitted the pattern of early flowering. Additionally, both their aboveground and underground parts were well developed and had greater fresh weights (Figure 3). Therefore, the transgenic plants had the appearance of multiple individuals growing together with an accelerated growth rate. For hsp70 and hsp90, AtHsp70 (At1g16030) and AtHsp90 (At5g52640) might have a slight effect on the roots, but neither the hsp70 nor hsp90 lines displayed obvious morphological abnormalities in this study (Figure 3). Over 15 Hsp70s and 7 Hsp90s have been identified in A. thaliana [40,41], suggesting functional redundancy among Hsps.
PcHsp70-1 could affect the vegetative development and reproductive growth of Arabidopsis and advance flowering by directly or indirectly upregulating some flowering-related genes, including the FT, SOC1, SPL3, AP1, FUL, LFY, and AGL24. The FT gene can regulate the transcription factor SOC1, which can interact with AGL24 to directly activate LFY expression [26,42]. LFY is a flowering integrator gene in the vegetative to the reproductive phases and can also act as a floral meristem identity gene along with AP1 [43,44]. Moreover, the SPL gene can directly bind to the promoters of floral meristem identity genes, like AP1, LFY, and FUL [45,46]. The expression levels of these genes were significantly greater in PcHsp70-1 transgenic plants than in the wild type, and their levels increased rapidly, particularly those of AP1 and FUL, which are floral meristem identity genes (Figure 4). Similarly, Hsp90 was linked with flowering gene pathways using an RNAi approach, which showed essential and extensive roles for Hsp90 during the vegetative-to-reproductive phase transition and floral development [26]. Margaritopoulou and colleagues [26] hypothesized that Hsp90 may facilitate the capability of flowering-related genes to interact with each other and maintain their activities at the established levels, thus promoting and modulating downstream gene pathways. PcHsp70-1 might play a similar role.

4.3. Possible Mechanisms of Drought Resistance in Transgenic Arabidopsis

Under normal conditions, the primary root lengths of transgenic Arabidopsis were greater than those of the wild type and mutants (Figure 3), which aids in absorbing nutrients and water. Also, the greater chlorophyll contents of PcHSP70-1 transgenic plants compared with those of other genotypes (Figure 6) enhanced photosynthesis. In addition, for the PcHsp90 transgenic plants, their proline contents were significantly greater than those of the other genotypes (Figure 6). Proline is an osmotic substance that can help maintain the osmotic balance and the integrity of the membranes; therefore, its content can reflect the capacity of plants to resist stress to some extent [47,48]. Thus, the transgenic plants had some basic characteristics of drought resistance, and under drought stress, both the PcHsp70-1- and PcHsp90-overexpressing plants could resist drought, especially 70-L19 (Figure 5). Moreover, when plants are exposed to drought stress, cellular homeostasis is altered, and ROS are generated. ROS are not only signaling molecules during stress but can also be toxic when accumulated excessively [49]. DAB staining results show that the PcHsp70-1 and PcHsp90 transgenic Arabidopsis accumulated fewer ROS than the wild-type and mutant plants (Figure 6). This indicates that the PcHsps transgenic lines, while enhancing drought resistance, can better balance ROS production and scavenging. Transgenic A. thaliana may resist drought in various ways, such as increasing the proline content to regulate osmotic pressure, thus reducing cell membrane damage and maintaining high water content, reducing the accumulation of reactive oxygen to alleviate membrane lipid oxidation, and maintaining the chlorophyll content to retain a strong photosynthetic capacity (Figure 6).

