PLA-Based Mineral-Doped Scaffolds Seeded with Human Periapical Cyst-Derived MSCs: A Promising Tool for Regenerative Healing in Dentistry
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. TIPS Scaffolds Preparation
2.3. Scaffold Characterization by Micro-CT
2.4. Cell Culture
2.5. Cytofluorimetric Analysis
2.6. Proliferation Assay
2.7. Live/Dead Assay
2.8. qPCR
- RUNX-2
- For: ATGTGTGTTTGTTTCAGCAGCA
- Rev: TCCCTAAAGTCACTCGGTATGTGTA
- DMP-1
- For: GTGAGTGAGTCCAGGGGAGATAA
- Rev: TTTTGAGTGGGAGAGTGTGTGC
- OSC
- For: TGAGAGCCCTCACACTCCTC
- Rev: ACCTTTGCTGGACTCTGCAC
2.9. Statistical Analysis
3. Results
3.1. Scaffolds Characterization by Micro-CT
3.2. Biological Assays
3.3. Metabolic Assay
3.4. Live/Dead Assay
3.5. Osteogenic Differentiation
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Gyurkocza, B.; Rezvani, A.; Storb, R.F. Allogeneic hematopoietic cell transplantation: The state of the art. Expert Rev. Hematol. 2010, 3, 285–299. [Google Scholar] [CrossRef] [PubMed]
- Codispoti, B.; Rinaldo, N.; Chiarella, E.; Lupia, M.; Spoleti, C.B.; Marafioti, M.G.; Aloisio, A.; Scicchitano, S.; Giordano, M.; Nappo, G.; et al. Recombinant TAT-BMI-1 fusion protein induces ex vivo expansion of human umbilical cord blood-derived hematopoietic stem cells. Oncotarget 2017, 27, 43782–43798. [Google Scholar] [CrossRef] [PubMed]
- Tatullo, M.; Codispoti, B.; Pacifici, A.; Palmieri, F.; Marrelli, M.; Pacifici, L.; Paduano, F. Potential Use of Human Periapical Cyst-Mesenchymal Stem Cells (hPCy-MSCs) as a Novel Stem Cell Source for Regenerative Medicine Applications. Front. Cell Dev. Biol. 2017, 5, 103. [Google Scholar] [CrossRef] [PubMed]
- Nair, P.N.R. On the causes of persistent apical periodontitis: A review. Int. Endod. J. 2016, 39, 249–281. [Google Scholar] [CrossRef] [PubMed]
- Park, J.G.; Fayazi, S.; White, S.N. Prevalence of periapical radiolucency and root canal treatment: A systematic review of cross-sectional studies. J. Endod. 2012, 38, 1170–1176. [Google Scholar]
- Berlin-Broner, Y.; Febbraio, M.; Levin, L. Association between apical periodontitis and cardiovascular diseases: A systematic review of the literature. Int. Endod. J. 2017, 50, 847–859. [Google Scholar] [CrossRef] [PubMed]
- Marrelli, M.; Paduano, F.; Tatullo, M. Cells isolated from human periapical cysts express mesenchymal stem cell-like properties. Int. J. Biol. Sci. 2013, 16, 1070–1078. [Google Scholar] [CrossRef]
- Kawashima, N. Characterisation of dental pulp stem cells: a new horizon fortissue regeneration? Arch. Oral Biol. 2012, 57, 1439–1458. [Google Scholar] [CrossRef]
- Paduano, F.; Marrelli, M.; Palmieri, F.; Tatullo, M. CD146 Expression Influences Periapical Cyst Mesenchymal Stem Cell Properties. Stem Cell Rev. Rep. 2016, 12, 592–603. [Google Scholar] [CrossRef]
- Covas, D.T.; Panepucci, R.A.; Fontes, A.M.; Silva, W.A.; Orellana, M.D.; Freitas, M.C.; Neder, L.; Santos, A.R.; Peres, L.C.; Jamur, M.C.; Zago, M.A. Multipotent mesenchymal stromal cells obtained from diverse human tissues share functional properties and gene-expression profile with CD146+ perivascular cells and fibroblasts. Exp. Hematol. 2008, 36, 642–654. [Google Scholar] [CrossRef]
- Tatullo, M.; Falisi, G.; Amantea, M.; Rastelli, C.; Paduano, F.; Marrelli, M. Dental pulp stem cells and human periapical cyst mesenchymal stem cells in bone tissue regeneration: Comparison of basal and osteogenic differentiated gene expression of a newly discovered mesenchymal stem cell lineage. J. Biol. Regul. Homeost. Agents 2015, 29, 713–718. [Google Scholar] [PubMed]
- Marrelli, M.; Paduano, F.; Tatullo, M. Human periapical cyst-mesenchymal stem cells differentiate into neuronal cells. J. Dental Res. 2015, 94, 843–852. [Google Scholar] [CrossRef] [PubMed]
- Marrelli, M.; Falisi, G.; Apicella, A.; Apicella, D.; Amantea, M.; Cielo, A.; Bonanome, L.; Palmieri, F.; Santacroce, L.; Giannini, S.; et al. Behaviour of dental pulp stem cells on different types of innovative mesoporous and nanoporous silicon scaffolds with different functionalizations of the surfaces. J. Biol. Regul. Homeost. Agents 2015, 29, 991–997. [Google Scholar] [PubMed]
- Paduano, F.; Marrelli, M.; White, L.J.; Shakesheff, K.M.; Tatullo, M. Odontogenic Differentiation of Human Dental Pulp Stem Cells on Hydrogel Scaffolds Derived from Decellularized Bone Extracellular Matrix and Collagen Type I. PLoS ONE 2016, 11, e0148225. [Google Scholar] [CrossRef] [PubMed]
- Paduano, F.; Marrelli, M.; Alom, N.; Amer, M.; White, L.J.; Shakesheff, K.M.; Tatullo, M. Decellularized bone extracellular matrix and human dental pulp stem cells as a construct for bone regeneration. J. Biomater. Sci. Polym. Edit. 2017, 28, 730–748. [Google Scholar] [CrossRef] [PubMed]
- Langer, R.; Vacanti, J.P. Tissue engineering. Science 1993, 260, 920–926. [Google Scholar] [CrossRef] [PubMed]
- Moussa, D.G.; Aparicio, C. Present and future of tissue engineering scaffolds for dentin-pulp complex regeneration. J. Tissue Eng. Regen. Med. 2019, 13, 58–75. [Google Scholar] [CrossRef] [PubMed]
- Armentano, I.; Dottori, M.; Fortunati, E.; Mattioli, S.; Kenny, J.M. Biodegradable polymer matrix nanocomposites for tissue engineering: A review. Polym. Degrad. Stab. 2010, 95, 2126–2146. [Google Scholar] [CrossRef]
- Zizzari, V.L.; Zara, S.; Tetè, G.; Vinci, R.; Gherlone, E.; Cataldi, A. Biologic and clinical aspects of integration of different bone substitutes in oral surgery: A literature review. Oral Surg. Oral Med. Oral Pathol. Oral Radiolo. 2016, 122, 392–402. [Google Scholar] [CrossRef]
- LeGeros, R.Z.; Lin, S.; Rohanizadeh, R.; Mijares, D.; LeGeros, J.P. Biphasic calcium phosphate bioceramics: preparation, properties and applications. J. Mater. Sci. 2003, 14, 201–209. [Google Scholar]
- Yip, I.; Ma, L.; Mattheos, N.; Dard, M.; Lang, N.P. Defect healing with various bone substitutes. Clin. Oral Implant. Res. 2015, 26, 606–614. [Google Scholar] [CrossRef] [PubMed]
- Gandolfi, M.G.; Spagnuolo, G.; Siboni, F.; Procino, A.; Rivieccio, V.; Pelliccioni, G.A.; Prati, C.; Rengo, S. Calcium silicate/calcium phosphate biphasic cements for vital pulp therapy: chemical-physical properties and human pulp cells response. Clin. Oral Investig. 2015, 19, 2075–2089. [Google Scholar] [CrossRef] [PubMed]
- Prati, C.; Gandolfi, M.G. Calcium silicate bioactive cements: biological perspectives and clinical applications. Dental Mater. 2015, 31, 351–370. [Google Scholar] [CrossRef] [PubMed]
- Gandolfi, M.G.; Iezzi, G.; Piattelli, A.; Prati, C.; Scarano, A. Osteoinductive potential and bone-bonding ability of ProRoot MTA, MTA Plus and Biodentine in rabbit intramedullary model: Microchemical characterization and histological analysis. Dental Mater. 2017, 33, 221–238. [Google Scholar] [CrossRef] [PubMed]
- Siboni, F.; Taddei, P.; Zamparini, F.; Prati, C.; Gandolfi, M.G. Properties of BioRoot RCS, a tricalcium silicate endodontic sealer modified with povidone and polycarboxylate. Int. Endod. J. 2018, 50, 120–136. [Google Scholar] [CrossRef] [PubMed]
- Zamparini, F.; Siboni, F.; Prati, C.; Taddei, P.; Gandolfi, M.G. Properties of calcium silicate-monobasic calcium phosphate materials for endodontics containing tantalum pentoxide and zirconium oxide. Clin. Oral Investig. 2019, 23, 445–457. [Google Scholar] [CrossRef] [PubMed]
- Zhou, W.; Zheng, Q.; Tan, X.; Song, D.; Zhang, L.; Huang, D. Comparison of Mineral Trioxide Aggregate and iRoot BP Plus Root Repair Material as Root-end Filling Materials in Endodontic Microsurgery: A Prospective Randomized Controlled Study. J. Endod. 2017, 43, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Gandolfi, M.G.; Taddei, P.; Modena, E.; Siboni, F.; Prati, C. Biointeractivity-related versus chemi/physisorption-related apatite precursor-forming ability of current root end filling materials. J. Biomed. Mater. Res. B Appl. Biomater. 2013, 101, 1107–1123. [Google Scholar] [CrossRef]
- Gandolfi, M.G.; Taddei, P.; Tinti, A.; Dorigo, E.D.S.; Prati, C. Alpha-TCP improves the apatite-formation ability of calcium-silicate hydraulic cement soaked in phosphate solutions. Mater. Sci. Eng. C Mater. Biol. Appl. 2011, 31, 1412–1422. [Google Scholar] [CrossRef]
- Marei, N.H.; El-Sherbiny, I.M.; Lotfy, A.; El-Badawy, A.; El-Badri, N. Mesenchymal stem cells growth and proliferation enhancement using PLA vs. PCL based nanofibrous scaffolds. Int. J. Biol. Macromol. 2016, 93, 9–19. [Google Scholar] [CrossRef]
- Chiu, Y.C.; Fang, H.Y.; Hsu, T.T.; Lin, C.Y.; Shie, M.Y. The Characteristics of Mineral Trioxide Aggregate/Polycaprolactone 3-dimensional Scaffold with Osteogenesis Properties for Tissue Regeneration. J. Endod. 2017, 43, 923–929. [Google Scholar] [CrossRef] [PubMed]
- Cho, Y.S.; Hong, M.W.; Quan, M.; Kim, S.Y.; Lee, S.H.; Lee, S.J.; Kim, Y.Y.; Cho, Y.S. Assessments for bone regeneration using the polycaprolactone SLUP (salt-leaching using powder) scaffold. J. Biomed. Mater. Res. Part A 2017, 105, 3432–3444. [Google Scholar] [CrossRef] [PubMed]
- Fabbri, P.; Cannillo, V.; Sola, A.; Dorigato, A.; Chiellini, F. Highly porous polycaprolactone-45S5 Bioglass® scaffolds for bone tissue engineering. Comp. Sci. Technol. 2010, 70, 1869–1878. [Google Scholar] [CrossRef]
- Gandolfi, M.G.; Zamparini, F.; Degli Esposti, M.; Chiellini, F.; Aparicio, C.; Fava, F.; Fabbri, P.; Taddei, P.; Prati, C. Polylactic acid-based porous scaffolds doped with calcium silicate and dicalcium phosphate dihydrate designed for biomedical application. Mater. Sci. Eng. C Mater. Biological Appl. 2018, 82, 163–181. [Google Scholar] [CrossRef] [PubMed]
- Park, C.H.; Rios, H.F.; Jin, Q.; Bland, M.E.; Flanagan, C.L.; Hollister, S.J.; Giannobile, W.V. Biomimetic hybrid scaffolds for engineering human tooth-ligament interfaces. Biomaterials 2010, 31, 5945–5952. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wongsupa, N.; Nuntanaranont, T.; Kamolmattayakul, S.; Thuaksuban, N. Assessment of bone regeneration of a tissue-engineered bone complex using human dental pulp stem cells/poly(ε-caprolactone)-biphasic calcium phosphate scaffold constructs in rabbit calvarial defects. J. Mater. Sci. Mater. Med. 2017, 28, 77. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.H.; Hsu, T.T.; Huang, T.H.; Lin, C.Y.; Shie, M.Y. Fabrication and characterization of polycaprolactone and tricalcium phosphate composites for tissue engineering applications. J Dental Sci. 2017, 12, 33–43. [Google Scholar] [CrossRef]
- Boccaccini, A.R.; Gough, J. Tissue Engineering Using Ceramics and Polymers; CRC Press: Boca Raton, FL, USA, 2007; Volume 15, pp. 320–327. [Google Scholar]
- Janik, H.; Marzec, M. A review: fabrication of porous polyurethane scaffolds. Mater. Sci. Eng. C Mater. Biolological Appl. 2015, 48, 586–591. [Google Scholar] [CrossRef]
- Dutta, R.C.; Dutta, A.K. 3D Cell Culture: Fundamentals and Applications in Tissue Engineering and Regenerative Medicine; CRC Press: Boca Raton, FL, USA, 2018; Volume 3, pp. 160–168. [Google Scholar]
- Mullender, M.G.; Tan, S.D.; Vico, L.; Alexandre, C.; Klein-Nulend, J. Differences in osteocyte density and bone histomorphometry between men and women and between healthy and osteoporotic subjects. Calcified Tissue Int. 2005, 77, 291–296. [Google Scholar] [CrossRef]
- Rehman, M.T.; Hoyland, J.A.; Denton, J.; Freemont, A.J. Age related histomorphometric changes in bone in normal British men and women. J. Clin. Pathol. 1994, 47, 529–534. [Google Scholar] [CrossRef]
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tatullo, M.; Spagnuolo, G.; Codispoti, B.; Zamparini, F.; Zhang, A.; Esposti, M.D.; Aparicio, C.; Rengo, C.; Nuzzolese, M.; Manzoli, L.; et al. PLA-Based Mineral-Doped Scaffolds Seeded with Human Periapical Cyst-Derived MSCs: A Promising Tool for Regenerative Healing in Dentistry. Materials 2019, 12, 597. https://doi.org/10.3390/ma12040597
Tatullo M, Spagnuolo G, Codispoti B, Zamparini F, Zhang A, Esposti MD, Aparicio C, Rengo C, Nuzzolese M, Manzoli L, et al. PLA-Based Mineral-Doped Scaffolds Seeded with Human Periapical Cyst-Derived MSCs: A Promising Tool for Regenerative Healing in Dentistry. Materials. 2019; 12(4):597. https://doi.org/10.3390/ma12040597
Chicago/Turabian StyleTatullo, Marco, Gianrico Spagnuolo, Bruna Codispoti, Fausto Zamparini, Anqi Zhang, Micaela Degli Esposti, Conrado Aparicio, Carlo Rengo, Manuel Nuzzolese, Lucia Manzoli, and et al. 2019. "PLA-Based Mineral-Doped Scaffolds Seeded with Human Periapical Cyst-Derived MSCs: A Promising Tool for Regenerative Healing in Dentistry" Materials 12, no. 4: 597. https://doi.org/10.3390/ma12040597
APA StyleTatullo, M., Spagnuolo, G., Codispoti, B., Zamparini, F., Zhang, A., Esposti, M. D., Aparicio, C., Rengo, C., Nuzzolese, M., Manzoli, L., Fava, F., Prati, C., Fabbri, P., & Gandolfi, M. G. (2019). PLA-Based Mineral-Doped Scaffolds Seeded with Human Periapical Cyst-Derived MSCs: A Promising Tool for Regenerative Healing in Dentistry. Materials, 12(4), 597. https://doi.org/10.3390/ma12040597