Moso Bamboo’s Survival Strategy Against Chilling Stress in Signaling Dynamics
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Chilling Treatment
2.1.1. Cold-Shock Treatment Experiment
2.1.2. Chilling Treatment Experiment
2.2. RNA Extraction, Illumina Library Construction, and Sequencing
2.3. Sequencing Data Analysis
2.4. Real-Time Quantitative Reverse Transcription PCR Analysis of DEGs
2.5. Net Ca2+, Net NH4+, and NO3− Fluxes Measurements
2.6. Confocal Laser Scanning Microscopy for Fluorescence Imaging
2.7. The Detection of Enzymatic Activity and Protein Content
2.8. Statistical and Visualization Analysis
3. Results
3.1. Enrichment Analysis of Differentially Expressed Genes of P. edulis Under Chilling Stress
3.2. Expression Analysis of Calcium Signaling-Related Genes in P. edulis Under Chilling Stress
3.3. The Ca2+ Flux and Distribution Law Under Chilling Stress in the Root Tips of P. edulis
3.4. Changes in NO3− and NH4+ Flux and Nitrogen Transporter Protein Contents
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Intergovernmental Panel on Climate Change (IPCC). Climate Change 2014: Synthesis Report; IPCC: Geneva, Switzerland, 2015. [Google Scholar]
- Su, W.H.; Fan, S.H.; Zhang, W.Y.; Qi, L.H.; Guan, F.Y. Damage of Frost and Snow Disaster to Moso Bamboo Stands and the Influencing Factors in Huangshan, Anhui Province. Sci. Silvae Sin. 2008, 44, 42–49. [Google Scholar]
- Aslam, M.; Fakher, B.; Ashraf, M.A.; Cheng, Y.; Wang, B.R.; Qin, Y. Plant Low-Temperature Stress: Signaling and Response. Agronomy 2022, 12, 702. [Google Scholar] [CrossRef]
- Yang, C.B.; Yang, H.Z.; Xu, Q.J.; Wang, Y.L.; Sang, Z.; Yuan, H.J. Comparative metabolomics analysis of the response to cold stress of resistant and susceptible Tibetan hulless barley (Hordeum distichon). Phytochemistry 2020, 174, 112346. [Google Scholar] [CrossRef] [PubMed]
- Hayat, S.; Hayat, Q.; Alyemeni, M.N.; Wani, A.S.; Pichtel, J.; Ahmad, A. Role of proline under changing environments: A review. Plant Signal. Behav. 2012, 7, 1456–1466. [Google Scholar] [CrossRef]
- Eom, S.H.; Ahn, M.-A.; Kim, E.; Lee, H.J.; Lee, J.H.; Wi, S.H.; Kim, S.K.; Lim, H.B.; Hyun, T.K. Plant Response to Cold Stress: Cold Stress Changes Antioxidant Metabolism in Heading Type Kimchi Cabbage (Brassica rapa L. ssp. Pekinensis). Antioxidants 2022, 11, 700. [Google Scholar] [CrossRef]
- Wang, H.Y.; Guo, L.; Zha, R.Z.; Gao, Z.P.; Yu, F.; Wei, Q. Histological, metabolomic and transcriptomic analyses reveal mechanisms of cold acclimation of the Moso bamboo (Phyllostachys edulis) leaf. Tree Physiol. 2022, 42, 2336–2352. [Google Scholar] [CrossRef]
- Miller, G.; Suzuki, N.; Ciftci-Yilmaz, S.; Mittler, R. Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ. 2010, 33, 453–467. [Google Scholar] [CrossRef]
- Abid, M.; Tian, Z.W.; Ata-Ul-Karim, S.T.; Liu, Y.; Cui, Y.K.; Zahoor, R.; Jiang, D.; Dai, T.B. Improved tolerance to post-anthesis drought stress by pre-drought priming at vegetative stages in drought-tolerant and -sensitive wheat cultivars. Plant Physiol. Biochem. 2016, 106, 218–227. [Google Scholar] [CrossRef] [PubMed]
- Huang, Z.; Zhu, P.L.; Zhong, X.J.; Qiu, J.R.; Xu, W.X.; Song, L. Transcriptome Analysis of Moso Bamboo (Phyllostachys edulis) Reveals Candidate Genes Involved in Response to Dehydration and Cold Stresses. Front. Plant Sci. 2022, 19, 960302. [Google Scholar] [CrossRef]
- Luan, S. The CBL–CIPK network in plant calcium signaling. Trends Plant Sci. 2009, 14, 37–42. [Google Scholar] [CrossRef]
- DeFalco, T.A.; Bender, K.W.; Snedden, W.A. Breaking the code: Ca2+ sensors in plant signalling. Biochem. J. 2009, 425, 27–40. [Google Scholar] [CrossRef] [PubMed]
- Harmon, A.C.; Gribskov, M.; Harper, J.F. CDPKs—A kinase for every Ca2+ signal? Trends Plant Sci. 2000, 5, 154–159. [Google Scholar] [CrossRef] [PubMed]
- Cheng, S.H.; Willmann, M.R.; Chen, H.C.; Sheen, J. Calcium signaling through protein kinases. The Arabidopsis calcium-dependent protein kinase gene family. Plant Physiol. 2002, 129, 469–485. [Google Scholar] [CrossRef]
- Harper, J.F.; Breton, G.; Harmon, A. Decoding Ca2+ signals through plant protein kinases. Annu. Rev. Plant Biol. 2004, 55, 263–288. [Google Scholar] [CrossRef]
- Trewavas, A. How plants learn. Proc. Natl. Acad. Sci. USA 1999, 96, 4216–4218. [Google Scholar] [CrossRef]
- Kudla, J.; Xu, Q.; Harter, K.; Gruissem, W.; Luan, S. Genes for calcineurin B-like proteins in Arabidopsis are differentially regulated by stress signals. Proc. Natl. Acad. Sci. USA 1999, 96, 4718–4723. [Google Scholar] [CrossRef]
- Luan, S.; Kudla, J.; Rodriguez-Concepcion, M.; Yalovsky, S.; Gruissem, W. Calmodulins and calcineurin B-like proteins: Calcium sensors for specific signal response coupling in plants. Plant Cell 2002, 14, S389–S400. [Google Scholar] [CrossRef]
- McCormack, E.; Tsai, Y.C.; Braam, J. Handling calcium signaling: Arabidopsis CaMs and CMLs. Trends Plant Sci. 2005, 10, 383–389. [Google Scholar] [CrossRef]
- Batistič, O.; Kudla, J. Analysis of calcium signaling pathways in plants. Biochim. Biophys. Acta 2012, 1820, 1283–1293. [Google Scholar] [CrossRef]
- Ma, Y.; Dai, X.Y.; Xu, Y.Y.; Luo, W.; Zheng, X.M.; Zeng, D.; Pan, Y.J.; Lin, X.L.; Liu, H.H.; Zhang, D.J.; et al. COLD1 confers chilling tolerance in rice. Cell 2015, 160, 1209–1221. [Google Scholar] [CrossRef]
- Zhou, A.; Liu, E.H.; Li, H.; Li, Y.; Feng, S.; Gong, S.F.; Wang, J.G. PsCor413pm2, a Plasma Membrane-Localized, Cold-Regulated Protein from Phlox subulata, Confers Low Temperature Tolerance in Arabidopsis. Int. J. Mol. Sci. 2018, 19, 2579. [Google Scholar] [CrossRef]
- Shi, Y.L.; Yue, X.L.; An, L.Z. Integrated regulation triggered by a cryophyte ω-3 desaturase gene confers multiple-stress tolerance in tobacco. J. Exp. Bot. 2018, 69, 2131–2148. [Google Scholar] [CrossRef]
- Zhang, D.J.; Guo, X.Y.; Xu, Y.Y.; Li, H.; Ma, L.; Yao, X.F.; Weng, Y.X.; Guo, Y.; Liu, C.M.; Chong, K. OsCIPK7 point-mutation leads to conformation and kinase-activity change for sensing cold response. J. Integr. Plant Biol. 2019, 61, 1194–1200. [Google Scholar] [CrossRef] [PubMed]
- Tang, R.J.; Wang, C.; Li, K.L.; Luan, S. The CBL-CIPK Calcium Signaling Network: Unified Paradigm from 20 Years of Discoveries. Trends Plant Sci. 2020, 25, 604–617. [Google Scholar] [CrossRef] [PubMed]
- Iqbal, Z.; Memon, A.G.; Ahmad, A.; Iqbal, M.S. Calcium Mediated Cold Acclimation in Plants: Underlying Signaling and Molecular Mechanisms. Front. Plant Sci. 2022, 13, 855559. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.W.; Zhou, M.B. Genome-wide identification of the ICE gene family in moso bamboo and its expression pattern under low temperature stress. J. Zhejiang A&F Univ. 2024, 41, 568–576. [Google Scholar] [CrossRef]
- Zhong, S.L.; Joung, J.G.; Zheng, Y.; Chen, Y.R.; Liu, B.; Shao, Y.; Xiang, J.Z.; Fei, Z.J.; Giovannoni, J.J. High-throughput illumina strand-specific RNA sequencing library preparation. Cold Spring Harb. Protoc. 2011, 2011, 940–949. [Google Scholar] [CrossRef] [PubMed]