4.4. The Correlation Between the Sex Expressions of P. chinensis and Environment

We obtained 200 grafted trees using scions of different sex types on monoecious P. chinensis, and the sex types of grafted trees cannot completely maintain the sex of scions [18], indicating the environment may affect sex determination. Previous studies have proved that plant growth can flexibly adapt to stresses [50,51], and the environment may affect the sex distribution and proportion of the Pistacia genus [52,53], such as male-biased P. chinensis populations appearing in poor-soil-nitrogen areas [54]. The increase in proline content and SOD activity in stage B proved that the floral differentiation was indeed subject to drought stress, and the female increased faster (Figure 1), indicating that the female had a stronger response to drought. At the protein level, both the differentiation of female primordium and male primordium were associated with enhanced oxidative stress resistance, and the Cu/Zn superoxide dismutases that were differentially expressed between female and bisexual floral buds during sex differentiation could act as possible markers for sex determination in monoecious P. chinensis [55]. According to the theory of Horandl and Speijer [56], the first step in the evolutionary order of events was repairing oxidative damage, which happens during prophase I of meiosis, the most indispensable phase of sex. Combined with the hypothesis that all Pistacia species may have evolved from hermaphroditic ancestors under environmental stress [12], sex differentiation may be inherently linked to the environment.
Our previous study revealed that in the early stages of floral bud development in P. chinensis, bisexual primordia initially coexist. During subsequent differentiation, one sex undergoes abortion, leading to the formation of unisexual flowers [18]. This suggests that the dioecious P. chinensis possesses an inherent potential for monoecy. Interestingly, a considerable number of monoecious germplasms have been identified in the arid and semi-arid mountainous regions of northern China. Biochemical and molecular analyses indicate a potential correlation between sex determination and stress resistance in P. chinensis (Figure 1). In the present study, we found that overexpression of the PcHsp70-1 resistance gene not only enhanced stress tolerance but also promoted bolting and flowering. Based on our findings, we propose a potential model linking environmental factors with sex differentiation in P. chinensis (Figure 7). Plant hormones play a crucial role in flowering and sex determination, and the ultimate expression of sexual phenotype is likely regulated through a coordinated interplay of environmental cues, hormonal signals, and genetic factors [57,58,59]. The occurrence of monoecy in P. chinensis, a species widely regarded as dioecious, suggests that environmental factors may act as a regulatory switch for sex determination, with hormones playing an indispensable role in this process. However, the intricate interactions between these factors remain largely unexplored, highlighting a key direction for future research on sex differentiation and floral development in P. chinensis.

5. Conclusions

In summary, this study provided more support for the hypothesis that sex differentiation of P. chinensis is related to environmental stress involving environmental responsive genes. First, the proline content and SOD activity of female floral buds were higher than that of males, proving that different sex types of P. chinensis have different responses to environmental stress. Second, PcHsp70-1 and PcHsp90 were differentially expressed between sexes during the sex differentiation phase, indicating that they play roles in sex differentiation. In addition, conservative and new functions of PcHsp70-1 and PcHsp90 were identified. The sequences of PcHsp70-1 and PcHsp90 were highly conserved, and 35S::PcHsp70-1-eGFP and 35S::PcHsp90-eGFP were localized both in the nucleus and cytoplasm. At the phenotypic level, overexpression of PcHSP70-1 accelerated growth, promoted bolting, and advanced flowering. At the gene expression level, the early flowering phenotype may be closely related to the significantly increased expression levels of PcHSP70-1 and flowering-related genes. At the biochemical level, overexpression of PcHsp70-1 and PcHsp90 could enhance drought resistance by increasing the proline content and alleviating membrane lipid oxidation, thus reducing cell membrane damage and maintaining chlorophyll and water contents. In summary, the characterizations of PcHsp70-1 and PcHsp90 functions provide new insights into floral-developmental and stress-responsive pathways.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/f16030395/s1, Figure S1. The most enriched pathway during the bisexual-to-unisexual phase obtained from transcriptome analysis: ko04141 (Protein processing in the endoplasmic reticulum); Figure S2. One of the most enriched pathways during the bisexual-to-unisexual phase obtained from transcriptome analysis: ko04144 (Endocytosis); Figure S3. One of the most enriched pathways during the bisexual-to-unisexual phase obtained from transcriptome analysis: ko03040 (Spliceosome); Figure S4. Alignment and comparison of Hsp70s’ deduced amino acid sequences from PcHsp70-1 (Pistacia chinensis, the present sequence) with those of different species. Figure S5. Alignment and comparison of Hsp90s’ deduced amino acid sequences from PcHsp90 (Pistacia chinensis, the present sequence) with different species. Table S1. Primers used in the qRT-PCR.

Author Contributions

Conceptualization, Q.B. and S.S.; investigation, Q.B., Y.Z., H.L., G.C., J.D. and M.L.; writing—original draft Y.Z. and Q.B.; writing—review and editing, Q.B. and S.S.; project administration, Q.B. and S.S.; funding acquisition, Q.B. and S.S. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by National Natural Science Foundation of China (Grant No. 32301629) and 5·5 Engineering Research & Innovation Team Project of Beijing Forestry University (No. BLRC2023B08).

