Nanocomplex of Berberine with C60 Fullerene Is a Potent Suppressor of Lewis Lung Carcinoma Cells Invasion In Vitro and Metastatic Activity In Vivo
Abstract
1. Introduction
2. Materials and Methods
2.1. Structure Modeling of C60-Ber Nanocomplex
2.2. Preparation of C60-Ber Nanocomplex
2.3. Cell Culture
2.4. In Vitro Invasion Assay
2.5. Western Blot Analysis
2.6. Quantitative PCR Analysis
2.7. In Vivo Metastatic Growth Study
2.8. Statistics
3. Results
3.1. Calculation
3.2. C60-Ber Nanocomplex Demonstrates the High Ability to Suppress the Invasion Potential of LLC Cells In Vitro
3.3. C60-Ber Nanocomplex Effectively Modulates the Expression of EMT Effectors
3.4. Expression of EMT Related Transcription Factors and Cancer Stem Cell Surface Markers Is Suppressed by C60-Ber Nanocomplex
3.5. C60-Ber Nanocomplex Effectively Suppresses LLC Cells Metastasis to Lung
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Imenshahidi, M.; Hosseinzadeh, H. Berberis Vulgaris and Berberine: An Update Review. Phytother. Res. 2016, 30, 1745–1764. [Google Scholar] [CrossRef] [Scilit]
- Neag, M.A.; Mocan, A.; Echeverría, J.; Pop, R.P.; Bocsan, C.L.; Crisan, G.; Buzoianu, A.D. Berberine: Botanical Occurrence, Traditional Uses, Extraction Methods, and Relevance in Cardiovascular, Metabolic, Hepatic, and Renal Disorders. Front. Pharmacol. 2018, 9, 557. [Google Scholar] [CrossRef] [Scilit]
- Singh, N.; Sharma, B. Toxicological Effects of Berberine and Sanguinarine. Front. Mol. Biosci. 2018, 5, 21. [Google Scholar] [CrossRef] [Scilit]
- Farooqi, A.A.; Qureshi, M.Z.; Khalid, S.; Attar, R.; Martinelli, C.; Sabitaliyevich, U.Y.; Sadykov, B.N.; Taverna, S.; Poltronieri, P.; Xu, B. Regulation of Cell Signaling Pathways by Berberine in Different Cancers: Searching for Missing Pieces of an Incomplete Jig-Saw Puzzle for an Effective Cancer Therapy. Cancers 2019, 11, 478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kulkarni, S.K.; Dandiya, P.C.; Varandani, N.L. Pharmacological investigations of berberine sulphate. Jpn. J. Pharmacol. 1972, 22, 11–16. [Google Scholar] [CrossRef]
- Kheir, M.M.; Wang, Y.; Hua, L.; Hu, J.; Li, L.; Lei, F.; Du, L. Acute toxicity of berberine and its correlation with the blood concentration in mice. Food Chem. Toxicol. 2010, 48, 1105–1110. [Google Scholar] [CrossRef] [Scilit]
- Tillhon, M.; Guamán Ortiz, L.M.; Lombardi, P.; Scovassi, A.I. Berberine: New perspectives for old remedies. Biochem. Pharm. 2012, 84, 1260–1267. [Google Scholar] [CrossRef] [Scilit]
- Efferth, T.; Oesch, F. Repurposing of plant alkaloids for cancer therapy: Pharmacology and toxicology. Semin. Cancer Biol. 2021, 68, 143–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Y.; Xun, K.; Wang, Y.; Chen, X. A systematic review of the anticancer properties of berberine, a natural product from Chinese herbs. Anticancer Drugs 2009, 20, 757–769. [Google Scholar] [CrossRef] [Scilit]
- Xu, J.; Long, Y.; Ni, L.; Yuan, X.; Yu, N.; Wu, R.; Tao, J.; Zhang, Y. Anticancer effect of berberine based on experimental animal models of various cancers: A systematic review and meta-analysis. BMC Cancer 2019, 19, 589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, C.S.; Zheng, Y.R.; Zhang, Y.F.; Long, X.Y. Research progress on berberine with a special focus on its oral bioavailability. Fitoterapia 2016, 109, 274–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwon, M.; Lim, D.Y.; Lee, C.H.; Jeon, J.H.; Choi, M.K.; Song, I.S. Enhanced Intestinal Absorption and Pharmacokinetic Modulation of Berberine and Its Metabolites through the Inhibition of P-Glycoprotein and Intestinal Metabolism in Rats Using a Berberine Mixed Micelle Formulation. Pharmaceutics 2020, 12, 882. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Javed Iqbal, M.; Quispe, C.; Javed, Z.; Sadia, H.; Qadri, Q.R.; Raza, S.; Salehi, B.; Cruz-Martines, N.; Mohamed, Z.A.; Jaafaru, M.S.; et al. Nanotechnology-Based Strategies for Berberine Delivery System in Cancer Treatment: Pulling Strings to Keep Berberine in Power. Front. Mol. Biosci. 2020, 7, 624494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, L.; Li, H.; Wang, S.; Liu, R.; Wu, Z.; Wang, C.; Wang, Y.; Chen, M. Enhancing the antitumor activity of berberine hydrochloride by solid lipid nanoparticle encapsulation. AAPS PharmSciTech 2014, 15, 834–844. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bhanumathi, R.; Vimala, K.; Shanthi, K.; Thangaraj, R.; Kannan, S. Bioformulation of silver nanoparticles as berberine carrier cumanticancer agent against breast cancer. New J. Chem. 2017, 41, 14466–14477. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.; Lee, S.Y.; Cho, H.J. Berberine and zinc oxide-based nanoparticles for the chemo-photothermal therapy of lung adenocarcinoma. Biochem. Biophys. Res. Commun. 2018, 501, 765–770. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Wen, B.; Yu, H.; Ding, D.; Zhang, J.; Zhang, Y.; Zhao, L.; Zhang, W. Berberine Hydrochloride-Loaded Chitosan Nanoparticles Effectively Targets and Suppresses Human Nasopharyngeal Carcinoma. J. Biomed. Nanotechnol. 2018, 14, 1486–1495. [Google Scholar] [CrossRef] [Scilit]
- Gupta, L.; Sharma, A.K.; Gothwal, A.; Khan, M.S.; Khinchi, M.P.; Qayum, A.; Singh, S.K.; Gupta, U. Dendrimer encapsulated and conjugated delivery of berberine: A novel approach mitigating toxicity and improving in vivo pharmacokinetics. Int. J. Pharm. 2017, 528, 88–99. [Google Scholar] [CrossRef] [Scilit]
- Bunker, A.; Róg, T. Mechanistic Understanding From Molecular Dynamics Simulation in Pharmaceutical Research 1: Drug Delivery. Front. Mol. Biosci. 2020, 7, 604770. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goodarzi, S.; Da Ros, T.; Conde, J.; Sefat, F.; Mozafari, M. Fullerene: Biomedical engineers get to revisit an old friend. Mater. Today 2017, 20, 460–480. [Google Scholar] [CrossRef] [Scilit]
- Moussa, F. [60]Fullerene and derivatives for biomedical applications. Nanobiomaterials 2018, 2018, 113–136. [Google Scholar] [CrossRef] [Scilit]
- Grebinyk, A.; Prylutska, S.; Grebinyk, S.; Prylutskyy, Y.; Ritter, U.; Matyshevska, O.; Dandekar, T.; Frohme, M. Complexation with C60 Fullerene Increases Doxorubicin Efficiency against Leukemic Cells In Vitro. Nanoscale Res. 2019, 14, 61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prylutska, S.; Grynyuk, I.; Skaterna, T.; Horak, I.R.; Grebinyk, A.G.; Drobot, L.B.; Matyshevska, O.P.; Senenko, A.I.; Prylutskyy, Y.I.; Naumovets, A.G.; et al. Toxicity of C60 fullerene-cisplatin nanocomplex against Lewis lung carcinoma cells. Arch. Toxicol. 2019, 93, 1213–1226. [Google Scholar] [CrossRef] [Scilit]
- Grebinyk, A.; Prylutska, S.; Buchelnikov, A.; Tverdokhleb, N.; Grebinyk, S.; Evstigneev, M.; Matyshevska, O.; Cherepanov, V.; Prylutskyy, Y.; Yashchuk, V.; et al. C60 Fullerene as an Effective Nanoplatform of Alkaloid Berberine Delivery into Leukemic Cells. Pharmaceutics 2019, 11, 586. [Google Scholar] [CrossRef] [Scilit]
- Grebinyk, A.; Prylutska, S.; Grebinyk, S.; Evstigneev, M.; Krysiuk, I.; Skaterna, T.; Horak, I.; Sun, Y.; Drobot, L.; Matyshevska, O.; et al. Antitumor efficiency of the natural alkaloid Berberine complexed with C60 fullerene in Lewis lung carcinoma in vitro and in vivo. Cancer Nanotechnol. 2021, 12, 24. [Google Scholar] [CrossRef] [Scilit]
- Gennatas, S.; Noble, J.; Stanway, S.; Gunapala, R.; Chowdhury, R.; Wotherspoon, A.; Benepal, T.; Popat, S. Patterns of relapse in extrapulmonary small cell carcinoma: Retrospective analysis of outcomes from two cancer centres. BMJ Open 2015, 5, e006440. [Google Scholar] [CrossRef] [Scilit]
- Popper, H.H. Progression and metastasis of lung cancer. Cancer Metastasis Rev. 2016, 35, 75–91. [Google Scholar] [CrossRef] [Scilit]
- Garg, M. Epithelial-mesenchymal transition—Activating transcription factors—Multifunctional regulators in cancer. World J. Stem Cells 2013, 5, 188–195. [Google Scholar] [CrossRef] [Scilit]
- Mittal, V. Epithelial Mesenchymal Transition in Tumor Metastasis. Annu. Rev. Pathol. 2018, 13, 395–412. [Google Scholar] [CrossRef] [Scilit]
- Kostjukov, V.V.; Khomytova, N.M.; Santiago, A.A.H.; Tavera, A.M.C.; Alvarado, J.S.; Evstigneev, M.P. Parsing of the free energy of aromatic–aromatic stacking interactions in solution. J. Chem. Thermodyn. 2011, 43, 1424–1434. [Google Scholar] [CrossRef] [Scilit]
- Skamrova, G.B.; Laponogov, I.V.; Buchelnikov, A.S.; Shckorbatov, Y.G.; Prylutska, S.V.; Ritter, U.; Prylutskyy, Y.I.; Evstigneev, M.P. Interceptor effect of C60 fullerene on the in vitro action of aromatic drug molecules. Eur. Biophys. J. 2014, 43, 265–276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ritter, U.; Prylutskyy, Y.I.; Evstigneev, M.P.; Davidenko, N.A.; Cherepanov, V.V.; Senenko, A.I.; Marchenko, O.A.; Naumovets, A.G. Structural Features of Highly Stable Reproducible C60 Fullerene Aqueous Colloid Solution Probed by Various Techniques. Fuller. Nanotub. Carbon Nanostruct. 2015, 23, 530–534. [Google Scholar] [CrossRef] [Scilit]
- Samoylenko, A.; Vynnytska-Myronovska, B.; Byts, N.; Kozlova, N.; Basaraba, O.; Pasichnyk, G.; Palyvoda, K.; Bobak, Y.; Barska, M.; Mayevska, O.; et al. Increased levels of the HER1 adaptor protein Rukl/CIN85 contribute to breast cancer malignancy. Carcinogenesis 2012, 33, 1976–1984. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mayevska, O.; Shuvayeva, H.; Igumentseva, N.; Havrylov, S.; Basaraba, O.; Bobak, Y.; Barska, M.; Volodko, N.; Baranska, J.; Buchman, V.; et al. Expression of adaptor protein Ruk/CIN85 isoforms in cell lines of various tissue origins and human melanoma. Exp. Oncol. 2006, 28, 275–281. [Google Scholar] [PubMed]
- Casas, E.; Kim, J.; Bendesky, A.; Ohno-Machado, L.; Wolfe, C.J.; Yang, J. Snail2 is an essential mediator of Twist1-induced epithelial mesenchymal transition and metastasis. Cancer Res. 2011, 71, 245–254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, W.; Kang, Y. Epithelial-Mesenchymal Plasticity in Cancer Progression and Metastasis. Dev. Cell 2019, 49, 361–374. [Google Scholar] [CrossRef] [Scilit]
- Yu, Z.; Pestell, T.G.; Lisanti, M.P.; Pestell, R.G. Cancer stem cells. Int. J. Biochem. Cell Biol. 2012, 44, 2144–2151. [Google Scholar] [CrossRef] [Scilit]
- Mirza, S.; Jain, N.; Rawal, R. Evidence for circulating cancer stem-like cells and epithelial-mesenchymal transition phenotype in the pleurospheres derived from lung adenocarcinoma using liquid biopsy. Tumor Biol. 2017, 39, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Horak, I.R.; Pasichnyk, G.V.; Gerashchenko, D.S.; Knopfova, L.; Borsig, L.; Drobot, L. Adaptor protein Ruk/CIN85 modulates manifestation of cancer stem cells (CSCs) features in mouse breast adenocarcinoma 4T1 cells. Rep. Natl. Acad. Sci. Ukr. 2018, 12, 101–109. [Google Scholar] [CrossRef] [Scilit]
- Chu, S.C.; Yu, C.C.; Hsu, L.S.; Chen, K.S.; Su, M.Y.; Chen, P.N. Berberine reverses epithelial-to-mesenchymal transition and inhibits metastasis and tumor-induced angiogenesis in human cervical cancer cells. Mol. Pharmacol. 2014, 86, 609–623. [Google Scholar] [CrossRef] [Scilit]
- Qi, H.W.; Xin, L.Y.; Xu, X.; Ji, X.X.; Fan, L.H. Epithelial-to-mesenchymal transition markers to predict response of Berberine in suppressing lung cancer invasion and metastasis. J. Transl. Med. 2014, 12, 22. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.H.; Tang, W.C.; Sia, P.; Huang, C.C.; Yang, P.M.; Wu, M.H.; Lai, I.L.; Lee, K.H. Berberine inhibits the metastatic ability of prostate cancer cells by suppressing epithelial-to-mesenchymal transition (EMT)-associated genes with predictive and prognostic relevance. Int. J. Med. Sci. 2015, 12, 63–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hanssen, A.; Loges, S.; Pantel, K.; Wikman, H. Detection of Circulating Tumor Cells in Non-Small Cell Lung Cancer. Front. Oncol. 2015, 5, 207. [Google Scholar] [CrossRef] [Scilit]
- Thomas, O.S.; Weber, W. Overcoming Physiological Barriers to Nanoparticle Delivery-Are We There Yet? Front. Bioeng. Biotechnol. 2019, 7, 415. [Google Scholar] [CrossRef] [Scilit]
- Didenko, G.; Prylutska, S.; Kichmarenko, Y.; Potebnya, G.; Prylutskyy, Y.; Slobodyanik, N.; Ritter, U.; Scharff, P. Evaluation of the antitumor immune response to C60 fullerene. Materialwissenschaft und Werkstofftechnik 2013, 44, 124–128. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Jiao, F.; Qiu, Y.; Wei, L.; Ying, Q.; Chixia, T.; Yufeng, L.; Ru, B.; Fang, L.; Yuliang, Z.; et al. Immunostimulatory properties and enhanced TNF- alpha mediated cellular immunity for tumor therapy by C60(OH)20 nanoparticles. Nanotechnology 2009, 20, 415102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meng, J.; Liang, X.; Chen, X.; Zhao, Y. Biological characterizations of [Gd@C82(OH)22]n nanoparticles as fullerene derivatives for cancer therapy. Integr. Biol. 2013, 5, 43–47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dunn, G.P.; Bruce, A.T.; Ikeda, H.; Old, L.J.; Schreiber, R.D. Cancer immunoediting: From immunosurveillance to tumor escape. Nat. Immunol. 2002, 3, 991–998. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prylutska, S.; Skivka, L.; Didenko, G.; Prylutskyy, Y.; Evstigneev, M.; Potebnya, G.; Panchuk, R.; Stoika, R.; Ritter, U.; Scharff, P.; et al. Complex of C60 Fullerene with Doxorubicin as a Promising Agent in Antitumor Therapy. Nanoscale Res. Lett. 2015, 10, 499. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prylutska, S.V.; Politenkova, S.V.; Afanasieva, K.S.; Korolovych, V.F.; Bogutska, K.I.; Sivolob, A.V.; Skivka, L.M.; Evstigneev, M.P.; Kostjukov, V.V.; Prylutskyy, Y.I.; et al. A nanocomplex of С60 fullerene with cisplatin: Design, characterization and toxicity. Beilstein J. Nanotechnol. 2017, 8, 1494–1501. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Panchuk, R.R.; Prylutska, S.V.; Chumakl, V.V.; Skorokhyd, N.R.; Lehka, L.V.; Evstigneev, M.P.; Prylutskyy, Y.I.; Berger, W.; Heffeter, P.; Scharff, P.; et al. Application of C60 Fullerene-Doxorubicin Complex for Tumor Cell Treatment In Vitro and In Vivo. J. Biomed. Nanotechnol. 2015, 11, 1139–1152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prylutska, S.; Panchuk, R.; Gołunski, G.; Skivka, L.; Prylutskyy, Y.; Hurmach, V.; Skorokhyd, N.; Borowik, A.; Woziwodzka, A.; Piosik, J.; et al. C60 fullerene enhances cisplatin anticancer activity and overcomes tumor cell drug resistance. Nano Res. 2017, 10, 652–671. [Google Scholar] [CrossRef] [Scilit]






| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| Snai1 | TCTGAAGATGCACATCCGAAGCCA | AGGAGAATGGCTTCTCACCAGTGT |
| Zeb1 | GGAGGAGGTGACTCGAGCATTTAG | TAATACTGTCTGGTCTGCTGGC |
| Twist1 | CTCAGCTACGCCTTCTCCGT | CCTCTGGGAATCTCTGTCCAC |
| Cd44 | AGAGCACCCCAGAAAGCTAC | GTAGTTGCACTCGTTGTGGG |
| Cd24 | GCGAGCTTAGCAGATCTCCAC | CGGTGCAACAGATGTTTGGT |
| Sh3kbp1 (Ruk/CIN85) | CGCCAACTTTCACGCTGCTT | TGACCTCACCCACGCTGATT |
| B2m | ACCGTCTACTGGGATCGAGA | TGCTATTTCTTTCTGCGTGCAT |
| Nano-Complex | ΔGentr | ΔGel | ΔGvdw | ΔGH-bonds | ΔGhydr | ΔGtotal | ΔGexp | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ΔGtr | ΔGrot | ΔGvib(I) | ΔGvib(II) | ΔGsolv | ΔGim | ΔGvdw(solv) | ΔGvdw(im) | |||||
| C60-Ber | 9.8 | 8.4 | −6.0 | −9.5 | 0.0 | 0.0 | 16.8 | −19.0 | −1.8 | −10.1 | −11.3 | −6.0 [24] |
| Σ | 2.8 | 0.0 | −2.2 | |||||||||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Horak, I.; Prylutska, S.; Krysiuk, I.; Luhovskyi, S.; Hrabovsky, O.; Tverdokhleb, N.; Franskevych, D.; Rumiantsev, D.; Senenko, A.; Evstigneev, M.; et al. Nanocomplex of Berberine with C60 Fullerene Is a Potent Suppressor of Lewis Lung Carcinoma Cells Invasion In Vitro and Metastatic Activity In Vivo. Materials 2021, 14, 6114. https://doi.org/10.3390/ma14206114
Horak I, Prylutska S, Krysiuk I, Luhovskyi S, Hrabovsky O, Tverdokhleb N, Franskevych D, Rumiantsev D, Senenko A, Evstigneev M, et al. Nanocomplex of Berberine with C60 Fullerene Is a Potent Suppressor of Lewis Lung Carcinoma Cells Invasion In Vitro and Metastatic Activity In Vivo. Materials. 2021; 14(20):6114. https://doi.org/10.3390/ma14206114
Chicago/Turabian StyleHorak, Iryna, Svitlana Prylutska, Iryna Krysiuk, Serhii Luhovskyi, Oleksii Hrabovsky, Nina Tverdokhleb, Daria Franskevych, Dmytro Rumiantsev, Anton Senenko, Maxim Evstigneev, and et al. 2021. "Nanocomplex of Berberine with C60 Fullerene Is a Potent Suppressor of Lewis Lung Carcinoma Cells Invasion In Vitro and Metastatic Activity In Vivo" Materials 14, no. 20: 6114. https://doi.org/10.3390/ma14206114
APA StyleHorak, I., Prylutska, S., Krysiuk, I., Luhovskyi, S., Hrabovsky, O., Tverdokhleb, N., Franskevych, D., Rumiantsev, D., Senenko, A., Evstigneev, M., Drobot, L., Matyshevska, O., Ritter, U., Piosik, J., & Prylutskyy, Y. (2021). Nanocomplex of Berberine with C60 Fullerene Is a Potent Suppressor of Lewis Lung Carcinoma Cells Invasion In Vitro and Metastatic Activity In Vivo. Materials, 14(20), 6114. https://doi.org/10.3390/ma14206114