- Podnar, J.; Deiderick, H.; Huerta, G.; Hunicke-Smith, S. Next-Generation Sequencing RNA-Seq Library Construction. Curr. Protoc. Mol. Biol. 2014, 106, 4.21.1–4.21.19. [Google Scholar] [CrossRef]
- Xu, Y.; Sun, T.; Yin, L.P. Application of Non-invasive Microsensing System to Simultaneously Measure Both H+, and O2 Fluxes Around the Pollen Tube. J. Integr. Plant Biol. 2006, 48, 823–831. [Google Scholar] [CrossRef]
- Lee, E.S.; Park, J.H.; Wi, S.D.; Kang, C.H.H.; Chi, Y.H.; Chae, H.B.; Paeng, S.K.; Ji, M.G.; Kim, W.Y.; Kim, M.G.; et al. Redox-dependent structural switch and CBF activation confer freezing tolerance in plants. Nat. Plants 2021, 7, 914–922. [Google Scholar] [CrossRef]
- Ludwig, A.A.; Saitoh, H.; Felix, G.; Freymark, G.; Miersch, O.; Wasternack, C.; Boller, T.; Jones, J.D.G.; Romeis, T. Ethylene-mediated cross-talk between calcium-dependent protein kinase and MAPK signaling controls stress responses in plants. Proc. Natl. Acad. Sci. USA 2005, 102, 10736–10741. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.K. Abiotic Stress Signaling and Responses in Plants. Cell 2016, 167, 313–324. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.Y.; Li, Y.; Cao, K.; Xu, H.W.; Zhou, X.F. Transcriptome and proteome depth analysis indicate ABA, MAPK cascade and Ca2+ signaling co-regulate cold tolerance in Rhododendron chrysanthum Pall. Front. Plant Sci. 2023, 14, 1146663. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Liu, W.X.; Liu, Z.P.; Xie, W.G.; Wang, Y.R. Responses of fatty acid and its derivatives to stress in plants. Pratacult. Sci. 2014, 8, 1556–1565. [Google Scholar] [CrossRef]
- Lian, H.D.; Qin, C.; Zhao, Q.S.; Begum, N.; Zhang, S.Q. Exogenous calcium promotes growth of adzuki bean (Vigna angularis Willd.) seedlings under nitrogen limitation through the regulation of nitrogen metabolism. Plant Physiol. Biochem. 2022, 190, 90–100. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.S.; Wang, S.T.; Mei, Q.; Sun, T.; Hu, J.T.; Xiao, G.S.; Chen, H.; Xuan, Y.H. The role of CBL-CIPK signaling in plant responses to biotic and abiotic stresses. Plant Mol. Biol. 2024, 114, 53. [Google Scholar] [CrossRef]
- Ding, Y.D.; Yang, H.; Wu, S.F.; Fu, D.Y.; Li, M.Z.; Gong, Z.Z.; Yang, S.H. CPK28-NLP7 module integrates cold-induced Ca2+ signal and transcriptional reprogramming in Arabidopsis. Sci. Adv. 2022, 8, eabn7901. [Google Scholar] [CrossRef]
- Klimecka, M.; Muszyńska, G. Structure and functions of plant calcium-dependent protein kinases. Acta Biochim. Pol. 2007, 54, 219–233. [Google Scholar] [CrossRef]
- Dolmetsch, R.E.; Xu, K.; Lewis, R.S. Calcium oscillations increase the efficiency and specificity of gene expression. Nature 1998, 392, 933–936. [Google Scholar] [CrossRef]
- Liu, Y.M.; Bai, L.Q.; Sun, M.T.; Wang, J.; Li, S.Z.; Miao, L.; Yan, Y.; He, C.X.; Yu, X.C.; Li, Y.S. Adaptation of cucumber seedlings to low temperature stress by reducing nitrate to ammonium during it’s transportation. BMC Plant Biol. 2021, 21, 189. [Google Scholar] [CrossRef]
- Ju, C.F.; Zhang, Z.Q.; Deng, J.P.; Miao, C.C.; Wang, Z.Q.; Wallrad, L.; Javed, L.; Fu, D.; Zhang, T.; Kudla, J.; et al. Ca2+-dependent successive phosphorylation of vacuolar transporter MTP8 by CBL2/3-CIPK3/9/26 and CPK5 is critical for manganese homeostasis in Arabidopsis. Mol. Plant 2022, 15, 419–437. [Google Scholar] [CrossRef] [PubMed]
- Liu, K.H.; Liu, M.H.; Lin, Z.W.; Wang, Z.F.; Chen, B.Q.; Liu, C.; Guo, A.; Konishi, M.; Yanagisawa, S.; Wagner, G.; et al. NIN-like protein 7 transcription factor is a plant nitrate sensor. Science 2022, 377, 1419–1425. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.Y.; Shi, Y.T.; Yang, S.H. CBF: A key factor balancing plant cold stress responses and growth. Chin. Bull. Bot. 2017, 52, 689–698. [Google Scholar] [CrossRef]
- Hwarari, D.; Guan, Y.L.; Ahmad, B.; Movahedi, A.; Min, T.; Hao, Z.D.; Lu, Y.; Chen, J.H.; Yang, L. ICE-CBF-COR Signaling Cascade and Its Regulation in Plants Responding to Cold Stress. Int. J. Mol. Sci. 2022, 23, 1549. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.T.; Ding, Y.L.; Yang, S.H. Molecular Regulation of CBF Signaling in Cold Acclimation. Trends Plant Sci. 2018, 23, 623–637. [Google Scholar] [CrossRef]
- Peng, Y.; Ming, Y.H.; Jiang, B.C.; Zhang, X.Y.; Fu, D.Y.; Lin, Q.H.; Zhang, X.Y.; Wang, Y.; Shi, Y.T.; Gong, Z.Z.; et al. Differential phosphorylation of Ca2+-permeable channel CNGC20 modulates calcium-mediated freezing tolerance in Arabidopsis. Plant Cell 2024, 36, 4356–4371. [Google Scholar] [CrossRef]
- Lin, R.; Song, J.N.; Tang, M.J.; Wang, L.Y.; Yu, J.Q.; Zhou, Y.H. CALMODULIN6 negatively regulates cold tolerance by attenuating ICE1-dependent stress responses in tomato. Plant Physiol. 2023, 193, 2105–2121. [Google Scholar] [CrossRef]
- Zhu, J.H.; Dong, C.H.; Zhu, J.K. Interplay between cold-responsive gene regulation, metabolism and RNA processing during plant cold acclimation. Curr. Opin. Plant Biol. 2007, 10, 290–295. [Google Scholar] [CrossRef]
- Winfield, M.O.; Lu, C.G.; Wilson, I.D.; Coghill, J.A.; Edwards, K.J. Plant responses to cold: Transcriptome analysis of wheat. Plant Biotechnol. J. 2010, 8, 749–771. [Google Scholar] [CrossRef]












| Gene ID | Forward Primer | Reverse Primer |
|---|---|---|
| PH02Gene03957 | GCTGGGCTGGTATTGCTAAC | GCAAAGGCGAAGAAGACGAT |
| PH02Gene42787 | GTCATTCCAAGCAGTGCACA | AATGGAGTGTCACCGAACCT |
| PH02Gene19300 | GTTCCGGGTTTTCGACGAG | ATCATGCACTTGAACTCGCC |
| PH02Gene17971 | CCACTAACACAGCTTCGACG | GCTGGCCTCATTTCTTGGTT |
| PH02Gene35076 | ATTGACGAAGCAGGACAGGA | GAGCTTGCTATGTCCCCTCT |
| PH02Gene13036 | TTCAAGGAACCGAATCGTGC | CCAATCGAAGTTGCAGCCTT |
| PH02Gene03104 | TGCCTCGACGTCATCTTCTT | TTGGGCAGGATCATCATGGT |
| PH02Gene04394 | GCAATGGTAGAGAAGCCGTG | GATCCATGGTGAAGCTGCAG |
| PH02Gene14168 | TCGTGTCTGGCTTGGTACTT | TTGTTGACTGCTGGCTTGAC |
| Ion Species for Flux Testing | Test Position Site (μm) | Measuring Solutions | ||
|---|---|---|---|---|
| Root | Concentration | Consisting | pH | |
| Ca2+ | 500 μM from the root apex | 0.2 mM 0.1 mM | 2-(N-morpholino) ethanesulfonic acid (MES) CaCl2 | 6.0 |
| NH4+ | 1500 μM from the root apex | 0.1 mM 0.1 mM | NH4NO3 CaCl2 | 6.0 |
| NO3− | 1500 μM from the root apex | 0.1 mM 0.1 mM | NH4NO3 CaCl2 | 6.0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jing, X.; Cai, C.; Geng, P.; Wang, Y. Moso Bamboo’s Survival Strategy Against Chilling Stress in Signaling Dynamics. Forests 2024, 15, 2132. https://doi.org/10.3390/f15122132
Jing X, Cai C, Geng P, Wang Y. Moso Bamboo’s Survival Strategy Against Chilling Stress in Signaling Dynamics. Forests. 2024; 15(12):2132. https://doi.org/10.3390/f15122132
Chicago/Turabian StyleJing, Xiong, Chunju Cai, Pengfei Geng, and Yi Wang. 2024. "Moso Bamboo’s Survival Strategy Against Chilling Stress in Signaling Dynamics" Forests 15, no. 12: 2132. https://doi.org/10.3390/f15122132
APA StyleJing, X., Cai, C., Geng, P., & Wang, Y. (2024). Moso Bamboo’s Survival Strategy Against Chilling Stress in Signaling Dynamics. Forests, 15(12), 2132. https://doi.org/10.3390/f15122132