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Lu, L.; Jiang, D.; Zhuang, D.; Huang, Y. Evaluating the marginal land resources suitable for developing Pistacia chinensis-based biodiesel in China. Energies 2012, 5, 2165–2177. [Google Scholar] [CrossRef]
  2. Chen, F.; Lin, W.; Li, W.; Hu, J.; Li, Z.; Shi, L.; Zhang, Z.; Xiu, Y.; Lin, S. Determination of superior Pistacia chinensis accession with high-quality seed oil and biodiesel production and revelation of LEC1/WRI1-mediated high oil accumulative mechanism for better developing woody biodiesel. BMC Plant Biol. 2023, 23, 268. [Google Scholar] [CrossRef]
  3. Cheng, X.; Wang, F.; Luo, W.; Kuang, J.; Huang, X. Transcriptome analysis and identification of a female-specific SSR marker in Pistacia chinensis based on illumina paired-end RNA sequencing. Genes 2022, 13, 1024. [Google Scholar] [CrossRef] [PubMed]
  4. Cheng, S.P. Tissue Culture and Rapid Propagation of Cotyledonary Nodes and Sex Identification of Pistacia chinensis Bunge. Master’s Thesis, Henan University of Science and Technology, Luoyang, China, 2011. [Google Scholar]
  5. Huang, S.F.; Zhao, Z.F.; Chen, Z.Y.; Chen, S.J.; Huang, X.X. Chromosome counts on one hundred species and infraspecific taxa. Acta Bot. Austro. Sin. 1989, 5, 161–176. [Google Scholar]
  6. Jonasson, S.; Medrano, H.; Flexas, J. Variation in leaf longevity of Pistacia lentiscus and its relationship to sex and drought stress inferred from leaf δ13C. Funct. Ecol. 1997, 11, 282–289. [Google Scholar] [CrossRef]
  7. Li, G.P.; Yang, L.S. Comparative analysis of water-soluble phenolic substances and oxidases activity in the male and female plant of Pistacia chinensis. Genomics Appl. Biol. 2012, 31, 385–388. [Google Scholar]
  8. Ma, L.Y. Study on the Main Morphological and Physiological Characteristics Between Male and Female Plants of Pistacia chinensis Bunge. Master’s Thesis, Agricultural University of Hebei, Baoding, China, 2012. [Google Scholar]
  9. Sun, Q.; Yang, X.; Li, R. SCAR marker for sex identification of Pistacia chinensis Bunge (Anacardiaceae). Genet. Mol. Res. 2014, 13, 1395–1401. [Google Scholar] [CrossRef] [PubMed]
  10. Wang, X.Y. The Comparative Study on Biological Characteristic Between Female and Male Individuals of Pistacia chinensis Bunge. Master’s Thesis, Henan University of Science and Technology, Luoyang, China, 2013. [Google Scholar]
  11. Xiong, E.; Wu, X.; Shi, J.; Wang, X.; Wang, W. Proteomic identification of differentially expressed proteins between male and female plants in Pistacia chinensis. PLoS ONE 2013, 8, e64276. [Google Scholar] [CrossRef] [PubMed]
  12. Bai, Q.; Ma, Z.; Zhang, Y.Q.; Su, S.C.; Leng, P.S. The sex expression and sex determining mechanism in Pistacia species. Breeding Sci. 2019, 69, 205–214. [Google Scholar] [CrossRef] [PubMed]
  13. Guan, X.W.; Chen, Z.Z.; Zhang, Y.T.; Yang, J.H.; Meng, X.D. Physiological response of Pistacia chinensis Bunge and Xanthoceras sorbifolia Bunge of drought Stress. Shandong For. Sci. Technol. 2012, 42, 1–353. [Google Scholar]
  14. Liu, K.; Liu, Z.; Shi, A.; Zhang, K. Container seedling for Pistacia chinensis and study on its drought resistance. J. Beijing For. Univ. 2002, 24, 27–30. [Google Scholar]
  15. Du, Q.S.; Gao, C.G.; Wang, R.X.; Zhou, X.P.; Zhang, Y.T. Comparison of evaluation methods for drought resistance of 3 tree species. For. Sci. Technol. 2022, 38, 48–54. [Google Scholar]
  16. Li, X.X.; Lu, B.S.; Wang, H.B. NaCl stress on electrical impedance spectroscopy parameters and activities of antioxidative enzymes of Pistacia chinensis Bunge. Mol. Plant Breed. 2019, 17, 6833–6839. [Google Scholar]
  17. Bai, Q.; Su, S.C.; Lin, Z.; Leng, P.S.; Wang, W.H. The variation characteristics and blooming phenophase of monoecious Pistacia chinensis Bunge. HortScience 2016, 51, 961–967. [Google Scholar] [CrossRef]
  18. Bai, Q.; Zhu, C.Y.; Lei, X.; Cao, T.; Su, S.C.; Leng, P.S. Sex determination during inflorescence bud differentiation in monoecious Pistacia chinensis Bunge. Forests 2019, 10, 202. [Google Scholar] [CrossRef]
  19. Majee, A.; Kumari, D.; Sane, V.A.; Singh, R.K. Novel roles of HSFs and HSPs, other than relating to heat stress, in temperature-mediated flowering. Ann. Bot. 2023, 132, 1103–1106. [Google Scholar] [CrossRef] [PubMed]
  20. Gupta, S.C.; Sharma, A.; Mishra, M.; Mishra, R.K.; Chowdhuri, D.K. Heat shock proteins in toxicology: How close and how far? Life Sci. 2010, 86, 377–384. [Google Scholar] [CrossRef] [PubMed]
  21. Rezaul, I.M.; Baohua, F.; Tingting, C.; Weimeng, F.; Caixia, Z.; Longxing, T.; Guanfu, F. Abscisic acid prevents pollen abortion under high-temperature stress by mediating sugar metabolism in rice spikelets. Physiol. Plant. 2019, 165, 644–663. [Google Scholar] [CrossRef] [PubMed]
  22. Qin, F.; Yu, B.; Li, W. Heat shock protein 101 (HSP101) promotes flowering under nonstress conditions. Plant Physiol. 2021, 186, 407–419. [Google Scholar] [CrossRef]
  23. Ma, L.; Zhang, T.; Zhu, Q.H.; Zhang, X.; Sun, J.; Liu, F. HSP70 and APX1 play important roles in cotton male fertility by mediating ROS homeostasis. Int. J. Biol. Macromol. 2024, 278, 134856. [Google Scholar] [CrossRef] [PubMed]
  24. Yi, L.; Li, X.; Chen, J.; Xia, S. Creation of male sterile line in tobacco with HSP70 anti-sense fragment. Agric. Sci. Technol. 2016, 17, 2262. [Google Scholar]
  25. Deng, Z.H. Molecular Identification of the Male-Sterile Gene BnRf b of a Genic Male Sterility Line 9012A in Brassica napus L. Ph.D. Thesis, Huazhong Agricultural University, Wuhan, China, 2016. [Google Scholar]
  26. Margaritopoulou, T.; Kryovrysanaki, N.; Megkoula, P.; Prassinos, C.; Samakovli, D.; Milioni, D.; Hatzopoulos, P. HSP90 canonical content organizes a molecular scaffold mechanism to progress flowering. Plant J. 2016, 87, 174–187. [Google Scholar] [CrossRef] [PubMed]
  27. Zheng, T. The Research on Suitability Evaluation of Advantage Grain and Oil Crops on the Taihang Mountainous Area. Master’s Thesis, Hebei Agricultural University, Baoding, China, 2015. [Google Scholar]
  28. Alonso, J.M.; Stepanova, A.N.; Leisse, T.J.; Kim, C.J.; Chen, H.; Shinn, P.; Stevenson, D.K.; Zimmerman, J.; Barajas, P.; Cheuk, R. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 2003, 301, 653–657. [Google Scholar] [CrossRef] [PubMed]
  29. Woody, S.T.; Austin-Phillips, S.; Amasino, R.M.; Krysan, P.J. The WiscDsLox T-DNA collection: An Arabidopsis community resource generated by using an improved high-throughput T-DNA sequencing pipeline. J. Plant Res. 2007, 120, 157–165. [Google Scholar] [CrossRef]
  30. Jazi, M.M.; Khorzoghi, E.G.; Botanga, C.; Seyedi, S.M. Identification of reference genes for quantitative gene expression studies in a non-model tree pistachio (Pistacia vera L.). PLoS ONE 2016, 11, e0157467. [Google Scholar]
  31. Reid, K.E.; Olsson, N.; Schlosser, J.; Peng, F.; Lund, S.T. An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development. BMC Plant Biol. 2006, 6, 27. [Google Scholar] [CrossRef] [PubMed]
  32. An, Y.; McDowell, J.M.; Huang, S.; McKinney, E.C.; Chambliss, S.; Meagher, R.B. Strong, constitutive expression of the Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues. Plant J. 1996, 10, 107–121. [Google Scholar] [CrossRef] [PubMed]
  33. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed]
  34. Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [PubMed]
  35. Turner, N.C. Techniques and experimental approaches for the measurement of plant water status. Plant Soil 1981, 58, 339–366. [Google Scholar] [CrossRef]
