The Effect of Ultraviolet Photofunctionalization on a Titanium Dental Implant with Machined Surface: An In Vitro and In Vivo Study
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ti Samples, Surface Analysis, and UV Treatment
2.1.1. Preparation of the Ti Disc and Implant
2.1.2. Surface Analysis
2.1.3. UV Light Treatment
2.2. In Vitro Experiment
2.2.1. Cell Culture
2.2.2. Cell Attachment
2.2.3. Cell Proliferation
2.2.4. Cell Differentiation
2.3. In Vivo Experiment
2.3.1. Animals
2.3.2. Surgical Procedure
2.3.3. Sacrifice and Microcomputed Tomography (Micro-CT)
2.3.4. Histological Preparation and Histomorphometric Measurement
2.4. Statistical Analysis
3. Results
3.1. Surface Characteristics
3.2. In Vitro Test
3.2.1. Cell Attachment
3.2.2. Cell Proliferation
3.2.3. Quantitative Assessment of the Osteogenic Markers
3.3. In Vivo Test
3.3.1. Histomorphometry
3.3.2. Micro-CT
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Henry, P.J. Oral implant restoration for enhanced oral function. Clin. Exp. Pharmacol. Physiol. 2005, 32, 123–127. [Google Scholar] [CrossRef] [PubMed]
- Srinivasan, M.; Meyer, S.; Mombelli, A.; Müller, F. Dental implants in the elderly population: A systematic review and meta-analysis. Clin. Oral Implant. Res. 2017, 28, 920–930. [Google Scholar] [CrossRef] [PubMed]
- De Angelis, F.; Papi, P.; Mencio, F.; Rosella, D.; Di Carlo, S.; Pompa, G. Implant survival and success rates in patients with risk factors: Results from a long-term retrospective study with a 10 to 18 years follow-up. Eur. Rev. Med. Pharmacol. Sci. 2017, 21, 433–437. [Google Scholar] [PubMed]
- Albrektsson, T.; Branemark, P.I.; Hansson, H.A.; Lindstrom, J. Osseointegrated titanium implants. Requirements for ensuring a long-lasting, direct bone-to-implant anchorage in man. Acta Orthop. Scand. 1981, 52, 155–170. [Google Scholar] [CrossRef]
- Gallucci, G.O.; Hamilton, A.; Zhou, W.; Buser, D.; Chen, S. Implant placement and loading protocols in partially edentulous patients: A systematic review. Clin. Oral Implant. Res. 2018, 29, 106–134. [Google Scholar] [CrossRef] [Green Version]
- Chrcanovic, B.R.; Kisch, J.; Albrektsson, T.; Wennerberg, A. Factors Influencing Early Dental Implant Failures. J. Dent. Res. 2016, 95, 995–1002. [Google Scholar] [CrossRef] [PubMed]
- Manzano, G.; Montero, J.; Martin-Vallejo, J.; Del Fabbro, M.; Bravo, M.; Testori, T. Risk Factors in Early Implant Failure: A Meta-Analysis. Implant Dent. 2016, 25, 272–280. [Google Scholar] [CrossRef] [PubMed]
- Diz, P.; Scully, C.; Sanz, M. Dental implants in the medically compromised patient. J. Dent. 2013, 41, 195–206. [Google Scholar] [CrossRef]
- Chrcanovic, B.R.; Albrektsson, T.; Wennerberg, A. Bone Quality and Quantity and Dental Implant Failure: A Systematic Review and Meta-analysis. Int. J. Prosthodont. 2017, 30, 219–237. [Google Scholar] [CrossRef]
- Neves, J.; de Araujo Nobre, M.; Oliveira, P.; Martins Dos Santos, J.; Malo, P. Risk Factors for Implant Failure and Peri-Implant Pathology in Systemic Compromised Patients. J. Prosthodont. 2018, 27, 409–415. [Google Scholar] [CrossRef]
- Albrektsson, T.; Wennerberg, A. Oral implant surfaces: Part 1—Review focusing on topographic and chemical properties of different surfaces and in vivo responses to them. Int. J. Prosthodont. 2004, 17, 536–543. [Google Scholar] [PubMed]
- Berglundh, T.; Gotfredsen, K.; Zitzmann, N.U.; Lang, N.P.; Lindhe, J. Spontaneous progression of ligature induced peri-implantitis at implants with different surface roughness: An experimental study in dogs. Clin. Oral Implant. Res. 2007, 18, 655–661. [Google Scholar] [CrossRef] [PubMed]
- Albouy, J.P.; Abrahamsson, I.; Persson, L.G.; Berglundh, T. Spontaneous progression of peri-implantitis at different types of implants. An experimental study in dogs. I: Clinical and radiographic observations. Clin. Oral Implant. Res. 2008, 19, 997–1002. [Google Scholar] [CrossRef] [PubMed]
- Rasmusson, L.; Kahnberg, K.E.; Tan, A. Effects of implant design and surface on bone regeneration and implant stability: An experimental study in the dog mandible. Clin. Implant Dent. Relat. Res. 2001, 3, 2–8. [Google Scholar] [CrossRef] [PubMed]
- Wennerberg, A.; Albrektsson, T. Effects of titanium surface topography on bone integration: A systematic review. Clin. Oral Implant. Res. 2009, 20, 172–184. [Google Scholar] [CrossRef] [PubMed]
- Feller, L.; Jadwat, Y.; Khammissa, R.A.; Meyerov, R.; Schechter, I.; Lemmer, J. Cellular responses evoked by different surface characteristics of intraosseous titanium implants. Biomed. Res. Int. 2015, 2015, 171945. [Google Scholar] [CrossRef]
- Albouy, J.P.; Abrahamsson, I.; Berglundh, T. Spontaneous progression of experimental peri-implantitis at implants with different surface characteristics: An experimental study in dogs. J. Clin. Periodontol. 2012, 39, 182–187. [Google Scholar] [CrossRef]
- Aita, H.; Hori, N.; Takeuchi, M.; Suzuki, T.; Yamada, M.; Anpo, M.; Ogawa, T. The effect of ultraviolet functionalization of titanium on integration with bone. Biomaterials 2009, 30, 1015–1025. [Google Scholar] [CrossRef]
- Att, W.; Hori, N.; Iwasa, F.; Yamada, M.; Ueno, T.; Ogawa, T. The effect of UV-photofunctionalization on the time-related bioactivity of titanium and chromium-cobalt alloys. Biomaterials 2009, 30, 4268–4276. [Google Scholar] [CrossRef]
- Ueno, T.; Yamada, M.; Suzuki, T.; Minamikawa, H.; Sato, N.; Hori, N.; Takeuchi, K.; Hattori, M.; Ogawa, T. Enhancement of bone-titanium integration profile with UV-photofunctionalized titanium in a gap healing model. Biomaterials 2010, 31, 1546–1557. [Google Scholar] [CrossRef]
- Keleher, J.; Bashant, J.; Heldt, N.; Johnson, L.; Li, Y. Photo-catalytic preparation of silver-coated TiO2 particles for antibacterial applications. World J. Microbiol. Biotechnol. 2002, 18, 133–139. [Google Scholar] [CrossRef]
- Nakashima, T.; Ohko, Y.; Kubota, Y.; Fujishima, A. Photocatalytic decomposition of estrogens in aquatic environment by reciprocating immersion of TiO2-modified polytetrafluoroethylene mesh sheets. J. Photochem. Photobiol. A Chem. 2003, 160, 115–120. [Google Scholar] [CrossRef]
- Wang, R.; Hashimoto, K.; Fujishima, A.; Chikuni, M.; Kojima, E.; Kitamura, A.; Shimohigoshi, M.; Watanabe, T. Light-induced amphiphilic surfaces. Nature 1997, 388, 431. [Google Scholar] [CrossRef]
- Chomczynski, P.; Mackey, K. Short technical reports. Modification of the TRI reagent procedure for isolation of RNA from polysaccharide-and proteoglycan-rich sources. Biotechniques 1995, 19, 942–945. [Google Scholar] [PubMed]
- Donath, K.; Breuner, G. A method for the study of undecalcified bones and teeth with attached soft tissues * The Säge-Schliff (sawing and grinding) Technique. J. Oral Pathol. 1982, 11, 318–326. [Google Scholar] [CrossRef]
- Park, K.H.; Koak, J.Y.; Kim, S.K.; Han, C.H.; Heo, S.J. The effect of ultraviolet-C irradiation via a bactericidal ultraviolet sterilizer on an anodized titanium implant: A study in rabbits. Int. J. Oral Maxillofac. Implant. 2013, 28, 57–66. [Google Scholar] [CrossRef] [PubMed]
- Pyo, S.W.; Park, Y.B.; Moon, H.S.; Lee, J.H.; Ogawa, T. Photofunctionalization enhances bone-implant contact, dynamics of interfacial osteogenesis, marginal bone seal, and removal torque value of implants: A dog jawbone study. Implant Dent. 2013, 22, 666–675. [Google Scholar] [CrossRef] [PubMed]
- Hirota, M.; Ozawa, T.; Iwai, T.; Ogawa, T.; Tohnai, I. Effect of Photofunctionalization on Early Implant Failure. Int. J. Oral Maxillofac. Implant. 2018, 33, 1098–1102. [Google Scholar] [CrossRef]
- Soltanzadeh, P.; Ghassemi, A.; Ishijima, M.; Tanaka, M.; Park, W.; Iwasaki, C.; Hirota, M.; Ogawa, T. Success rate and strength of osseointegration of immediately loaded UV-photofunctionalized implants in a rat model. J. Prosthet. Dent. 2017, 118, 357–362. [Google Scholar] [CrossRef]
- Kitajima, H.; Ogawa, T. The Use of Photofunctionalized Implants for Low or Extremely Low Primary Stability Cases. . Int. J. Oral Maxillofac. Implant. 2016, 31, 439–447. [Google Scholar] [CrossRef]
- Ishijima, M.; Ghassemi, A.; Soltanzadeh, P.; Tanaka, M.; Nakhaei, K.; Park, W.; Hirota, M.; Tsukimura, N.; Ogawa, T. Effect of UV Photofunctionalization on Osseointegration in Aged Rats. Implant Dent. 2016, 25, 744–750. [Google Scholar] [CrossRef] [PubMed]
- Roy, M.; Pompella, A.; Kubacki, J.; Szade, J.; Roy, R.A.; Hedzelek, W. Photofunctionalization of Titanium: An Alternative Explanation of Its Chemical-Physical Mechanism. PLoS ONE 2016, 11, e0157481. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Komasa, S.; Mashimo, C.; Sekino, T.; Okazaki, J. Effect of ultraviolet treatment on bacterial attachment and osteogenic activity to alkali-treated titanium with nanonetwork structures. Int. J. Nanomed. 2017, 12, 4633–4646. [Google Scholar] [CrossRef] [PubMed]
- Bowers, K.T.; Keller, J.C.; Randolph, B.A.; Wick, D.G.; Michaels, C.M. Optimization of surface micromorphology for enhanced osteoblast responses in vitro. Int. J. Oral Maxillofac. Implant. 1992, 7, 302–310. [Google Scholar] [CrossRef]
- Keller, J.C.; Schneider, G.B.; Stanford, C.M.; Kellogg, B. Effects of implant microtopography on osteoblast cell attachment. Implant Dent. 2003, 12, 175–181. [Google Scholar] [CrossRef] [PubMed]
- De Avila, E.D.; Lima, B.P.; Sekiya, T.; Torii, Y.; Ogawa, T.; Shi, W.; Lux, R. Effect of UV-photofunctionalization on oral bacterial attachment and biofilm formation to titanium implant material. Biomaterials 2015, 67, 84–92. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sawase, T.; Jimbo, R.; Baba, K.; Shibata, Y.; Ikeda, T.; Atsuta, M. Photo-induced hydrophilicity enhances initial cell behavior and early bone apposition. Clin. Oral Implant. Res. 2008, 19, 491–496. [Google Scholar] [CrossRef] [PubMed]
- Buser, D.; Broggini, N.; Wieland, M.; Schenk, R.; Denzer, A.; Cochran, D.L.; Hoffmann, B.; Lussi, A.; Steinemann, S. Enhanced bone apposition to a chemically modified SLA titanium surface. J. Dent. Res. 2004, 83, 529–533. [Google Scholar] [CrossRef] [PubMed]
- Ehlers, H.; Jacobs, F.; Kloppers, H.; Postma, T. The influence of storage media on early osseointegration of titanium implants. J. Dent. Implant 2016, 6, 3–12. [Google Scholar] [CrossRef]
- Wennerberg, A.; Galli, S.; Albrektsson, T. Current knowledge about the hydrophilic and nanostructured SLActive surface. Clin. Cosmet. Investig. Dent. 2011, 3, 59–67. [Google Scholar] [CrossRef]
- Ghassemi, A.; Ishijima, M.; Hasegawa, M.; Mohammadzadeh Rezaei, N.; Nakhaei, K.; Sekiya, T.; Torii, Y.; Hirota, M.; Park, W.; Miley, D.D.; et al. Biological and Physicochemical Characteristics of 2 Different Hydrophilic Surfaces Created by Saline-Storage and Ultraviolet Treatment. Implant Dent. 2018, 27, 405–414. [Google Scholar] [CrossRef] [PubMed]
- Kasemo, B.; Lausmaa, J. Biomaterial and implant surfaces: On the role of cleanliness, contamination, and preparation procedures. J. Biomed. Mater. Res. 1988, 22, 145–158. [Google Scholar] [CrossRef] [PubMed]
- Serro, A.; Saramago, B. Influence of sterilization on the mineralization of titanium implants induced by incubation in various biological model fluids. Biomaterials 2003, 24, 4749–4760. [Google Scholar] [CrossRef]
- Choi, S.H.; Jeong, W.S.; Cha, J.Y.; Lee, J.H.; Lee, K.J.; Yu, H.S.; Choi, E.H.; Kim, K.M.; Hwang, C.J. Overcoming the biological aging of titanium using a wet storage method after ultraviolet treatment. Sci. Rep. 2017, 7, 3833. [Google Scholar] [CrossRef] [PubMed]
- Flanagan, D. Photofunctionalization of Dental Implant. J. Oral Implantol. 2016, 42, 445–450. [Google Scholar] [CrossRef] [PubMed]
- Shayganpour, A.; Rebaudi, A.; Cortella, P.; Diaspro, A.; Salerno, M. Electrochemical coating of dental implants with anodic porous titania for enhanced osteointegration. Beilstein J. Nanotechnol. 2015, 6, 2183–2192. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
Col 1 | GCTCCTCTTAGGGGCCACT | CCACGTCTCACCATTGGGG |
Alp 2 | GGCTACATTGGTCTTGAGCTTTT | CCAACTCTTTTGTGCCAGAGA |
Ocn 3 | CTGACAAAGCCTTCATGTCCAA | GCGCCGGAGTCTGTTCACTA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, J.-B.; Jo, Y.-H.; Choi, J.-Y.; Seol, Y.-J.; Lee, Y.-M.; Ku, Y.; Rhyu, I.-C.; Yeo, I.-S.L. The Effect of Ultraviolet Photofunctionalization on a Titanium Dental Implant with Machined Surface: An In Vitro and In Vivo Study. Materials 2019, 12, 2078. https://doi.org/10.3390/ma12132078
Lee J-B, Jo Y-H, Choi J-Y, Seol Y-J, Lee Y-M, Ku Y, Rhyu I-C, Yeo I-SL. The Effect of Ultraviolet Photofunctionalization on a Titanium Dental Implant with Machined Surface: An In Vitro and In Vivo Study. Materials. 2019; 12(13):2078. https://doi.org/10.3390/ma12132078
Chicago/Turabian StyleLee, Jun-Beom, Ye-Hyeon Jo, Jung-Yoo Choi, Yang-Jo Seol, Yong-Moo Lee, Young Ku, In-Chul Rhyu, and In-Sung Luke Yeo. 2019. "The Effect of Ultraviolet Photofunctionalization on a Titanium Dental Implant with Machined Surface: An In Vitro and In Vivo Study" Materials 12, no. 13: 2078. https://doi.org/10.3390/ma12132078
APA StyleLee, J.-B., Jo, Y.-H., Choi, J.-Y., Seol, Y.-J., Lee, Y.-M., Ku, Y., Rhyu, I.-C., & Yeo, I.-S. L. (2019). The Effect of Ultraviolet Photofunctionalization on a Titanium Dental Implant with Machined Surface: An In Vitro and In Vivo Study. Materials, 12(13), 2078. https://doi.org/10.3390/ma12132078