Molecular Detection and Epidemiological Features of Selected Bacterial, Viral, and Parasitic Enteropathogens in Stool Specimens from Children with Acute Diarrhea in Thi-Qar Governorate, Iraq
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Setting and Design
2.2. Stool Samples Processing and DNA Extraction
2.3. Molecular Screening of Enteropathogens
2.3.1. Bacteria
2.3.2. Viruses
2.3.3. Parasites
2.4. Statistical Analysis
2.5. Ethics and Consent Approval
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- United Nations International Children’s Emergency Fund. Diarrhoeal Diseases. UNICEF Data: Monitoring the Situation of Children and Women. Available online: https://data.unicef.org/topic/child-health/diarrhoeal-disease/ (accessed on 17 March 2018).
- Kelly, P. Infectious diarrhoea. Medicine 2015, 43, 253–258. [Google Scholar] [CrossRef]
- Khoury, H.; Ogilvie, I.; El Khoury, A.C.; Duan, Y.; Goetghebeur, M.M. Burden of rotavirus gastroenteritis in the Middle Eastern and North African pediatric population. BMC Infect. Dis. 2011, 11, 9. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, S.; Klena, J.; Albana, A.; Alhamdani, F.; Oskoff, J.; Soliman, M.; Heylen, E.; Teleb, N.; Husain, T.; Matthijnssens, J. Characterization of human rotaviruses circulating in Iraq in 2008: Atypical G8 and high prevalence of P [6] strains. Infect. Genet. Evol. 2013, 16, 212–217. [Google Scholar] [CrossRef] [PubMed]
- Cruz, J.R.; Caceres, P.; Cano, F.; Flores, J.; Bartlett, A.; Torun, B. Adenovirus types 40 and 41 and rotaviruses associated with diarrhea in children from Guatemala. J. Clin. Microbiol. 1990, 28, 1780–1784. [Google Scholar]
- Shimizu, H.; Phan, T.G.; Nishimura, S.; Okitsu, S.; Maneekarn, N.; Ushijima, H. An outbreak of adenovirus serotype 41 infection in infants and children with acute gastroenteritis in Maizuru City, Japan. Infect. Genet. Evol. 2007, 7, 279–284. [Google Scholar] [CrossRef]
- Dey, R.S.; Ghosh, S.; Chawla-Sarkar, M.; Panchalingam, S.; Nataro, J.P.; Sur, D.; Manna, B.; Ramamurthy, T. Circulation of a novel pattern of infections by enteric adenovirus serotype 41 among children below 5 years of age in Kolkata, India. J. Clin. Microbiol. 2011, 49, 500–505. [Google Scholar] [CrossRef] [PubMed]
- Fletcher, S.; Van Hal, S.; Andresen, D.; McLaws, M.L.; Stark, D.; Harkness, J.; Ellis, J. Gastrointestinal pathogen distribution in symptomatic children in Sydney, Australia. J. Epidemiol. Glob. Health 2013, 3, 11. [Google Scholar] [CrossRef]
- Bennett, S.; Gunson, R.N. The development of a multiplex real-time RT-PCR for the detection of adenovirus, astrovirus, rotavirus and sapovirus from stool samples. J. Virol. Methods 2017, 242, 30–34. [Google Scholar] [CrossRef]
- Cherry, F. Textbook of Pediatric Infectious Diseases, 4th ed.; W.B Saunders Company: Philadelphia, PA, USA, 1998. [Google Scholar]
- Majowicz, S.E.; Musto, J.; Scallan, E.; Angulo, F.J.; Kirk, M.; O’Brien, S.J.; Jones, T.F.; Fazil, A.; Hoekstra, R.M. The global burden of nontyphoidal Salmonella gastroenteritis. Clin. Infect. Dis. 2010, 50, 882–889. [Google Scholar] [CrossRef]
- Kovanen, S.M.; Kivisto, R.I.; Rossi, M.; Schott, T.; Karkkainen, U.M.; Tuuminen, T.; Uksila, J.; Rautelin, H.; Hanninen, M.L. Multilocus sequence typing (MLST) and whole-genome MLST of Campylobacter jejuni isolates from human infections in three districts during a seasonal peak in Finland. J. Clin. Microbiol. 2014, 52, 4147–4154. [Google Scholar] [CrossRef]
- Graham, S.M. Salmonellosis in children in developing and developed countries and populations. Curr. Opin. Infect. Dis. 2002, 15, 507–512. [Google Scholar] [CrossRef]
- Mukerji, S.; O’Dea, M.; Barton, M.; Kirkwood, R.; Lee, T.; Abraham, S. Development and transmission of antimicrobial resistance among Gram-negative bacteria in animals and their public health impact. Essays Biochem. 2017, 61, 23–35. [Google Scholar] [CrossRef]
- Cheun, H.I.; Cho, S.H.; Lee, J.H.; Lim, Y.Y.; Jeon, J.H.; Yu, J.R.; Kim, T.S.; Lee, W.J.; Cho, S.H.; Lee, D.Y.; et al. Infection status of hospitalized diarrhea patients with gastrointestinal protozoa, bacteria, and viruses in the Republic of Korea. Korean J. Parasitol. 2010, 48, 113. [Google Scholar] [CrossRef]
- Hegazi, M.A.; Patel, T.A.; El-Deek, B.S. Prevalence and characters of Entamoeba histolytica infection in Saudi infants and children admitted with diarrhea at 2 main hospitals at South Jeddah: A re-emerging serious infection with unusual presentation. Braz. J. Infect. Dis. 2013, 17, 32–40. [Google Scholar] [CrossRef]
- Ghenghesh, K.S.; Ghanghish, K.; BenDarif, E.T.; Shembesh, K.; Franka, E. Prevalence of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium spp. in Libya: 2000–2015. Libyan J. Med. 2016, 11, 32088. [Google Scholar] [CrossRef]
- Harb, A.; O’Dea, M.; Hanan, Z.K.; Abraham, S.; Habib, I. Prevalence, risk factors and antimicrobial resistance of Salmonella diarrhoeal infection among children in Thi-Qar Governorate, Iraq. Epidemiol. Infect. 2017, 145, 3486–3496. [Google Scholar] [CrossRef]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef]
- Swamy, S.C.; Barnhart, H.M.; Lee, M.D.; Dreesen, D.W. Virulence determinants invA and spvC in Salmonellae isolated from poultry products, wastewater, and human sources. Appl. Environ. Microbiol. 1996, 62, 3768–3771. [Google Scholar]
- Barletta, F.; Mercado, E.H.; Lluque, A.; Ruiz, J.; Cleary, T.G.; Ochoa, T.J. Multiplex Real-Time PCR for Detection of Campylobacter, Salmonella, and Shigella. J. Clin. Microbiol. 2013, 51, 2822–2829. [Google Scholar] [CrossRef]
- Yan, H.; Yagyu, F.; Okitsu, S.; Nishio, O.; Ushijima, H. Detection of norovirus (GI, GII) Sapovirus and astrovirus in fecal samples using reverse transcription single-round multiplex PCR. J. Virol. Methods 2003, 114, 37–44. [Google Scholar] [CrossRef]
- Yan, H.; Nguyen, T.A.; Phan, T.G.; Okitsu, S.; Li, Y.; Ushijima, H. Development of RT-multiplex PCR assay for detection of adenovirus and group A and C rotaviruses in diarrheal fecal specimens from children in China. Kansenshogaku Zasshi 2004, 78, 699–709. [Google Scholar] [CrossRef]
- Al-Areeqi, M.A.; Sady, H.; Al-Mekhlafi, H.M.; Anuar, T.S.; Al-Adhroey, A.H.; Atroosh, W.M.; Dawaki, S.; Elyana, F.N.; Nasr, N.A.; Ithoi, I.; et al. First molecular epidemiology of Entamoeba histolytica, E. dispar and E. moshkovskii infections in Yemen: Different species-specific associated risk factors. Trop. Med. Int. Health 2017, 22, 493–504. [Google Scholar] [CrossRef]
- Yang, R.; Jacobson, C.; Gardner, G.; Carmichael, I.; Campbell, A.J.D.; Ryan, U. Development of a quantitative PCR (qPCR) for Giardia and analysis of the prevalence, cyst shedding and genotypes of Giardia present in sheep across four states in Australia. Exp. Parasitol. 2014, 137, 46–52. [Google Scholar] [CrossRef]
- Guha-Sapir, D.; Burkle, F.M. Health trends in Iraq with a focus on children: No cause for optimism. J. Trop. Pediatr. 2014, 60, 177–178. [Google Scholar] [CrossRef][Green Version]
- Burkle, F.; Garfield, R. Civilian mortality after the 2003 invasion of Iraq. Lancet 2013, 381, 877–879. [Google Scholar] [CrossRef]
- Sethi, S.K.; Khuffash, F.A.; Al-Nakib, W. Microbial etiology of acute gastroenteritis in hospitalized children in Kuwait. Pediatr. Infect. Dis. J. 1989, 8, 593–597. [Google Scholar] [CrossRef]
- Al-Thani, A.; Baris, M.; Al-Lawati, N.; Al-Dhahry, S. Characterising the aetiology of severe acute gastroenteritis among patients visiting a hospital in Qatar using real-time polymerase chain reaction. BMC Infect. Dis. 2013, 13, 329. [Google Scholar] [CrossRef]
- El Sayed Zaki, M.; Abo El Kheir, N. Molecular study of astrovirus, adenovirus and norovirus in community acquired diarrhea in children: One Egyptian center study. Asian. Pac. J. Trop. Biomed. 2017, 7, 987–990. [Google Scholar] [CrossRef]
- Han, H.J.; Wen, H.L.; Zhao, L.; Liu, J.W.; Luo, L.M.; Zhou, C.M.; Qin, X.R.; Zhu, Y.L.; Liu, M.M.; Qi, R.; et al. Novel coronaviruses, astroviruses, adenoviruses and circoviruses in insectivorous bats from northern China. Zoonoses Public Health 2017, 64, 636–646. [Google Scholar] [CrossRef]
- Afrad, M.H.; Avzun, T.; Haque, J.; Haque, W.; Hossain, M.E.; Rahman, A.R.; Ahmed, S.; Faruque, A.S.G.; Rahman, M.Z.; Rahman, M. Detection of enteric- and non-enteric adenoviruses in gastroenteritis patients, Bangladesh, 2012–2015. J. Med. Virol. 2018, 90, 677–684. [Google Scholar] [CrossRef]
- Lekana-Douki, S.E.; Kombila-Koumavor, C.; Nkoghe, D.; Drosten, C.; Drexler, J.F.; Leroy, E.M. Molecular epidemiology of enteric viruses and genotyping of rotavirus A, adenovirus and astrovirus among children under 5 years old in Gabon. Int. J. Infect. Dis. 2015, 34, 90–95. [Google Scholar] [CrossRef]
- Alrajab, W.J.; Abdullah, B.A.; Shareef, A.Y. Salmonella responsible for infantile gastroenteritis in Mosul, Iraq. J. Trop. Med. Hyg. 1988, 91, 315–318. [Google Scholar]
- Sethi, S.K.; Khuffash, F. Bacterial and viral causes of acute diarrhoea in children in Kuwait. J. Diarrhoeal. Dis. Res. 1989, 7, 85–88. [Google Scholar]
- Prakash, K.P. Epidemiology and Antimicrobial Resistance of Enteric Pathogens in Dhahira Region, Oman. Iran. J. Public Health 2008, 37, 60–69. [Google Scholar]
- Joint Analysis Unit. Thi-Qar Governorate Profile. Iraq: United Nations. 2013. Available online: http://www.cybermanual.com/thi-qar-ir-joint-analysis-unit-jau.html?page=5 (accessed on 5 October 2013).
- Liu, J.; Platts-Mills, J.A.; Juma, J.; Kabir, F.; Nkeze, J.; Okoi, C.; Operario, D.J.; Uddin, J.; Ahmed, S.; Alonso, P.L.; et al. Use of quantitative molecular diagnostic methods to identify causes of diarrhoea in children: A reanalysis of the GEMS case-control study. Lancet 2016, 388, 1291–1301. [Google Scholar] [CrossRef]
- Lengerh, A.; Moges, F.; Unakal, C.; Anagaw, B. Prevalence, associated risk factors and antimicrobial susceptibility pattern of Campylobacter species among under five diarrheic children at Gondar University Hospital, Northwest Ethiopia. BMC Pediatr. 2013, 13, 82. [Google Scholar] [CrossRef]
- Schnee, A.E.; Petri, W.A. Campylobacter jejuni and associated immune mechanisms: Short-term effects and long-term implications for infants in low-income countries. Curr. Opin. Infect. Dis. 2017, 30, 322–328. [Google Scholar] [CrossRef]
- Akihara, S.; Phan, T.G.; Nguyen, T.A.; Hansman, G.; Okitsu, S.; Ushijima, H. Existence of multiple outbreaks of viral gastroenteritis among infants in a day care center in Japan. Arch. Virol. 2005, 150, 2061–2075. [Google Scholar] [CrossRef]
- Zheng, S.; Yu, F.; Chen, X.; Cui, D.; Cheng, Y.; Xie, G.; Yang, X.; Han, D.; Wang, Y.; Zhang, W.; et al. Enteropathogens in children less than 5 years of age with acute diarrhea: A 5-year surveillance study in the Southeast Coast of China. BMC Infect. Dis. 2016, 16, 434. [Google Scholar] [CrossRef]
- Enriquez, C.E.; Hurst, C.J.; Gerba, C.P. Survival of the enteric andenoviruses 40 and 41 in tap, sea, and waste water. Water Res. 1995, 29, 2548–2553. [Google Scholar] [CrossRef]
- Van Heerden, J.; Ehlers, M.M.; Hiem, A.; Grabow, W.O.K. Prevalence, quantification and typing of adenoviruses detected in river and treated drinking water in South Africa. J. Appl. Microbiol. 2005, 99, 234–242. [Google Scholar] [CrossRef]
- Bronowski, C.; Mustafa, K.; Goodhead, I.; James, C.E.; Nelson, C.; Lucaci, A.; Wigley, P.; Humphrey, T.J.; Williams, N.J.; Winstanley, C. Campylobacter jejuni transcriptome changes during loss of culturability in water. PLoS ONE 2017, 12, e0188936. [Google Scholar] [CrossRef]
- Amour, C.; Gratz, J.; Mduma, E.; Svensen, E.; Rogawski, E.T.; McGrath, M.; Seidman, J.C.; McCormick, B.J.J.; Shrestha, S.; Samie, A.; et al. Epidemiology and Impact of Campylobacter Infection in Children in 8 Low-Resource Settings: Results From the MAL-ED Study. Clin. Infect. Dis. 2016, 63, 1171–1179. [Google Scholar]
- Chang, Y.C.; Scaria, J.; Ibraham, M.; Doiphode, S.; Chang, Y.F.; Sultan, A.; Mohammed, H.O. Distribution and factors associated with Salmonella enterica genotypes in a diverse population of humans and animals in Qatar using multi-locus sequence typing (MLST). J. Infect. Public. Health 2016, 9, 315–323. [Google Scholar] [CrossRef]
- Nair, S.; Ashton, P.; Doumith, M.; Connell, S.; Painset, A.; Mwaigwisya, S.; Langridge, G.; de Pinna, E.; Godbole, G.; Day, M. WGS for surveillance of antimicrobial resistance: A pilot study to detect the prevalence and mechanism of resistance to azithromycin in a UK population of non-typhoidal Salmonella. J. Antimicrob. Chemother. 2016, 71, 3400–3408. [Google Scholar] [CrossRef]
- Liu, F.; Kariyawasam, S.; Jayarao, B.M.; Barrangou, R.; Gerner-Smidt, P.; Ribot, E.M.; Knabel, S.J.; Dudley, E.G. Subtyping Salmonella enterica serovar enteritidis isolates from different sources by using sequence typing based on virulence genes and clustered regularly interspaced short palindromic repeats (CRISPRs). Appl. Environ. Microbiol. 2011, 77, 4520–4526. [Google Scholar] [CrossRef]
- Liu, B.; Liu, W.; Zhu, X.; Yu, S.; Shi, X. Diversity of Salmonella isolates using serotyping and multilocus sequence typing. Food Microbiol. 2011, 28, 1182–1189. [Google Scholar] [CrossRef]
- Jassim, A.M. In-home drug storage and self-medication with antimicrobial drugs in Basrah, Iraq. Oman. Med. J. 2010, 25, 79–87. [Google Scholar] [CrossRef]
- Tajbakhsh, M.; Hendriksen, R.S.; Nochi, Z.; Zali, M.R.; Aarestrup, F.M.; Garcia-Migura, L. Antimicrobial resistance in Salmonella spp. recovered from patients admitted to six different hospitals in Tehran, Iran from 2007 to 2008. Folia Microbiol. 2012, 57, 91–97. [Google Scholar] [CrossRef]
- Zhao, X.; Yang, J.; Zhang, B.; Sun, S.; Chang, W. Characterization of Integrons and Resistance Genes in Salmonella Isolates from Farm Animals in Shandong Province, China. Front. Microbiol. 2017, 8, 1300. [Google Scholar] [CrossRef]
- Huang, S.; Chiu, C.; Chiou, C.; Yang, Y. Multidrug-resistant Salmonella enterica serovar Panama carrying class 1 integrons is invasive in Taiwanese children. J. Formos. Med. Assoc. 2013, 112, 269–275. [Google Scholar] [CrossRef]
- Randall, L.P.; Cooles, S.W.; Osborn, M.K.; Piddock, L.J.V.; Woodward, M.J. Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. J. Antimicrob. Chemother. 2004, 53, 208–216. [Google Scholar] [CrossRef]
- Robinson, A.L.; Lee, H.J.; Kwon, J.; Todd, E.; Rodriguez, F.P.; Ryu, D. Adequate hand washing and glove use are necessary to reduce cross-contamination from hands with high bacterial loads. J. Food Prot. 2016, 79, 304–408. [Google Scholar] [CrossRef]
- Humphrey, J.H.; Jones, A.D.; Manges, A.; Mangwadu, G.; Maluccio, J.A.; Mbuya, M.N.N.; Moulton, L.H.; Ntozini, R.; Prendergast, A.J.; Stoltzfus, R.J.; et al. The sanitation hygiene infant nutrition efficacy (SHINE) trial: Rationale, design, and methods. Clin. Infect. Dis. 2015, 61, S685–S702. [Google Scholar]
- Jensen, D.A.; Danyluk, M.D.; Harris, L.J.; Schaffner, D.W. Quantifying the effect of hand wash duration, soap use, ground beef debris, and drying methods on the removal of enterobacter aerogenes on hands. J. Food Prot. 2015, 78, 685–690. [Google Scholar] [CrossRef]


| Target Pathogen | Gene | Sequence (5′ to 3′) | Amplicon Size (bp) | Reference |
|---|---|---|---|---|
| Salmonella spp. | invA F invA R | TTGTTACGGCTATTTTGACCA CTGACTGCTACCTTGCTGATG | 521 | [20] |
| Campylobacter spp. | 16S rRNA F 16S rRNA R | GGATGACACTTTTCGGAGC CATTGTAGCACGTGTGTC | 812 | [21] |
| Astrovirus | PreCAP1 F 82b R | GGACTGCAAAGCAGCTTCGTG GTGAGCCACCAGCCATCCCT | 719 | [22] |
| Norovirus GI | G1SK F G1SK R | CTGCCCGAATTYGTAAATGA CCAACCCARCCATTRTACA | 330 | [22] |
| Norovirus GII | COG2 F G2SK R | CARGARBCNATGTTYAGRTGGATGAG CCRCCNGCATRHCCRTTRTACAT | 387 | [22] |
| Adenovirus | Ad1 F Ad2 R | TTCCCCATGGCICAYAACAC CCCTGGTAKCCRATRTTGTA | 482 | [23] |
| Entamoeba spp. | E-1 F E-1 R | TAAGATGCACGAGAGCGAAA GTACAAAGGGCAGGGACGTA | 439 | [24] |
| Giardia spp. | gdf F gdf R Probe | GGGCAAGTCCGACAACGA GCACATCTCCTCCAGGAAGTAGAC TCATGCGCTTCTGCCAG BHQ2 | 261 | [25] |
| Variables | Category | No. of Cases (%) |
|---|---|---|
| Gender | Male Female | 90 (58.1) 65 (41.9) |
| Age (years) | <2 years 2–5 years | 93 (60.0) 62 (40.0) |
| Mean age (months) ± SD | 22.7 (±12.7) | |
| Residence | Rural Urban | 110 (71.0) 45 (29.0) |
| Breastfeeding pattern in the first 6 months of age | Exclusively bottle-fed Exclusively breastfed Mix—breast- and bottle-fed | 60 (38.7) 64 (41.3) 31 (20.0) |
| Water source in household | Reverse osmosis water Municipal (pipe) water | 58 (37.4) 97 (62.6) |
| Domestic animals in the household | No Yes | 62 (40.0) 93 (60.0) |
| Caregiver hand washing before food preparation | No Sometimes Always | 51 (32.9) 86 (55.5) 18 (11.6) |
| Caregiver hand washing after cleaning child defecation | No Sometimes Always | 15 (9.7) 40 (25.8) 100 (64.5) |
| Caregiver hand washing before feeding the child | No Sometimes Always | 36 (23.2) 49 (31.6) 70 (45.2) |
| Enteropathogens | No. of Cases | % of Cases (95% CI) | Co-Infection (No. of Cases) | Mixed Infection (No. of Cases) |
|---|---|---|---|---|
| Salmonella spp. | 23 | 14.8 (9.6–21.4) | Adenovirus (5) Astrovirus (3) Giardia spp. + astrovirus (3) Giardia spp. (2) Norovirus GII (1) Norovirus GII + adenovirus (1) Astrovirus + adenovirus (1) | Campylobacter spp. (3) |
| Campylobacter spp. | 17 | 10.9 (6.5–16.9) | Adenovirus (7) Entamoeba spp. + adenovirus (3) Norovirus GI (2) Norovirus GI + adenovirus (2) Norovirus GII (1) | Salmonella spp. (3) |
| Astrovirus | 11 | 7.1 (3.6–12.3) | Salmonella spp.+ Giardia spp. (3) Salmonella spp. (3) Giardia spp. (1) | Adenovirus (2) Adenovirus + norovirus GII (1) |
| Adenovirus | 53 | 34.2 (26.7–42.2) | Campylobacter spp. (7) Salmonella spp. (5) Entamoeba spp. (3) Entamoeba spp. + Campylobacter spp. (3) Salmonella spp. + Giardia spp. (3) Salmonella spp. + Campylobacter spp. (2) | Norovirus GII (4) Norovirus GI (3) Astrovirus (2) Astrovirus + norovirus GII (1) |
| Norovirus GI | 5 | 3.2 (1.0–7.3) | Campylobacter spp. (2) | Adenovirus (3) |
| Norovirus GII | 10 | 6.4 (3.1–11.5) | Salmonella spp. (1) Campylobacter spp. (1) | Adenovirus (4) |
| Entamoeba spp. | 21 | 13.5 (8.5–19.9) | Adenovirus + Campylobacter spp. (3) Adenovirus (3) Astrovirus + adenovirus (1) | None |
| Giardia spp. | 11 | 7.1 (3.6–12.3) | Astrovirus + Salmonella spp. (3) Adenovirus + Salmonella spp. (3) Salmonella spp. (2) Campylobacter spp. (1) Astrovirus (1) | None |
| Serovars | MLST | Resistance Genes | Resistance Phenotypes a |
|---|---|---|---|
| S. typhimurium | ST-49 | tetB | TET, S |
| S. typhimurium | ST-49 | tetB | TET, S |
| S. typhimurium | ST-49 | tetB | TET, ATH |
| S. typhimurium | ST-49 | tetB | TET, CTX |
| S. typhimurium | ST-49 | tetB | ATH, NA, CTX |
| S. typhimurium | ST-49 | tetB | TET, ATH, TS |
| S. typhimurium | ST-49 | tetB | TET, ATH, CTX |
| S. typhimurium | ST-49 | tetB | TET, ATH, CTX, CIP |
| S. typhimurium | ST-49 | tetB | NA, ATH, CTX, TS, S |
| S. typhimurium | ST-3020 | tetG, sul1, aadA2, blaCARB-2 | TET, ATH, CTX, CIP, TS, S |
| S. typhimurium | ST-49 | tetA, sul1, aadA7, aph(3’)-Ic, aac(3)-Id | TET, ATH, CTX, GM |
| S. typhimurium | ST-49 | tetB, strB, aph(3’)-Ic | TET, ATH, NA, S |
| S. typhimurium | ST-49 | tetB, strB, strA, aph(3’)-Ic | TET, ATH, CTX, CIP, TS |
| S. typhimurium | ST-3020 | tetG, aadA2, sul1, blaCARB-2, floR | TET, ATH, CIP, CRO, TS, NA, GM |
| S. typhimurium | ST-49 | tetB, aadA7, sul1, aph(3’)-Ia, blaCARB-2 | TET, TS, NA, AMP, CRO, ATH, CIP |
| S. hadar | ST-198 | tetA, aadA7, sul1, aph(3’)-Ic, aac(3)-Id | NA, ATH, CTX, TS, S |
| S. hadar | ST-198 | tetA, aadA7, sul, aph(3’)-Ia, aac(3)-Id | TET, CRO, CIP, TS, GM |
| S. hadar | ST-198 | tetG, aadA2, sul, aph(3’)-Ia, blaCARB-2, dfrA14, erm(42) | TET, ATH, CIP, NA, GM |
| S. hato | ST-52 | tetA, aadA1, sul1, aph(3’)-Ic | TET, CRO, S, GM |
| S. hato | ST-52 | tetA, strB, strA, aph(3’)-Ic, mphA | ATH, NA, CTX, TS |
| S. hato | ST-52 | tetA, strB, strA, aph(3’)-Ic, mphA | ATH, CRO, S, NA, TS |
| S. muenchen | ST-1825 | tetA, aadA1, sul1, dfrA14 | TET, ATH, CIP, S, TS, NA |
| S. muenchen | ST-1825 | tetA, aadA7, sul1, aph(3’)-Ia, aac(3)-Id | TET, ATH, CIP, S, NA, CTX |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Harb, A.; Abraham, S.; Rusdi, B.; Laird, T.; O’Dea, M.; Habib, I. Molecular Detection and Epidemiological Features of Selected Bacterial, Viral, and Parasitic Enteropathogens in Stool Specimens from Children with Acute Diarrhea in Thi-Qar Governorate, Iraq. Int. J. Environ. Res. Public Health 2019, 16, 1573. https://doi.org/10.3390/ijerph16091573
Harb A, Abraham S, Rusdi B, Laird T, O’Dea M, Habib I. Molecular Detection and Epidemiological Features of Selected Bacterial, Viral, and Parasitic Enteropathogens in Stool Specimens from Children with Acute Diarrhea in Thi-Qar Governorate, Iraq. International Journal of Environmental Research and Public Health. 2019; 16(9):1573. https://doi.org/10.3390/ijerph16091573
Chicago/Turabian StyleHarb, Ali, Sam Abraham, Bertha Rusdi, Tanya Laird, Mark O’Dea, and Ihab Habib. 2019. "Molecular Detection and Epidemiological Features of Selected Bacterial, Viral, and Parasitic Enteropathogens in Stool Specimens from Children with Acute Diarrhea in Thi-Qar Governorate, Iraq" International Journal of Environmental Research and Public Health 16, no. 9: 1573. https://doi.org/10.3390/ijerph16091573
APA StyleHarb, A., Abraham, S., Rusdi, B., Laird, T., O’Dea, M., & Habib, I. (2019). Molecular Detection and Epidemiological Features of Selected Bacterial, Viral, and Parasitic Enteropathogens in Stool Specimens from Children with Acute Diarrhea in Thi-Qar Governorate, Iraq. International Journal of Environmental Research and Public Health, 16(9), 1573. https://doi.org/10.3390/ijerph16091573