  36. Lee, S.; Seo, P.J.; Lee, H.J.; Park, C.M. A NAC transcription factor NTL4 promotes reactive oxygen species production during drought-induced leaf senescence in Arabidopsis. Plant J. 2012, 70, 831–844. [Google Scholar] [CrossRef]
  37. Li, B.; Gao, K.; Ren, H.; Tang, W. Molecular mechanisms governing plant responses to high temperatures. J. Integr. Plant Biol. 2018, 60, 757–779. [Google Scholar] [CrossRef] [PubMed]
  38. Ul Haq, S.; Khan, A.; Ali, M.; Khattak, A.M.; Gai, W.X.; Zhang, H.X.; Wei, A.M.; Gong, Z.H. Heat Shock Proteins: Dynamic biomolecules to counter plant biotic and abiotic stresses. Int. J. Mol. Sci. 2019, 20, 5321. [Google Scholar] [CrossRef]
  39. Takada, S.; Goto, K. TERMINAL FLOWER2, an Arabidopsis homolog of HETEROCHROMATIN PROTEIN1, counteracts the activation of FLOWERING LOCUS T by CONSTANS in the vascular tissues of leaves to regulate flowering time. Plant Cell 2003, 15, 2856–2865. [Google Scholar] [CrossRef] [PubMed]
  40. Lin, B.L.; Wang, J.S.; Liu, H.C.; Chen, R.W.; Meyer, Y.; Barakat, A.; Delseny, M. Genomic analysis of the Hsp70 superfamily in Arabidopsis thaliana. Cell Stress Chaperon 2001, 6, 201. [Google Scholar] [CrossRef]
  41. Sangster, T.A.; Bahrami, A.; Wilczek, A.; Watanabe, E.; Schellenberg, K.; McLellan, C.; Kelley, A.; Kong, S.W.; Queitsch, C.; Lindquist, S. Phenotypic diversity and altered environmental plasticity in Arabidopsis thaliana with reduced Hsp90 levels. PLoS ONE 2007, 2, e648. [Google Scholar] [CrossRef]
  42. Lee, J.; Oh, M.; Park, H.; Lee, I. SOC1 translocated to the nucleus by interaction with AGL24 directly regulates LEAFY. Plant J. 2008, 55, 832–843. [Google Scholar] [CrossRef] [PubMed]
  43. Liu, X.; Wang, Q.; Jiang, G.; Wan, Q.; Dong, B.; Lu, M.; Deng, J.; Zhong, S.; Wang, Y.; Khan, I.A.; et al. Temperature-responsive module of OfAP1 and OfLFY regulates floral transition and floral organ identity in Osmanthus fragrans. Plant Physiol. Bioch. 2023, 203, 108076. [Google Scholar] [CrossRef]
  44. Périlleux, C.; Bouché, F.; Randoux, M.; Orman-Ligeza, B. Turning meristems into fortresses. Trends Plant Sci. 2019, 24, 431–442. [Google Scholar] [CrossRef] [PubMed]
  45. Chen, X.; Zhang, Z.; Liu, D.; Zhang, K.; Li, A.; Mao, L. SQUAMOSA promoter-binding protein-like transcription factors: Star players for plant growth and development. J. Integr. Plant Biol. 2010, 52, 946–951. [Google Scholar] [CrossRef] [PubMed]
  46. Jung, J.H.; Lee, H.J.; Ryu, J.Y.; Park, C.M. SPL3/4/5 integrate developmental aging and photoperiodic signals into the FT-FD module in Arabidopsis flowering. Mol. Plant 2016, 9, 1647–1659. [Google Scholar] [CrossRef] [PubMed]
  47. Zhu, X.; Duan, H.; Jin, H.; Chen, S.; Chen, Z.; Shao, S.; Tang, J.; Zhang, Y. Heat responsive gene StGATA2 functions in plant growth, photosynthesis and antioxidant defense under heat stress conditions. Front. Plant Sci. 2023, 14, 1227526. [Google Scholar] [CrossRef] [PubMed]
  48. Li, Z.; Long, R.; Zhang, T.; Wang, Z.; Zhang, F.; Yang, Q.; Kang, J.; Sun, Y. Molecular cloning and functional analysis of the drought tolerance gene MsHSP70 from alfalfa (Medicago sativa L.). J. Plant Res. 2017, 130, 387–396. [Google Scholar] [CrossRef] [PubMed]
  49. Miller, G.; Suzuki, N.; Ciftci-Yilmaz, S.; Mittler, R. Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ. 2010, 33, 453–467. [Google Scholar] [CrossRef]
  50. Chen, J.; Han, Q.; Duan, B.; Korpelainen, H.; Li, C. Sex-specific competition differently regulates ecophysiological responses and phytoremediation of Populus cathayana under Pb stress. Plant Soil 2017, 421, 203–218. [Google Scholar] [CrossRef]
  51. Liu, M.; Korpelainen, H.; Li, C.Y. Sexual differences and sex ratios of dioecious plants under stressful environments. J. Plant Ecol. 2021, 14, 920–933. [Google Scholar] [CrossRef]
  52. Nosrati, H.; Husainpourfeizi, M.A.; Khorasani, M.; Razban-Haghighi, A.; Nikniazi, M. Sex ratio and genetic diversity in the dioecious Pistacia atlantica (Anacardiaceae). J. Agrobiol. 2012, 29, 41–46. [Google Scholar] [CrossRef]
  53. Lu, J.T.; Qiu, Y.H.; Lu, J.B. Effects of landscape fragmentation on genetic diversity of male-biased dioecious plant Pistacia chinensis Bunge populations. Forests 2019, 10, 792. [Google Scholar] [CrossRef]
  54. Yu, L.; Lu, J. Does landscape fragmentation influence sex ratio of dioecious plants? A case study of Pistacia chinensis in the Thousand-Island Lake region of China. PLoS ONE 2011, 6, e22903. [Google Scholar] [CrossRef] [PubMed]
  55. Chen, Y.F.; Bai, Q.; Ruan, F.N.; Su, S.C. Proteomic analysis of differently expressed proteins in sex differentiation phases of flower buds in monoecious Pistacia chinensis Bunge. Isr. J. Plant Sci. 2019, 66, 182–195. [Google Scholar] [CrossRef]
  56. Horandl, E.; Speijer, D. How oxygen gave rise to eukaryotic sex. Proc. R. Soc. B 2018, 285, 20172706. [Google Scholar] [CrossRef] [PubMed]
  57. Wilkie, J.D.; Sedgley, M.; Olesen, T. Regulation of floral initiation in horticultural trees. J. Exp. Bot. 2008, 59, 3215–3228. [Google Scholar] [CrossRef]
  58. Kazan, K.; Lyons, R. The link between flowering time and stress tolerance. J. Exp. Bot. 2016, 67, 47–60. [Google Scholar] [CrossRef] [PubMed]
  59. Izawa, T. What is going on with the hormonal control of flowering in plants? Plant J. 2021, 105, 431–445. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Sex-related responses to drought and qRT-PCR analysis of selected Hsfs and Hsps during the floral bud differentiation process of Pistacia chinensis Bunge. The floral bud differentiation process involves stage A, asexual phase to bisexual phase; stage B, bisexual phase to unisexual phase; and stage C, sex organ developmental phase. AF: female floral buds during stage A; F: female floral buds; M: male floral buds; MF: monoecious female floral buds; MM: monoecious male floral buds. Error bars represent standard errors of the three independent biological replicates. Different lowercase letters indicate significant differences at p < 0.05.
Figure 1. Sex-related responses to drought and qRT-PCR analysis of selected Hsfs and Hsps during the floral bud differentiation process of Pistacia chinensis Bunge. The floral bud differentiation process involves stage A, asexual phase to bisexual phase; stage B, bisexual phase to unisexual phase; and stage C, sex organ developmental phase. AF: female floral buds during stage A; F: female floral buds; M: male floral buds; MF: monoecious female floral buds; MM: monoecious male floral buds. Error bars represent standard errors of the three independent biological replicates. Different lowercase letters indicate significant differences at p < 0.05.
Forests 16 00395 g001
Figure 2. Subcellular localizations of PcHsp70-1 and PcHsp90 in root cells of the transgenic Arabidopsis plants. (ad) Localization of eGFP only. (eh) Localization of PcHsp70-1-eGFP. (il) Localization of PcHsp90-eGFP. Fluorescence images were obtained by confocal laser scanning microscope. The nuclei stained by 4′,6′-diamidino-2-phenylindole (DAPI) appear in blue. Scale bar = 10 μm.
Figure 2. Subcellular localizations of PcHsp70-1 and PcHsp90 in root cells of the transgenic Arabidopsis plants. (ad) Localization of eGFP only. (eh) Localization of PcHsp70-1-eGFP. (il) Localization of PcHsp90-eGFP. Fluorescence images were obtained by confocal laser scanning microscope. The nuclei stained by 4′,6′-diamidino-2-phenylindole (DAPI) appear in blue. Scale bar = 10 μm.
Forests 16 00395 g002
Figure 3. Developmental processes and characteristics of transgenic Arabidopsis. (a) The hypocotyl lengths and root lengths of wild-type and PcHsp70-1 and PcHsp90 transgenic plants 4, 7, and 10 d after germination. (b,c) The phenotypic characteristics of OX-PcHsp70-L2 (70-L2), OX-PcHsp70-L19 (70-L19), wild type (WT), hsp70, hsp90, OX-PcHsp90-L5 (90-L5), and OX-PcHsp90-L6 (90-L6) plants in the second week. (d) The typical phenotype of 4-week-old seedlings. (e) The typical phenotype of 7-week-old plants. (f) qRT-PCR analysis of AtHsp70 (At1g16030) expression in wild type and hsp70, and PcHsp70-1 expression in 10 d old seedlings of 70-L2 and 70-L19. (g) qRT-PCR analysis of AtHsp90 (At5g52640) expression in wild type and hsp90, and PcHsp90 expression in 10 d old seedlings of 90-L5 and 90-L6. (h) Days to bolting. (i) The number of rosette leaves at bolting. (j) The number of boltings. (k) The fresh weight per seedling at bolting. All statistical data were acquired from at least 18 plants for each genotype. Error bars indicate SDs. Different lowercase letters indicate significant differences at p < 0.05, and capital letters indicate highly significant differences at p < 0.01.
Figure 3. Developmental processes and characteristics of transgenic Arabidopsis. (a) The hypocotyl lengths and root lengths of wild-type and PcHsp70-1 and PcHsp90 transgenic plants 4, 7, and 10 d after germination. (b,c) The phenotypic characteristics of OX-PcHsp70-L2 (70-L2), OX-PcHsp70-L19 (70-L19), wild type (WT), hsp70, hsp90, OX-PcHsp90-L5 (90-L5), and OX-PcHsp90-L6 (90-L6) plants in the second week. (d) The typical phenotype of 4-week-old seedlings. (e) The typical phenotype of 7-week-old plants. (f) qRT-PCR analysis of AtHsp70 (At1g16030) expression in wild type and hsp70, and PcHsp70-1 expression in 10 d old seedlings of 70-L2 and 70-L19. (g) qRT-PCR analysis of AtHsp90 (At5g52640) expression in wild type and hsp90, and PcHsp90 expression in 10 d old seedlings of 90-L5 and 90-L6. (h) Days to bolting. (i) The number of rosette leaves at bolting. (j) The number of boltings. (k) The fresh weight per seedling at bolting. All statistical data were acquired from at least 18 plants for each genotype. Error bars indicate SDs. Different lowercase letters indicate significant differences at p < 0.05, and capital letters indicate highly significant differences at p < 0.01.
Forests 16 00395 g003
Figure 4. The overexpression of PcHSP70-1 increased the expression levels of flowering-related genes in transgenic Arabidopsis. (a) qRT-PCR analysis of AtHsp70 (At1g16030) expression levels in wild type and hsp70, and PcHsp70-1 expression in 70-L2 and 70-L19. (bh) qRT-PCR analysis of FT, SOC1, SPL3, AP1, FUL, LFY, and AGL24 expression levels in wild-type, hsp70, 70-L2, and 70-L19 plants. Error bars represent standard errors of the three independent biological replicates. Different lowercase letters indicate significant differences at p < 0.05.
Figure 4. The overexpression of PcHSP70-1 increased the expression levels of flowering-related genes in transgenic Arabidopsis. (a) qRT-PCR analysis of AtHsp70 (At1g16030) expression levels in wild type and hsp70, and PcHsp70-1 expression in 70-L2 and 70-L19. (bh) qRT-PCR analysis of FT, SOC1, SPL3, AP1, FUL, LFY, and AGL24 expression levels in wild-type, hsp70, 70-L2, and 70-L19 plants. Error bars represent standard errors of the three independent biological replicates. Different lowercase letters indicate significant differences at p < 0.05.
Forests 16 00395 g004
Figure 5. The overexpression of PcHsp70-1 and PcHsp90 enhanced drought resistance in transgenic Arabidopsis. (a) The 28 d old wild-type and mutant seedlings and 26 d old transgenic seedlings before water limitation, after not being watered for 14 d, and after being re-watered for 3 d. (b) The survival rates of wild type, mutants, and transgenic plants after being re-watered for 3 d. All statistical data were acquired from at least nine plants for each genotype (line). Error bars indicate SDs. Different capital letters indicate highly significant differences at p < 0.01.
Figure 5. The overexpression of PcHsp70-1 and PcHsp90 enhanced drought resistance in transgenic Arabidopsis. (a) The 28 d old wild-type and mutant seedlings and 26 d old transgenic seedlings before water limitation, after not being watered for 14 d, and after being re-watered for 3 d. (b) The survival rates of wild type, mutants, and transgenic plants after being re-watered for 3 d. All statistical data were acquired from at least nine plants for each genotype (line). Error bars indicate SDs. Different capital letters indicate highly significant differences at p < 0.01.
Forests 16 00395 g005
Figure 6. Comparison of physiological indices among Arabidopsis PcHsp70-1 and PcHsp90 transgenic lines, wild type, and mutants under drought stress. (a) The trypan blue staining and 3,3′-Diaminobenzidine (DAB) staining of old rosette leaves of each genotype after not being watered for 10 d. (b) The proline content. (c) The chlorophyll content. (d) The relative water content (RWC). Error bars represent standard errors of the six independent biological replicates. Different lowercase letters indicate significant differences at p < 0.05.
Figure 6. Comparison of physiological indices among Arabidopsis PcHsp70-1 and PcHsp90 transgenic lines, wild type, and mutants under drought stress. (a) The trypan blue staining and 3,3′-Diaminobenzidine (DAB) staining of old rosette leaves of each genotype after not being watered for 10 d. (b) The proline content. (c) The chlorophyll content. (d) The relative water content (RWC). Error bars represent standard errors of the six independent biological replicates. Different lowercase letters indicate significant differences at p < 0.05.
Forests 16 00395 g006
Figure 7. Potential mechanism of PcHSP70-1 expression in sex differentiation of P. chinensis under drought stress. Stage A: asexual phase to bisexual phase; stage B: bisexual phase to unisexual phase; stage C: sex organ developmental phase; green floral organs: tepals; pink floral organs: pistil primordia; blue floral organs: stamen primordia.
Figure 7. Potential mechanism of PcHSP70-1 expression in sex differentiation of P. chinensis under drought stress. Stage A: asexual phase to bisexual phase; stage B: bisexual phase to unisexual phase; stage C: sex organ developmental phase; green floral organs: tepals; pink floral organs: pistil primordia; blue floral organs: stamen primordia.
Forests 16 00395 g007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, Y.; Li, H.; Cao, G.; Dong, J.; Lv, M.; Su, S.; Bai, Q. Heat Shock Proteins of Pistacia chinensis Could Promote Floral Development Under Drought Stress. Forests 2025, 16, 395. https://doi.org/10.3390/f16030395

AMA Style

Zhang Y, Li H, Cao G, Dong J, Lv M, Su S, Bai Q. Heat Shock Proteins of Pistacia chinensis Could Promote Floral Development Under Drought Stress. Forests. 2025; 16(3):395. https://doi.org/10.3390/f16030395

Chicago/Turabian Style

Zhang, Yu, Hao Li, Guanghui Cao, Jingjing Dong, Man Lv, Shuchai Su, and Qian Bai. 2025. "Heat Shock Proteins of Pistacia chinensis Could Promote Floral Development Under Drought Stress" Forests 16, no. 3: 395. https://doi.org/10.3390/f16030395

APA Style

Zhang, Y., Li, H., Cao, G., Dong, J., Lv, M., Su, S., & Bai, Q. (2025). Heat Shock Proteins of Pistacia chinensis Could Promote Floral Development Under Drought Stress. Forests, 16(3), 395. https://doi.org/10.3390/f16030395

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop