Next Article in Journal
Investigation of Recognition and Classification of Forest Fires Based on Fusion Color and Textural Features of Images
Previous Article in Journal
Fire Path Fighting in Forest Off-Road Using Improved ACA—An Example of The Northern Primitive Forest Region of The Great Xing’an Range in Inner Mongolia, China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Chloroplast Microsatellite-Based High-Resolution Melting Analysis for Authentication and Discrimination of Ilex Species

Jeonnam Institute of Natural Resources Research, Jangheung-gun 59338, Jeollanam-do, Korea
*
Author to whom correspondence should be addressed.
Forests 2022, 13(10), 1718; https://doi.org/10.3390/f13101718
Submission received: 28 September 2022 / Revised: 13 October 2022 / Accepted: 14 October 2022 / Published: 18 October 2022
(This article belongs to the Section Genetics and Molecular Biology)

Abstract

Ilex species are important sources of high-quality raw plant materials for the production of drugs and functional foods. The precise identification of different species within the Ilex genus would greatly facilitate authentication and certification as well as forest resource monitoring in plantations. Combining DNA barcoding with high-resolution melting (HRM) analysis represents a robust strategy for species discrimination, as demonstrated in recent DNA barcoding studies. Here, using concatenated and aligned complete chloroplast genomes of different Ilex species, we conducted a sliding window analysis to identify regions of high nucleotide diversity (Pi). We optimized and validated the utility of PCR-based HRM coupled with microsatellite markers to discriminate among the four Ilex species, Ilex integra Thunb., Ilex rotunda Thunb., Ilex cornuta Lindl. and Paxton, and Ilex x wandoensis C.F. Mill and M. Kim, from wild populations in southwestern Korea. The marker trnSUGA-psbZ produced clear melting patterns and distinct melting curve profiles for the four Ilex species using HRM analysis. We applied this protocol to commercially available Ilex accessions and consistently identified the correct species for all 15 accessions tested. Therefore, combining DNA barcoding with HRM analysis is a powerful method for identifying different species within the same genus, which could be used for quality control of raw materials in the functional food/medicinal plant industry.

1. Introduction

Ilex species, a monotypic genus in the family Aquifoliaceae, are dioecious trees or shrubs with either evergreen or deciduous habits that are found in tropical and subtropical regions such as South America and Southeast Asia. There are more than 600 Ilex species, including I. paraguariensis A. St.-Hil., I. cornuta, and I. rotunda, which are valuable materials for the health food, cosmetics, and pharmaceutical industries [1,2,3,4]. Yerba mate, an infusion prepared from the leaves of I. paraguariensis, is widely consumed worldwide. Mate is produced in tropical countries such as Paraguay, Argentina, and Brazil, and has long been used as South American folk medicine. Many studies have confirmed the therapeutic efficacy of a mate by evaluating its bioactivity in vitro and in vivo. As a result, mate has emerged as a major source of valuable bioactive components that are effective in preventing arthritis, inflammatory diseases, cardiovascular diseases, diabetes, and obesity [5,6,7,8,9]. Therefore, I. paraguariensis has been recognized as a popular product by the health and wellness industries worldwide. These findings have prompted research on other species of the genus Ilex. Recent studies have demonstrated the antioxidant and cardioprotective effects of triterpenoid saponins from I. kaushue S.Y. Hu and I. cornuta [3,10]. I. rotunda extracts showed enhanced anti-inflammation activity in vitro and prevented obesity in vivo [11,12].
In Korea, in an effort to respond to changes in woody vegetation due to climate change, many ecologists and botanists are focusing on the conservation and development of warm temperate evergreen broad-leaved trees such as Ilex (Aquifoliaceae), Quercus (Fagaceae), Castanopsis (Fagaceae), Camellia (Theaceae), Cinnamomum (Lauraceae), and Machilus (Lauraceae) [13,14]. Approximately six species of the genus Ilex are native to Korea, including I. integra, I. rotunda, and I. cornuta, I. crenata Thunb, I. crenata var. microphylla Maxim. ex Matsum. I. latifolia Thunb., I. x wandoensis, and I. macropoda Miq. Four of these species (I. integra, I. rotunda, I. cornuta, and I. x wandoensis) are found on islands and in coastal areas in the south. I. x wandoensis, which was discovered on Wando Island in Korea, originated from the natural hybridization of the parent species I. cornuta and I. integra [15]. This hybrid species shares several characteristics with its two parents, including evergreen leaves, dioecy, and red drupes [16]. The leaf shape of I. x wandoensis is intermediate between that of I. cornuta (with sharp thorns on the leaf margins) and I. integra (with an ovate or elliptical ovate shape). It is difficult to discriminate I. x wandoensis from I cornuta based on their morphological characteristics alone. Moreover, I. cornuta and I. x wandoensis both have very sharp and spiny leaf margins, whereas I. integra and I. rotunda have entire leaf margins (Figure 1).
Plant DNA barcoding using markers based on ribosomal internal transcribed spacer (ITS) and chloroplast universal regions, including matK, rbcL, and trnH-psbA, is a common method for species identification and classification. However, it is difficult to accurately distinguish different species from a single plant genus using a few core DNA barcode regions; discriminating between closely related species or sub-species is particularly challenging [17,18]. Therefore, a complementary method is needed using a specialized DNA barcode region to distinguish closely related species or similar species from the same genus. Complete chloroplast genome sequences can now be easily and accurately assembled at a relatively low cost due to rapid advances in the development of sequencing platforms. In addition, more than 5000 complete chloroplast genome sequences deposited in the National Center for Biotechnology Information (NCBI) organelle genome database can be used to develop microsatellite markers by comparative sequence analysis. Many studies have demonstrated the accurate discrimination of closely related species within the same genus using species-specific barcodes derived from a comparative analysis of complete chloroplast genomes [19,20,21]. The use of these super DNA barcodes based on whole chloroplast genome sequences offers a solution to the limitations of using previously established core DNA barcodes based on short gene or intergenic spacer (IGS) regions (<1 kb) to clearly discriminate among closely related species within the same genus.
High-resolution melting (HRM) analysis is a method used to visualize significantly different melting temperatures (Tm) and peak locations between genotypes or alleles based on quantitative PCR [21]. DNA barcoding coupled with HRM (Bar-HRM) analysis was recently shown to be an efficient molecular tool for the correct species identification and authentication of herbal medicinal plants and for the accurate quantification of adulterants in commercial natural food products [21,22,23].
In the current study, we searched for differences in the complete chloroplast genome sequences of various Ilex species in order to identify a new DNA barcode for Ilex species. Our goal was to develop a chloroplast genome-based Bar-HRM marker for the rapid and accurate authentication of four Ilex species with similar morphological features.

2. Materials and Methods

2.1. Plant Materials and DNA Extraction

The plant materials used in this study were leaf tissue from five accessions of I. integra, I. rotunda, and I. cornuta, which were obtained from the National Institute of Biological Resources (NIBR), Republic of Korea, and leaf tissue from 15 accessions collected from Wando Arboretum (Wando Island, Republic of Korea) (Table 1). To extract total genomic DNA, fresh leaf samples from all accessions (80 mg wet weight) were placed in microfuge tubes filled with stainless steel beads (2.8 mm in diameter) from a DNeasy Plant Pro Kit (Qiagen, Valencia, CA, USA). The leaves were ground to powder in a Precellys® Evolution homogenizer (Bertin Technologies, Montigny-le-Bretonneux, France). DNA extraction was performed using a DNeasy Plant Pro Kit according to the manufacturer’s instructions. DNA concentration and quality were measured using a NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and DNA integrity was evaluated by agarose gel electrophoresis on a 1.5% (w/v) agarose gel. An aliquot of DNA was diluted in nuclease-free water to a final working stock of 10 ng/µL.

2.2. Comparison of Chloroplast Genomes and Identification of Microsatellite Loci

All six available complete chloroplast genome sequences of the four Ilex species were downloaded from the NCBI GenBank database (I. integra, NC_044417 and MK335537; I rotunda, MT764244; I. cornuta, NC_044016 and MK335536; and I. x wandoensis, OK328174). The chloroplast genome sequences were aligned using the ClustalW algorithm from MEGA 7.0 [24]. The mVISTA program (http://genome.lbl.gov/vista/mvista/submit.shtml, accessed on 25 August 2021) was used in Shuffle-LAGAN mode to compare the six Ilex chloroplast genomes, using the I. integra (NC_044417) chloroplast genome as a reference. CPGAVA2 was used to annotate the chloroplast genomes and to predict junctions among these four Ilex species, which were visualized using IRscope (http://irscope.shinapps.io./irapp/, accessed on 21 March 2022) based on the annotations of their chloroplast genomes in GenBank. The six Ilex chloroplast genomes were aligned with MAFFT version 7.480 [25] and scanned for regions of high nucleotide diversity (π) by sliding window analysis implemented in DNaSP version 6.0 [26] with a window and step size of 600 bp. Only regions with a nucleotide diversity (π) value of >0.08 were considered to be hotspot regions. Each hotspot region was visually identified as a single nucleotide polymorphism (SNP), simple sequence repeat (SSR), or insertion/deletion (InDel) using microsatellite markers to discriminate among the four species. The NCBI BLAST analysis tool was employed to identify and confirm phylogenetically species-specific regions for each candidate marker. The goal was to discover species-specific sequences of the four Ilex species. The locus sequences of the four Ilex chloroplast genomes were collected by multiple sequence alignment, and each locus sequence isolated from the I. integra chloroplast genome was further evaluated via an NCBI BLASTn search to confirm the similarities and differences among sequences of I. integra, I. rotunda, I cornuta, and I. x wandoensis.

2.3. Quantitative PCR and HRM Analysis of Candidate DNA Barcodes

To validate polymorphisms derived from the complete cp genomes of the four Ilex species, species-specific primers were designed using Primer Tool software from Integrated DNA Technologies (IDT, Coralville, IA, USA) based on the hotspot regions identified above, except for multi-copy genes identified in these Ilex chloroplast genomes. This software uses standard design parameters for HRM, such as primer length (23–25 nucleotides), melting temperature (58–60 °C), GC content (40%–50%), and amplicon size (<200 bp) to design optimal primer pairs. To ensure the specificity of our primers, a Primer-BLAST analysis was conducted on the NCBI site to compare each primer against the genome sequences of the Ilex genus. All oligonucleotides used for quantitative PCR were synthesized at Cosmo Genetech (Seoul, Korea). A BioRad CFX96 instrument (Bio-Rad Laboratories, Hercules, CA, USA) was used for quantitative PCR and the HRM assay. Each 20-μL reaction contained 1 μL of genomic DNA (10 ng), 5 pM of primers, and 10 μL of reaction buffer, which included IQ SyberGreen Supermix (Bio-Rad). The PCR conditions were as follows: initial denaturation at 95 °C for 2 min; 40 cycles of denaturation (95 °C for 10 s), annealing (60 °C for 30 s), and extension (72 °C for 30 s), with the fluorescence signal collected at the end of the annealing and extension steps. Data were processed using Bio-Rad CFX Manager 3.1 software (Bio-Rad Laboratories, Hercules, CA, USA). PCR amplicons were denatured for HRM at 95 °C for 30 s and then annealed at 60 °C for 1 min to form random DNA duplexes. These steps were followed by a melting curve from 65 °C to 95 °C with an increase of 0.2 °C every 10 s. Fluorescence data were obtained at the end of each melting phase and processed using Precision Melt Analysis Software 1.2 (Bio-Rad Laboratories, Hercules, CA, USA), producing melting curves as a function of temperature and difference curves for easy visual identification of clusters.

3. Results

3.1. Comparative Analysis of the Chloroplast Genome of Four Ilex Species

We compared the features of the complete chloroplast genomes of I. integra (NC_044417 and MK335537), I. rotunda (MT764244), I. cornuta (NC_044416 and MK335536), and I. x wandoensis (OK328174), which are readily available in NCBI GenBank. The lengths of these cp genomes ranged from 157,216 bp (I. x wandoensis) to 157, 780 bp (I. rotunda). The lengths of the large single-copy (LSC) region ranged from 86,607 bp (I. x wandoensis) to 87,094 bp (I. rotunda), while the small single-copy (SSC) regions ranged from 18,426 bp (I. integra) to 18,436 bp (I. rotunda). The pairs of inverted repeat (IR) regions ranged from 52,182 bp (I. cornuta and I. x wandoensis) to 52,250 bp (I. rotunda). All six chloroplast genomes of the four Ilex species contained a total of 131 genes, consisting of 86 protein-coding genes, 37 transfer RNA (tRNA) genes, and eight ribosomal RNA (rRNA) genes. The overall GC content in each cp genome varied little, from 37.6 (I. integra and I. rotunda) to 37.7% (I. cornuta and I. x wandoensis) (Table 2). The chloroplast genomes of the four Ilex species had the same gene order and gene arrangement.
We compared the border structures of the four chloroplast genomes in detail (Figure 2). IR regions contained rpl22, and the SSC/IRa and IRb/SSC borders contained parts of the ycf1 and ndhF genes, respectively. The I. rotunda chloroplast genome harbored two copies of the ycf1 gene, including one in the IRb/SSC border. The ndhF gene was located in the IRb/SSC boundary region at a distance of 15 to 2244 bp from the borders.

3.2. Divergence Hotspots in the Four Ilex Cp Genomes

We compared the sequence divergence among the four Ilex chloroplast genomes using mVISTA, using the I. integra annotation as the reference (Figure 3). The IR (A/B) regions were less divergent than the LSC and SSC regions. In addition, the non-coding regions were more variable than the coding regions, and the most highly divergent regions among the four chloroplast genomes occurred in the intergenic spacers (IGS). To determine the level of sequence divergence, we calculated the nucleotide variability (π) values for regions spanning 300 bp on either side of a coding region in the four Ilex chloroplast genomes with DnaSP 6.0 software. The π values of the four Ilex chloroplast genomes ranged from 0.00000 to 0.01667, with an average π value of 0.00314. Based on a cutoff value for π > 0.005, we identified 33 highly variable regions out of the 626 windows analyzed (Figure 4 and Table S1). Twenty-eight of these regions (trnHGUG-psbA, trnKUUU-matK, matK-rps16, rps16-trnQUUG, trnGUCC, trnGGCC-trnRUCU, atpA-atpF, atpH-atpI, rpoC2, rpoB, rpoB-trnCGCA, petN-psbM, trnTGGU-psbD, trnSUGA-psbZ, trnGGCC-trnfMCAU, psaA-ycf3, ycf3-trnSGGA, trnTUGU, trnLUAA, ndhC-trnVUAC, atpB-rbcL, psbE-petL, clpP, psbB-psbN, psbT-psbH, petB-petD, rpl36-rps8, and rpl16-rpl22) were located in LSC regions, whereas five (ndhF-rpl32, trnLUAG-ccsA, ndhE, ndhA, and ycf1) were located in SSC regions (Table S1). The Pi values of the 33 hypervariable loci ranged from 0.008 to 0.016.
Because DNA molecular markers can be used in HRM analysis, and regions with high Pi values do not necessarily have high discrimination rates for the four Ilex species, we tested sequence identity rates using the BLAST search tool of the NCBI database to select species-specific regions for the four Ilex species from the 33 highly variable regions with high Pi values. Accordingly, we used the ~600 bp nucleotide sequences of I. integra derived from each of the 33 hypervariable regions as a reference sequence to search the database Nucleotide Collection for Ilex Species using MegabLASt in NCBI. As shown in Table S1, when I. integra was used as the reference sequence, each locus had a query coverage of 100% and 100% sequence identity. Only one region, trnSUGA-psbZ, showed a clearly different percentage among the four Ilex species, with sequence identities of 98.35%, 98.36%, and 98.52% for I. rotunda, I. cornuta, and I. x wandoensis, respectively. Among the 32 other regions, the sequence identities between I. cornuta and I. x wandoensis were 100% in 20 regions (trnHGUG-psbA, trnGGCC-trnRUCU, atpA-atpF, atpH-atpI, rpoC2, rpoB, rpoB-trnCGCA, petN-psbM, trnTGGU-psbD, trnGGCC-trnfMCAU, trnTUGU, trnLUAA, ndhC-trnVUAC, psbB-psbN, psbT-psbH, rpl36-rps8, rpl16-rpl22, ndhF-rpl32, ndhE, and ndhA), and the sequence identities between I. integra and I. x wandoensis were 100% in seven regions (trnKUUU-matK, matK-rps16, trnGUCC, ycf3-trnSGGA, atpB-rbcL, clpP, and trnLUAG-ccsA). The sequence identities for three Ilex species (I. integra, I. cornuta, and I. x wandoensis) were also 100% in four regions (rps16-trnQUUG, psaA-ycf3, psbE-petL, and ycf1), while the sequence identities were 100% between I. integra and I. cornuta in petB-petD.

3.3. Microsatellite Genotyping of the Four Ilex Species Using HRM Analysis

In this study, we identified 33 variable regions by sliding window analysis of the complete chloroplast genomes of four Ilex species (Table S1). Regions with the highest levels of divergence (π > 0.005) commonly contained complex microsatellite loci, including SSRs, SNPs, and InDels. Among these, we chose a specific divergent region, the IGS region between trnSUGA and psbZ, which was a species-specific polymorphic site among Ilex species, to develop high-resolution molecular markers for the identification of these four species. The markers derived from trnSUGA-psbZ loci were composed of mono-nucleotide repeat motifs such as A and C, as well as point mutations comprising T/A at position 83, A/T/G/C between positions 88 and 100, an inserted T and G at position 107, and A/C between positions 111 and 115 (Figure 4). We designed specific primers against the conserved regions and used them for HRM analysis (Table 3). The HRM curves for the target region trnSUGA-psbZ reveal that I. integra could be visually separated from I. rotunda, I. cornuta, and I. x wandoensis, as these regions were highly characteristic for each species (yellow, red, green, and blue curves, respectively, in Figure 5). Sanger sequencing confirmed the identities of the 173-bp amplicon for I. integra, the 169-bp amplicon for I. rotunda, the 179-bp amplicon for I. cornuta, and the 178-bp amplicon for I. x wandoensis, whose size differences resulted from InDels of (A)n between nucleotides 88 and 104 and (C)n between nucleotides 111 and 122 (Figure 5). The Tm values of the four Ilex species and the melting profiles of the amplicons from the trnSUGA-psbZ region are shown in Figure 6. In the HRM analysis, the trnSUGA-psbZ loci produced unique melting curves, and the accessions were stratified into four species.

4. Conclusions

The unequivocal identification and discrimination of similar species within the same genus in land plants, particularly species that serve as potential sources of secondary metabolites for the food and medicinal industries, has generally been a challenge for researchers and for collectors in the field. I. integra, which has similar biological activities as I. paraguariensis (Yerba mate), is a native species to Korea that has been attracting increasing attention for its potential use in the functional food and pharmaceutical industries [1,27,28]. Therefore, in the current study, we devised a method to rapidly and effectively distinguish I. integra from three native Ilex species, I. rotunda, I. cornuta, and I. x wandoensis, to facilitate the standardization and quality control of raw materials from this natural resource. DNA barcoding based on core DNA barcode regions can be used to confirm the identities of natural raw materials and to develop standard-quality herbal medicinal products for the healthcare marketplace. However, this method rarely provides accurate species identification since discriminating between closely related species within the same genus is difficult and often impossible. Moreover, the diagnostic features examined may not be sufficiently unique for a given species [17,29]. Super barcodes, which can distinguish closely related taxa through comparative analysis of the whole genome sequences of small organelles such as chloroplasts and mitochondria, have been proposed as an alternative to universal DNA barcodes. However, it is difficult to establish super barcodes due to the costly, time-consuming research needed for their identification [17]. Such studies require customized protocols that use optimized tools to discriminate between species within each genus.
Many researchers have recently identified hypervariable regions between species by sliding window analysis of the entire chloroplast genomes of different species at the genus level [30,31,32]. These regions can be thought of as ‘accurate DNA barcodes’ or ‘customized DNA barcodes’ between species within each genus, a concept opposite from that of general universal plant DNA barcodes. Here, we retrieved the complete chloroplast genome sequences of four Ilex species from the NCBI database, aligned and compared them to identify hypervariable regions with species-specific genetic diversity. We identified 33 hypervariable regions in the four Ilex species, with an average nucleotide diversity value (π) of 0.011333 (>0.005) by sliding window analysis (600 sites). Although the average π value for the 33 regions was higher, these regions did not show high species-specific divergence for the four individual Ilex species. Therefore, as a more efficient approach to species-specific marker selection, we visually selected specific sites for each of the four Ilex species from the 33 hypervariable regions using the NCBI BLAST search algorithm. Only one region, the trnSUGA-psbZ IGS region, contained specific SSR markers that discriminated between each of the four Ilex species. We confirmed that this region can specifically distinguish not only the four Ilex species but also other species within the same genus.
HRM analysis using the microsatellite marker derived from the trnSUGA-psbZ IGS SSR region successfully distinguished the four different Ilex species. This method is simple enough for use in identifying raw materials of I. integra by the medicinal herb industry. This technique was sensitive enough to identify amplicons based on changes in 2 mono-nucleotide and point mutations (trnSUGA-psbZ IGS), highlighting its potential for performing accurate large-scale screening. To enhance the development and commercialization of functional plant materials, there is a demand for an accurate method that can rapidly and easily discriminate among different species within the same genus. Such a method must be certified and standardized for the authentication of raw plant materials from cultivated or wild-harvested materials at the source or prior to manufacturing. Although universal core DNA barcodes are limited in their ability to discriminate among species, coupling DNA barcodes with HRM analysis has emerged as an excellent alternative technological platform for the precise identification of medicinal plant materials. Therefore, we suggest that the improved species-specific method designed in this study involving the combination of HRM analysis and the use of a chloroplast genome-based “customized DNA barcode” could be optimized for different species within the same genus.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/f13101718/s1, Table S1: 33 regions of the four Ilex cp genome sequence alignment (window of 600 sites) with significantly high (π > 0.006) nucleotide diversity and different sequence identities (%) based on the nucleotide sequence of I. integra.

Author Contributions

Study conception and design, D.B. and Y.K.; material preparation and experiments, D.-R.O. and Y.-J.K.; data analysis, Y.K. and K.-N.O.; writing—original draft preparation, review, and editing, Y.K.; project administration and funding acquisition, D.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Trade, Industry and Energy (MOTIE, Korea) [No. P0017660].

Institutional Review Board Statement

This study was approved by the institutional review board of the author’s affiliated research institute (protocol code 001-01 March 2021).

Informed Consent Statement

Not applicable.

Data Availability Statement

The geographical locations of the collected Ilex samples in South Korea and the Ilex genome sequences with GenBank accession numbers are included in the manuscript.

Acknowledgments

This paper is dedicated to the memories of Heungsu Kim and Jaeman Kim for inspiring us, mentoring our research, and teaching us to be scientifically curious, inquisitive inventors as well as scientists with a passion for plant biology.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gan, R.-Y.; Zhang, D.; Wang, M.; Corke, H. Health Benefits of Bioactive Compounds from the Genus Ilex, a Source of Traditional Caffeinated Beverages. Nutrients 2018, 10, 1682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Souza, A.H.; Corrêa, R.C.; Barros, L.; Calhelha, R.C.; Santos-Buelga, C.; Peralta, R.M.; Bracht, A.; Matsushita, M.; Ferreira, I.C. Phytochemicals and bioactive properties of Ilex paraguariensis: An in-vitro comparative study between the whole plant, leaves and stems. Food Res. Int. 2015, 78, 286–294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Singh, D.; Chaudhuri, P.K. Structural characteristics, bioavailability and cardioprotective potential of saponins. Integr. Med. Res. 2018, 7, 33–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Hill, R.A.; Connolly, J.D. Triterpenoids. Nat. Prod. Rep. 2020, 37, 962–998. [Google Scholar] [CrossRef] [Scilit]
  5. Correa, V.G.; de Sá-Nakanishi, A.B.; Gonçalves, G.d.A.; Barros, L.; Ferreira, I.C.F.R.; Bracht, A.; Peralta, R.M. Yerba mate aqueous extract improves the oxidative and inflammatory states of rats with adjuvant-induced arthritis. Food Funct. 2019, 10, 5682–5696. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Panza, V.P.; Brunetta, H.S.; de Oliveira, M.V.; Nunes, E.A.; da Silva, E.L. Effect of mate tea (Ilex paraguariensis) on the expression of the leukocyte NADPH oxidase subunit p47phox and on circulating inflammatory cytokines in healthy men: A pilot study. Int. J. Food Sci. Nutr. 2019, 70, 212–221. [Google Scholar] [CrossRef] [Scilit]
  7. Cahuê, F.; Nascimento, J.H.M.; Barcellos, L.; Salerno, V.P. Ilex paraguariensis, exercise and cardioprotection: A retrospective analysis. J. Funct. Foods 2019, 53, 105–108. [Google Scholar] [CrossRef] [Scilit]
  8. Rocha, D.S.; Casagrande, L.; Model, J.F.A.; Dos Santos, J.T.; Hoefel, A.L.; Kucharski, L.C. Effect of yerba mate (Ilex paraguariensis) extract on the metabolism of diabetic rats. Biomed. Pharmacother. 2018, 105, 370–376. [Google Scholar] [CrossRef] [Scilit]
  9. Luís, Â.F.S.; Domingues, F.D.C.; Amaral, L.M.J.P. The anti-obesity potential of Ilex paraguariensis: Results from a meta-analysis. Braz. J. Pharm. Sci. 2019, 55, e17615. [Google Scholar] [CrossRef] [Scilit]
  10. Zhu, F.; Cai, Y.Z.; Sun, M.; Ke, J.; Lu, D.; Corke, H. Comparison of major phenolic constituents and in vitro antioxidant activity of diverse Kudingcha genotypes from Ilex kudingcha, Ilex cornuta, and Ligustrum robustum. J. Agric. Food Chem. 2009, 57, 6082–6089. [Google Scholar] [CrossRef] [Scilit]
  11. Chen, G.; Han, Y.; Feng, Y.; Wang, A.; Li, X.; Deng, S.; Zhang, L.; Xiao, J.; Li, Y.; Li, N. Extract of Ilex rotunda Thunb alleviates experimental colitis-associated cancer via suppressing inflammation-induced miR-31-5p/YAP overexpression. Phytomedicine 2019, 62, 152941. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Liu, C.; Shen, Y.-J.; Tu, Q.-B.; Zhao, Y.-R.; Guo, H.; Wang, J.; Zhang, L.; Shi, H.-W.; Sun, Y. Pedunculoside, a novel triterpene saponin extracted from Ilex rotunda, ameliorates high-fat diet induced hyperlipidemia in rats. Biomed. Pharmacother. 2018, 101, 608–616. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Fujiwara, K.; Harada, A. Character of warm-temperate Quercus forests in Asia. In Warm-Temperate Deciduous Forests around the Northern Hemisphere; Springer: Cham, Switzerland, 2015; pp. 27–80. [Google Scholar]
  14. Jin, E.J.; Yoon, J.H.; Choi, M.S.; Sung, C.H. Seasonal Changes in the Absorption of Particulate Matter and the Fine Structure of Street Trees in the Southern Areas, Korea: With a Reference to Quercus myrsinifolia, Quercus glauca, Quercus salicina, Camellia japonica, and Prunus× yedoensis. J. Korean Soc. For. Sci. 2021, 110, 129–140. [Google Scholar]
  15. Joung, Y.H.; Picton, D.; Park, J.O.; Roh, M.S. Molecular evidence for the interspecific hybrid origin of Ilex× wandoensis. Hortic. Environ. Biotechnol. 2011, 52, 516–523. [Google Scholar] [CrossRef] [Scilit]
  16. Ahn, Y.H.; Choi, C.H. The Ecological Characteristics of Native Habitat of Korean Native Wando Holly (llex X wandoensis). J. Environ. Sci. Int. 2007, 16, 1011–1018. [Google Scholar]
  17. Li, X.; Yang, Y.; Henry, R.J.; Rossetto, M.; Wang, Y.; Chen, S. Plant DNA barcoding: From gene to genome. Biol. Rev. 2015, 90, 157–166. [Google Scholar] [CrossRef] [Scilit]
  18. Hollingsworth, P.M.; Graham, S.; Little, D.P. Choosing and Using a Plant DNA Barcode. PLoS ONE 2011, 6, e19254. [Google Scholar]
  19. Krawczyk, K.; Nobis, M.; Myszczyński, K.; Klichowska, E.; Sawicki, J. Plastid super-barcodes as a tool for species discrimination in feather grasses (Poaceae: Stipa). Sci. Rep. 2018, 8, 1–10. [Google Scholar] [CrossRef] [Scilit]
  20. Wu, L.; Wu, M.; Cui, N.; Xiang, L.; Li, Y.; Li, X.; Chen, S. Plant super-barcode: A case study on genome-based identification for closely related species of Fritillaria. Chin. Med. 2021, 16, 1–11. [Google Scholar] [CrossRef] [Scilit]
  21. Yu, J.; Wu, X.; Liu, C.; Newmaster, S.; Ragupathy, S.; Kress, W.J. Progress in the use of DNA barcodes in the identification and classification of medicinal plants. Ecotoxicol. Environ. Saf. 2021, 208, 111691. [Google Scholar] [CrossRef] [Scilit]
  22. Song, M.; Li, J.; Xiong, C.; Liu, H.; Liang, J. Applying high-resolution melting (HRM) technology to identify five commonly used Artemisia species. Sci. Rep. 2016, 6, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Gesto-Borroto, R.; Medina-Jiménez, K.; Lorence, A.; Villarreal, M.L. Application of DNA Barcoding for Quality Control of Herbal Drugs and Their Phytopharmaceuticals. Rev. Bras. Farm. 2021, 31, 127–141. [Google Scholar] [CrossRef] [Scilit]
  24. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Scilit]
  26. Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánchez-Gracia, A. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef] [Scilit]
  27. Sudhir, K.K.C.; Satish, S.C.; Mohan, S.M.R.; Manisha, D.S.; Deepak, K.S.; Ruchi, B.S.; Amita, S.; Bipin, R.; Ashok, K. Chemical constituents and biological significance of the genus Ilex (Aquifoliaceae). Nat. Prod. J. 2012, 2, 212–224. [Google Scholar]
  28. Yi, F.; Zhao, X.L.; Peng, Y.; Xiao, P.G. Genus llex L.: Phytochemistry, ethnopharmacology, and pharmacology. Chin. Herb. Med. 2016, 8, 209–230. [Google Scholar] [CrossRef] [Scilit]
  29. Parveen, I.; Gafner, S.; Techen, N.; Murch, S.J.; Khan, I.A. DNA Barcoding for the Identification of Botanicals in Herbal Medicine and Dietary Supplements: Strengths and Limitations. Planta Medica 2016, 82, 1225–1235. [Google Scholar] [CrossRef] [Scilit]
  30. Dong, W.; Liu, H.; Xu, C.; Zuo, Y.; Chen, Z.; Zhou, S. A chloroplast genomic strategy for designing taxon specific DNA mini-barcodes: A case study on ginsengs. BMC Genet. 2014, 15, 138. [Google Scholar] [CrossRef] [Scilit]
  31. Chen, Q.; Wu, X.; Zhang, D. Comparison of the abilities of universal, super, and specific DNA barcodes to discriminate among the original species of Fritillariae cirrhosae bulbus and its adulterants. PLoS ONE 2020, 15, e0229181. [Google Scholar] [CrossRef] [Scilit]
  32. Yik, M.; Kong, B.; Siu, T.-Y.; Lau, D.; Cao, H.; Shaw, P.-C. Differentiation of Hedyotis diffusa and Common Adulterants Based on Chloroplast Genome Sequencing and DNA Barcoding Markers. Plants 2021, 10, 161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Typical leaf shape of I. integra (A), I. rotunda (B), I. cornuta (C), and I. x wandoensis (D).
Figure 1. Typical leaf shape of I. integra (A), I. rotunda (B), I. cornuta (C), and I. x wandoensis (D).
Forests 13 01718 g001
Figure 2. Distances between adjacent genes and junctions of the large single-copy (LSC), small single-copy (SSC), and two inverted-repeat (IR) regions among the chloroplast genomes of the four Ilex species.
Figure 2. Distances between adjacent genes and junctions of the large single-copy (LSC), small single-copy (SSC), and two inverted-repeat (IR) regions among the chloroplast genomes of the four Ilex species.
Forests 13 01718 g002
Figure 3. Comparison of the six chloroplast genome sequences using mVISTA. The cp genomes of the four Ilex species were compared with that of I. integra NC_044417. Blue blocks: Conserved genes, red blocks: conserved non-coding sequences. White represents regions with sequence variation among the four Ilex species.
Figure 3. Comparison of the six chloroplast genome sequences using mVISTA. The cp genomes of the four Ilex species were compared with that of I. integra NC_044417. Blue blocks: Conserved genes, red blocks: conserved non-coding sequences. White represents regions with sequence variation among the four Ilex species.
Forests 13 01718 g003
Figure 4. Sliding 600 bp window analysis of the six Ilex chloroplast genomes showing nucleotide diversity (π). Regions with π > 0.005 are indicated in the graph. X-axis, positions of the midpoints of windows; y-axis, nucleotide diversity of each window.
Figure 4. Sliding 600 bp window analysis of the six Ilex chloroplast genomes showing nucleotide diversity (π). Regions with π > 0.005 are indicated in the graph. X-axis, positions of the midpoints of windows; y-axis, nucleotide diversity of each window.
Forests 13 01718 g004
Figure 5. Alignment of a subset of DNA fragments at the simple sequence repeat (SSR) locus trnSUGA-psbZ in 15 Ilex chloroplast genomes. Numbers at the top indicate positions relative to the consensus sequence between 70 and 130 bp. Bold nucleotides in brackets indicate SSR motifs, and the number of repeats is shown. Dashes indicate gaps. Point mutations are highlighted with colored boxes; red: A, green: T, blue: G, and purple: C. Yellow boxes indicate two groups of insertions and deletions, which are considered to be a single mutational event.
Figure 5. Alignment of a subset of DNA fragments at the simple sequence repeat (SSR) locus trnSUGA-psbZ in 15 Ilex chloroplast genomes. Numbers at the top indicate positions relative to the consensus sequence between 70 and 130 bp. Bold nucleotides in brackets indicate SSR motifs, and the number of repeats is shown. Dashes indicate gaps. Point mutations are highlighted with colored boxes; red: A, green: T, blue: G, and purple: C. Yellow boxes indicate two groups of insertions and deletions, which are considered to be a single mutational event.
Forests 13 01718 g005
Figure 6. Microsatellite typing of the four Ilex species using HRM analysis with the SSR marker trnSUGA-psbZ. (a) Normalized melting curves. (b) Difference plot curves.
Figure 6. Microsatellite typing of the four Ilex species using HRM analysis with the SSR marker trnSUGA-psbZ. (a) Normalized melting curves. (b) Difference plot curves.
Forests 13 01718 g006
Table 1. Ilex specimens used in this study.
Table 1. Ilex specimens used in this study.
No.Scientific NameCommon NameCollection SiteSpecimen Code
1Ilex integra Thunb.Kamtangnamu34°21′37.8″ N126°39′51.2″ ENIBRGR0000630040
234°21′37.5″ N 126°39′51.5″ EJINR000003111
334°21′37.4″ N 126°39′52.2″ EJINR000003112
434°21′37.3″ N 126°39′52.5″ EJINR000003113
534°41′12.1″ N 126°53′47.6″ EJINR000003114
6Ilex rotunda Thunb.Meonnamu33°18′09.4″ N 126°18′47.9″ ENIBRGR0000429868
734°41′11.8″ N 126°53′48.8″ EJINR000003115
834°21′44.5″ N 126°39′43.9″ EJINR000003116
934°21′44.4″ N 126°39′43.7″ EJINR000003117
1034°21′44.2″ N 126°39′44.0″ EJINR000003118
11Ilex cornuta Lindl.andPaxtonHoranggasinamu33°20′12.7″ N 126°12′03.5″ ENIBRGR0000429502
1233°20′00.6″ N 126°10′40.6″ ENIBRGR0000630049
1333°18′55.3″ N 126°10′33.4″ ENIBRGR0000630051
1435°00′23.2″ N 126°49′21.5″ EJINR000003119
1535°00′23.3″ N 126°49′24.3″ EJINR000003120
16Ilex x wandoensis C.F. Mill. and M. KimWandohoranggasinamu34°55′38.1″ N 127°30′06.6″ EJINR000003121
1735°00′23.5″ N 126°49′20.1″ EJINR000003122
1835°00′23.5″ N 126°49′20.2″ EJINR000003123
1934°21′38.3″ N 126°39′51.4″ EJINR000003124
2034°21′38.1″ N 126°39′51.8″ EJINR000003125
Table 2. Genes in the chloroplast genomes of the four Ilex species. a Genes with two copies; * Genes with one intron; ** Genes with two introns.
Table 2. Genes in the chloroplast genomes of the four Ilex species. a Genes with two copies; * Genes with one intron; ** Genes with two introns.
CategoryGene GroupGene Name
Self-replicationRibosomal RNA genesrrn4.5 arrn5 arrn16 arrn23 a
Transfer RNA genestrnA-UGC *trnC-GCAtrnD-GUCtrnE-UUCtrnF-GAA
trnfM-CAUtrnG-GCCtrnG-UCC *trnH-GUGtrnI-CAU a
trnI-GAU a,*trnK-UUU *trnL-CAA atrnL-UAA *trnL-UAG
trnM-CAUtrnN-GUU atrnP-UGGtrnQ-UUGtrnR-ACG a
trnR-UCUtrnS-GCUtrnS-UGAtrnS-GGAtrnT-UGU
trnT-GGUtrnV-GAC atrnV-UAC *trnV-GACtrnW-CCA
trendy-GUA
Small ribosome subunitrps2rps3rps4rps7 arps8
rps11rps12A *rps12B a,**rps14rps15
rps16 *rps18rps19
Large ribosome subunitrpl2 a,*rpl14rpl16 *rpl20rpl22
rpl23 arpl32rpl33rpl36
RNA polymeraserpoArpoBrpoC1 *rpoC2
Translation initiation factorinfA
PhotosynthesisPhotosystem I subunitpsaApsaBpsaCpsaIpsaJ
ycf3 **ycf4
Photosystem II subunitpsbApsbBpsbCpsbDpsbE
psbFpsbHpsbIpsbJpsbK
psbLpsbMpsbTpsbZ
Cytochrome b/f complexpetApetB*petD *petGpetL
petN
ATP synthaseatpAatpBatpEatpF*atpH
atpI
Rubisco large chainrbcL
NADH dehydrogenasendhA *ndhB a,*ndhCndhDndhE
ndhFndhGndhHndhIndhJ
ndhK
Other genesMaturasematK
Membrane proteincemA
Acetyl-CoA carboxylaseaccD
Cytochrome c biogenesisccsA
ATP-dependent proteaseclpP **
TIC complex componentycf1 a
Genes of unknown functionsOpen reading framesycf2ycf15
Table 3. Characteristics of the microsatellite marker used for HRM analysis.
Table 3. Characteristics of the microsatellite marker used for HRM analysis.
LocusRegionRepeat MotifSequence (5’-3’)Tm (°C)Size (bp)
trnSUGA-psbZIGS(T/A)(A)4(A/T/G/C)(A)n(T)2
(T/G)(C)2(A)n(C)n
TGCATGCCCATTTGTGAAA
CATTTGATCCCTCTATCAGCCA
60170–180
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kim, Y.; Oh, D.-R.; Kim, Y.-J.; Oh, K.-N.; Bae, D. Chloroplast Microsatellite-Based High-Resolution Melting Analysis for Authentication and Discrimination of Ilex Species. Forests 2022, 13, 1718. https://doi.org/10.3390/f13101718

AMA Style

Kim Y, Oh D-R, Kim Y-J, Oh K-N, Bae D. Chloroplast Microsatellite-Based High-Resolution Melting Analysis for Authentication and Discrimination of Ilex Species. Forests. 2022; 13(10):1718. https://doi.org/10.3390/f13101718

Chicago/Turabian Style

Kim, Yonguk, Dool-Ri Oh, Yu-Jin Kim, Kyo-Nyeo Oh, and Donghyuk Bae. 2022. "Chloroplast Microsatellite-Based High-Resolution Melting Analysis for Authentication and Discrimination of Ilex Species" Forests 13, no. 10: 1718. https://doi.org/10.3390/f13101718

APA Style

Kim, Y., Oh, D.-R., Kim, Y.-J., Oh, K.-N., & Bae, D. (2022). Chloroplast Microsatellite-Based High-Resolution Melting Analysis for Authentication and Discrimination of Ilex Species. Forests, 13(10), 1718. https://doi.org/10.3390/f13101718

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop