Bioaerosols Play a Major Role in the Nasopharyngeal Microbiota Content in Agricultural Environment
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling Sites in Pig Buildings
2.2. WWTP Sampling Sites (As Non-Agricultural Environment Controls)
2.3. Air Sampling
2.4. Nasopharynx Sampling
2.5. Pre-DNA Extraction Treatment
2.6. DNA Extraction
2.7. MiSeq Illumina® Sequencing
2.8. Bioinformatics
2.9. Quantification of Human Pathogens and Resistance Genes in the Nasopharynx
2.10. Statistical Analyses
2.11. Experimental Controls
3. Results
3.1. Summary of Data Processing
3.2. Alpha Diversity
3.2.1. Rarefaction Curves (Number of Observed OTUs)
3.2.2. Richness Estimates and Diversity Measures
3.2.3. Beta Diversity
3.3. Taxonomy Identification
3.3.1. Phylum Profiles
3.3.2. Class Profiles
3.3.3. Differential Abundance of Species
3.3.4. Non-Agricultural Low-Dust Industrial Control Environment
3.3.5. Human Pathogens and Resistance Genes in the Nasopharynxes of Pig Farmers and Non-Exposed Controls
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Després, V.R.; Huffman, J.A.; Burrows, S.M.; Hoose, C.; Safatov, A.S.; Buryak, G.; Fröhlich-Nowoisky, J.; Elbert, W.; Andreae, M.; Pöschl, U.; et al. Primary biological aerosol particles in the atmosphere: A review. Tellus B 2012, 64, 15598. [Google Scholar] [CrossRef]
- Macher, J.; Ammann, H.A.; Milton, D.K.; Burge, H.A.; Morey, P.R. (Eds.) Bioaerosols: Assessment and Control; American Conference of Governmental Industrial Hygienists (ACGIH): Cincinnati, OH, USA, 1999. [Google Scholar]
- Tuck, A. The Role of Atmospheric Aerosols in the Origin of Life. Surv. Geophys. 2002, 23, 379–409. [Google Scholar] [CrossRef]
- Brown, J.K.M.; Hovmøller, M.S. Aerial dispersal of pathogens on the global and continental scales and its impact on plant disease. Science 2002, 297, 537–541. [Google Scholar] [CrossRef] [PubMed]
- Burrows, S.M.; Butler, T.; Jöckel, P.; Tost, H.; Kerkweg, A.; Pöschl, U.; Lawrence, M.G. Bacteria in the global atmosphere-part 2: Modeling of emissions and transport between different ecosystems. Atmos. Chem. Phys. 2009, 9, 9281–9297. [Google Scholar] [CrossRef]
- Burrows, S.M.; Elbert, W.; Lawrence, M.G.; Pöschl, U. Bacteria in the global atmosphere—Part 1: Review and synthesis of literature data for different ecosystems. Atmos. Chem. Phys. 2009, 9, 9263–9280. [Google Scholar] [CrossRef]
- Womack, A.M.; Bohannan, B.J.M.; Green, J.L. Biodiversity and biogeography of the atmosphere. Philos. Trans. R. Soc. 2010, 365. [Google Scholar] [CrossRef] [PubMed]
- Nygard, K.; Werner-Johansen, O.; Ronsen, S.; Caugant, D.A.; Simonsen, O.; Kanestrom, A.; Ask, E.; Ringstad, J.; Odegard, R.; Jensen, T.; et al. An outbreak of legionnaires disease caused by long-distance spread from an industrial air scrubber in Sarpsborg, Norway. Clin. Infect. Dis. 2008, 46, 61–69. [Google Scholar] [CrossRef] [PubMed]
- Roy, C.J.; Milton, D.K. Airborne Transmission of Communicable Infection—The Elusive Pathway. Eng. J. Med. 2004, 350, 1710–1712. [Google Scholar] [CrossRef]
- Heldal, K.K.; Halstensen, A.S.; Thorn, J.; Djupesland, P.; Wouters, I.; Eduard, W.; Halstensen, T.T. Upper airway inflammation in waste handlers exposed to bioaerosols. Occup. Environ. Med. 2003, 60, 444–450. [Google Scholar] [CrossRef]
- Rawlings, B.A.; Higgins, T.S.; Han, J.K. Bacterial pathogens in the nasopharynx, nasal cavity, and osteomeatal complex during wellness and viral infection. Am. J. Rhinol. Allergy 2013, 27, 39–42. [Google Scholar] [CrossRef]
- WHO. Removing Obstacles to Healthy Development: World Health Organization Report on Infectious Diseases; WHO/CDS/99.1; WHO: Geneva, Switzerland, 1999. [Google Scholar]
- Yu, I.T.S.; Li, Y.; Wong, T.W.; Tam, W.; Chan, A.T.; Lee, J.H.W.; Leung, D.Y.C.; Ho, T. Evidence of Airborne Transmission of the Severe Acute Respiratory Syndrome Virus. N. Engl. J. Med. 2004, 350, 1731–1739. [Google Scholar] [CrossRef]
- Li, Y.; Leung, G.M.; Tang, J.W.; Yang, X.; Chao, C.Y.H.; Lin, J.Z.; Lu, J.W.; Nielsen, P.V.; Niu, J.; Qian, H.; et al. Role of ventilation in airborne transmission of infectious agents in the built environment—A multidisciplinary systematic review. Indoor Air 2007, 17, 2–18. [Google Scholar] [CrossRef]
- Eames, I.; Tang, J.W.; Li, Y.; Wilson, P. Airborne transmission of disease in hospitals. J. R. Soc. Interface 2009, 6, S697–S702. [Google Scholar] [CrossRef]
- Brodie, E.L.; DeSantis, T.Z.; Parker, J.P.; Zubietta, I.X.; Piceno, Y.M.; Andersen, G.L. Urban aerosols harbor diverse and dynamic bacterial populations. Proc. Natl. Acad. Sci. USA 2007, 104, 299–304. [Google Scholar] [CrossRef]
- Douwes, J. Bioaerosol health effects and exposure assessment: Progress and prospects. Ann. Occup. Hyg. 2003, 47, 187–200. [Google Scholar] [CrossRef] [PubMed]
- Eduard, W.; Heederik, D.; Duchaine, C.; Green, B.J. Bioaerosol exposure assessment in the workplace: The past, present and recent advances. J. Environ. Monit. 2012, 14, 334–339. [Google Scholar] [CrossRef] [PubMed]
- Heederik, D.; Von Mutius, E. Does diversity of environmental microbial exposure matter for the occurrence of allergy and asthma? J. Allergy Clin. Immunol. 2012, 130, 44–50. [Google Scholar] [CrossRef]
- O’Connor, A.M.; Auvermann, B.; Bickett-Weddle, D.; Kirkhorn, S.; Sargeant, J.M.; Ramirez, A.; Von Essen, S.J. The association between proximity to animal feeding operations and community health: A systematic review. PLoS ONE 2010, 5, e9530. [Google Scholar] [CrossRef] [PubMed]
- O’Connor, A.M.; Auvermann, B.W.; Dzikamunhenga, R.S.; Glanville, J.M.; Higgins, J.P.T.; Kirychuk, S.P.; Sargeant, J.M.; Totton, S.C.; Wood, H.; Von Essen, S.G. Updated systematic review: Associations between proximity to animal feeding operations and health of individuals in nearby communities. Syst. Rev. 2017, 6, 86. [Google Scholar] [CrossRef]
- Burge, H.A.; Rogers, C.A. Outdoor allergens. Environ. Health Perspect. 2000, 108 (Suppl. 4), 653–659. [Google Scholar]
- Bush, R.K. Indoor allergens, environmental avoidance, and allergic respiratory disease. Allergy Asthma Proc. 2008, 29, 575–579. [Google Scholar] [CrossRef] [PubMed]
- Wéry, N. Bioaerosols from composting facilities—A review. Front. Cell. Infect. Microbiol. 2014, 4, 42. [Google Scholar] [CrossRef] [PubMed]
- Bonifait, L.; Marchand, G.; Veillette, M.; M’Bareche, H.; Dubuis, M.E.; Pépin, C.; Cloutier, Y.; Bernard, Y.; Duchaine, C. Workers’ exposure to bioaerosols from three different types of composting facilities. J. Occup. Environ. Hyg. 2017, 14, 815–822. [Google Scholar] [CrossRef] [PubMed]
- Dubuis, M.E.; M’Bareche, H.; Veillette, M.; Bakhiyi, B.; Zayed, J.; Lavoie, J.; Duchaine, C. Bioaerosols concentrations in working areas in biomethanization facilities. J. Air Waste Mang. Assoc. 2017, 67, 1258–1271. [Google Scholar] [CrossRef] [PubMed]
- Mbareche, H.; Veillette, M.; Bonifait, L.; Dubuis, M.E.; Bernard, Y.; Marchand, G.; Bilodeau, G.J.; Duchaine, C. A next generation sequencing approach with a suitable bioinformatics workflow to study fungal diversity in bioaerosols released from two different types of composting plants. Sci. Total Environ. 2017, 601–602, 1306–1314. [Google Scholar] [CrossRef] [PubMed]
- Carducci, A.; Donzelli, G.; Cioni, L.; Federigi, I.; Lombardi, R.; Verani, M. Quantitative microbial risk assessment for workers exposed to bioaerosol in wastewater treatment plants aimed at the choice and setup of safety measures. Int. J. Environ. Res. Public Health 2018, 15, 1490. [Google Scholar] [CrossRef] [PubMed]
- Brisebois, E.; Veillette, M.; Dion-Dupont, V.; Lavoie, J.; Corbeil, J.; Culley, A.; Duchaine, C. Human Viral pathogens are pervasive in wastewater treatment center aerosols. J. Environ. Sci. 2018, 67, 45–53. [Google Scholar] [CrossRef] [PubMed]
- Nehmé, B.; Létourneau, V.; Foster, R.J.; Veillette, M.; Duchaine, C. Culture-Independent approach of the bacterial bioaerosol diversity in the standard swine confinement buildings, and assessment of the seasonal effect. Environ. Microbiol. 2008, 10, 665–675. [Google Scholar] [CrossRef]
- Gilbert, Y.; Duchaine, C. Bioaerosols in industrial environments: A review. Can. J. Civ. Eng. 2009, 9, 4–19. [Google Scholar] [CrossRef]
- Lanier, C.; Richard, E.; Heutte, N.; Picquet, R.; Bouchart, V.; Caron, D. Airborne moulds and mycotoxins associated with handling of corn silage and oilseed cakes in agricultural environment. Atmos. Environ. 2010, 44, 1980–1986. [Google Scholar] [CrossRef]
- Létourneau, V.; Nehmé, B.; Mériaux, A.; Daniel, M.; Cormier, Y.; Duchaine, C. Human pathogens and tetracycline-resistant bacteria in bioaerosols of swine confinement buildings and in nasal flora of hog producers. Int. J. Hyg. Environ. Health 2010, 213, 444–449. [Google Scholar] [CrossRef] [PubMed]
- Tsapko, V.G.; Chudnovets, A.J.; Sterenbogen, M.J.; Papach, V.V.; Dutckiewicz, J.; Skorska, C.; Krysinska-Traczyk, E.; Golec, M. Exposure to bioaerosols in the selected agricultural facilities of the Ukraine and Poland—A review. Ann. Agric. Environ. Med. 2011, 18, 19–27. [Google Scholar]
- Douglas, P.; Robertson, S.; Gay, R.; Hansell, A.L.; Gant, T.W. A systematic review of the public health risks of bioaerosols from intensive farming. Int. J. Hyg. Environ. Health 2018, 22, 134–173. [Google Scholar] [CrossRef] [PubMed]
- Iversen, M.; Kirychuk, S.; Drost, H.; Jacobson, L. Human health effects of dust exposure in animal confinement buildings. J. Agric. Saf. 2000, 6, 283–288. [Google Scholar] [CrossRef]
- Schiffman, S.S.; Studwell, C.E.; Landerman, L.R.; Berman, K.; Sundy, J.S. Symptomatic effects of exposure to diluted air sampled from a swine confinement atmosphere on healthy human subjects. Environ. Health Perspect. 2005, 113, 567–576. [Google Scholar] [CrossRef] [PubMed]
- Walser, S.M.; Gerstner, D.G.; Brenner, B.; Bünger, J.; Eikmann, T.; Janssen, B.; Kolb, S.; Kolk, A.; Nowalk, D.; Raulf, M.; et al. Evaluation of exposure-response relationships for health effects of microbial bioaerosols—A systematic review. Int. J. Hyg. Environ. Health 2015, 218, 577–589. [Google Scholar] [CrossRef]
- Duchaine, C.; Grimard, Y.; Cormier, Y. Influence of Building Maintenance, Environmental Factors, and Seasons on Airborne Contaminants of Swine Confinement Buildings. Am. Ind. Hyg. Assoc. 2000, 61, 56–63. [Google Scholar] [CrossRef]
- Mbareche, H.; Veillette, M.; Bilodeau, J.G.; Duchaine, C. Bioaerosol Sampler Choice Should Consider Efficiency and Ability of Samplers to Cover Microbial Diversity. Appl. Environ. Microbiol. 2018. [Google Scholar] [CrossRef]
- Mbareche, H.; Veillette, M.; Dubuis, M.E.; Bakhiyi, B.; Marchand, G.; Zayed, J.; Lavoie, J.; Bilodeau, G.J.; Duchaine, C. Fungal bioaerosols in biomethanization facilities. J. Air Waste Manag. Assoc. 2018, 68, 1198–1210. [Google Scholar] [CrossRef] [PubMed]
- Mbareche, H.; Veillette, M.; Teertstra, W.; Kegel, W.; Bilodeau, G.J.; Duchaine, C. Fungal Cells Recovery from Air Samples: A tale of Loss and Gain. Appl. Environ. Microbiol. 2019. [Google Scholar] [CrossRef]
- Mbareche, H.; Veillette, M.; Bilodeau, G.J.; Duchaine, C. Fungal aerosols at dairy farms using molecular and culture techniques. Sci. Total Environ. 2019, 653, 253–263. [Google Scholar] [CrossRef]
- Fung, A.O.; Mikhaylova, N. Analysis of Airborne biomarkers for Point-of-Care Diagnostics. J. Lab. Autom. 2014, 19, 225–247. [Google Scholar] [CrossRef] [PubMed]
- Hofmann, J.N.; Freeman, L.E.B.; Lynch, C.F.; Andreotti, G.; Thomas, K.W.; Sandler, D.P.; Savage, S.A.; Alavanja, M.C. The biomarkers of Exposure and Effect in Agriculture (BEEA) Study: Rationale, design, methods, and participant characteristics. J. Toxicol. Environ Health 2015, 78, 1318–1347. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Alcega, S.; Nasir, Z.A.; Fergusson, R.; Noël, C.; Cravo-Laureau, C.; Whitby, C.; Dumbrell, A.J.; Colbeck, I.; Tyrrel, S.; Coulon, F. Can chemical and molecular biomarkers help discriminate between industrial, rural and urban environments? Sci. Total Environ. 2018, 631–632, 1059–1069. [Google Scholar] [CrossRef] [PubMed]
- Muhammed, S.A.; Mohammed, A.W.; Wadi, A.S.; Derech, L. A comparative study on detecting bacterial flora of the nasal cavity in normal healthy workers that work in cement factory and the healthy students in Koya University. Int. J. Pharm. Biol. Sci. 2014, 9, 7–15. [Google Scholar] [CrossRef]
- Kraemer, J.G.; Ramette, A.; Aebi, S.; Oppliger, A.; Hilty, M. Influence of pig farming on the human nasal microbiota: Key role of airborne microbial communities. Appl. Environ. Microbiol. 2018, 84, e02470-17. [Google Scholar] [CrossRef]
- Yan, M.; Pamp, S.J.; Fukuyama, J.; Hwang, P.H.; Cho, D.Y.; Holmes, S.; Relman, D.A. Nasal microenvironments and interspecific interactions influence nasal microbiota complexity and S. aureus carriage. Cell. Host Microbe 2013, 14, 631–640. [Google Scholar] [CrossRef] [PubMed]
- Comeau, A.M.; Li, W.K.W.; Tremblay, J.E.; Carmack, E.C.; Lovejoy, C. Arctic Ocean Microbial Community Structure before and after the 2007 Record Sea Ice Minimum. PLoS ONE 2011, 6, e27492. [Google Scholar] [CrossRef] [PubMed]
- Schloss, P.D.; Westcott, S.L.; Ryabin, T.; Hall, J.R.; Hartmann, M.; Hollister, E.B.; Lesniewski, R.A.; Oakley, B.B.; Parks, D.H.; Robinson, C.J.; et al. Introducing mother: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 2009, 75, 7537–7541. [Google Scholar] [CrossRef] [PubMed]
- Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. VSEARCH: A versatile open source tool for metagenomics. PeerJ 2016, 4, e2584. [Google Scholar] [CrossRef] [PubMed]
- Caporaso, J.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Pena, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.C.; Haas, B.J.; Clemente, J.C.; Quince, C.; Knight, R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 2011, 27, 2194–2200. [Google Scholar] [CrossRef] [PubMed]
- Pilote, J.; Létourneau, V.; Girard, M.; Duchaine, C. Quantification of airborne dust, endotoxins, human pathogens and antibiotic and metal resistance genes in Eastern Canadian swine confinement buildings. Aerobiologia 2019. [Google Scholar] [CrossRef]
- Hawley, B.; Schaeffer, J.; Poole, J.A.; Dooley, G.P.; Reynolds, S.; Volckens, J. Differential response of human nasal and bronchial epithelial cells upon exposure to sign—Fractioned dairy dust. J. Toxicol. Environ. Health 2015, 78, 583–594. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Cheng, H.; Tao, S. Environmental and human health challenges of industrial livestock and poultry farming in China and their mitigation. Environ. Int. 2017, 107, 111–130. [Google Scholar] [CrossRef]
- Whittaker, R.H. Evolution and Measurement of Species Diversity. Taxon 1972, 21, 213–251. [Google Scholar] [CrossRef]
- Magurran, A.E.; McGill, B.J. (Eds.) Biological Diversity; Oxford University Press: Oxford, UK, 2011. [Google Scholar]
- Veech, J.A.; Crist, T.O. Diversity partitioning without statistical independence of alpha and beta. Ecology 2010, 91, 1964–1969. [Google Scholar] [CrossRef] [PubMed]
- Jost, L. Entropy and diversity. Oikos 2006, 113, 363–375. [Google Scholar] [CrossRef]
- Jost, L. Partitioning diversity into independent alpha and beta components. Ecology 2007, 88, 2427–2439. [Google Scholar] [CrossRef]
- Moreno, C.E.; Rodrìguez, P. A consistent terminology for quantifying species diversity? Oecologia 2010, 163, 279–282. [Google Scholar] [CrossRef]
- Faith, D.P.; Baker, A.M. Phylogenetic diversity (PD) and biodiversity conservation: Some bioinformatics challenges. Evol. Bioinform. Online 2006, 2, 121–128. [Google Scholar] [CrossRef]
- Lehtinen, M.J.; Hibberd, A.A.; Männikkö, S.; Yeung, N.; Kauko, T.; Forssten, S.; Lehtoranta, L.; Stahl, B.; Lyra, A.; Turner, R.B. Nasal microbiota clusters associate with inflammatory response, viral load, and symptom severity in experimental rhinovirus challenge. Sci. Rep. 2018, 8, 11411. [Google Scholar] [CrossRef] [PubMed]
- Legendre, P.; Legendre, L. Numerical Ecology, 2nd ed.; Elsevier: Amsterdam, The Netherlands, 1998. [Google Scholar]
- Kropf, S.; Heuer, H.; Grüning, M.; Smalla, K. Significance test for comparing complex microbial community fingerprints using pairwise similarity measures. J. Microbiol. Methods 2004, 57, 187–195. [Google Scholar] [CrossRef]
- McCune, B.; Grace, J.B. (Eds.) Analysis of Ecological Communities; MjM Software Design: Gleneden Beach, OR, USA, 2002. [Google Scholar]
- Paliy, O.; Shankar, V. Application of Multivariate Statistical Techniques in Microbial Ecology. Mol. Ecol. 2016, 25, 1032–1057. [Google Scholar] [CrossRef]
- Lozupone, C.A.; Hamady, M.; Kelley, S.T.; Knight, R. Quantitative and Qualitative β Diversity Measures Lead to Different Insights into Factors That Structure Microbial Communities. Appl. Environ. Microbiol. 2007, 73, 1576–1585. [Google Scholar] [CrossRef] [PubMed]
- Anderson, M.J. Permanova: A Fortran Computer Program for Permutational Multivariate Analysis of Variance; Department of Statistics, University of Auckland: Auckland, New Zealand, 2005. [Google Scholar]
- Grgic, B.; Finlay, W.H.; Heenan, A.F. Regional aerosol deposition and flow measurements in an idealized mouth and throat. J. Aerosol Sci. 2004, 35, 21–32. [Google Scholar] [CrossRef]
- Song, S.J.; Lauber, C.; Costello, E.K.; Lozupone, C.A.; Humphrey, G.; Berg-Lyons, D.; Caporaso, J.G.; Knights, D.; Clemente, J.C.; Nakielny, S.; et al. Cohabiting family members share microbiota with one another and with their dogs. Elife 2013, 2, e00458. [Google Scholar] [CrossRef]
- Misic, A.; Davis, M.F.; Tyldsley, A.S.; Hodkinson, B.P.; Tolomeo, P.; Hu, B.; Nachamkin, I.; Lautenbach, E.; Morris, D.O.; Grice, E.A. The shared microbiota of humans and companion animals as evaluated from Staphylococcus carriage sites. Microbiome 2015, 3, 2. [Google Scholar] [CrossRef]
- Camarinha-Silva, A.; Jauregui, R.; Chaves-Moreno, D.; Oxley, A.P.; Schaumburg, F.; Becker, K.; Wos-Oxley, M.L.; Pieper, D.H. Comparing the anterior nare bacterial community of two discrete human populations using Illumina amplicon sequencing. Environ. Microbiol. 2014, 16, 2939–2952. [Google Scholar] [CrossRef]
- Cheng, W.; Chen, H.; Su, C.; Yan, S. Abundance and persistence of antibiotic resistance genes in livestock farms: A comprehensive investigation in eastern China. Environ. Int. 2013, 61, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Brooks, J.P.; Adeli, A.; McLaughlin, M.R. Microbial ecology, bacterial pathogens, and antibiotic resistant genes in swine manure wastewater as influenced by three swine management systems. Water Res. 2014, 57, 96–103. [Google Scholar] [CrossRef] [PubMed]
- Arfken, A.M.; Song, B.; Sung, J.S. Comparison of airborne bacterial communities from a hog farm and spray field. J. Microbiol. Biotechnol. 2015, 25, 709–717. [Google Scholar] [CrossRef] [PubMed]
- Brazier, J.S.; Duerden, B.I.; Hall, V.; Salmon, J.E.; Hood, J.; Brett, M.M.; McLauchlin, J.; George, R.C. Isolation and identification of Clostridium spp. from infections associated with the injection of drugs: Experiences of a microbiological investigation team. J. Med. Microbiol. 2002, 5, 985–989. [Google Scholar] [CrossRef] [PubMed]
- Cassir, N.; Benamar, S.; La Scola, B. Clostridium butyricum: From beneficial to a new emerging pathogen. Clin. Microbiol. Infect. 2016, 22, 37–45. [Google Scholar] [CrossRef]
- Kedzia, A.; Kwapisz, E.; Wierzbowska, M. Incidence of anaerobic bacteria in respiratory tract infections. Pneumonol. Alergol. Pol. 2003, 71, 68–73. [Google Scholar] [PubMed]
- Bassis, C.M.; Erb-Downward, J.R.; Dickson, R.P.; Freeman, C.M.; Schmidt, T.M.; Young, V.B.; Beck, J.M.; Curtis, J.L.; Huffnagle, G.B. Analysis of the upper respiratory tract microbiotas as the source of the lung and gastric microbiotas in healthy individuals. mBio 2015. [Google Scholar] [CrossRef]
- De Steenhuijsen Piters, W.A.A.; Huijskens, E.G.W.; Wyllie, A.L.; Biesbroek, G.; van den Bergh, M.R.; Veenhoven, R.H.; Wang, X.; Trzcinski, K.; Bonten, M.J.; Rossen, J.W.; et al. Dysbiosis of upper respiratory tract microbiota in elderly pneumonia patients. ISME J. 2016, 10, 97–108. [Google Scholar] [CrossRef] [PubMed]
- Cormier, Y.; Tremblay, G.; Meriaux, A.; Brochu, G.; Lavoie, J. Airborne Microbial Contents in Two Types of Swine Confinement Buildings in Quebec. Am. Ind. Hyg. Assoc. J. 2010, 51, 304–309. [Google Scholar] [CrossRef]
- Jousimies-Somer, H.R.; Savolainen, S.; Ylikoski, J.S. Comparison of the nasal bacterial floras in two groups of healthy subjects and in patients with acute maxillary sinusitis. J. Clin. Microbiol. 1989, 27, 2736–2743. [Google Scholar]
- Vidakovics, P.M.L.; Riesbeck, K. Virulence mechanisms of Moraxella in the pathogenesis of infection. Curr. Opin. Infect. Dis. 2009, 22, 279–285. [Google Scholar] [CrossRef]
- Strachan, D.P. Hay fever, hygiene, and household size. BMJ 1989, 299, 1259–1260. [Google Scholar] [CrossRef] [PubMed]
- Stiemsma, L.T.; Reynolds, L.A.; Turvey, S.E.; Finlay, B.B. The hygiene hypothesis: Current perspectives and future therapies. Immunotargets Ther. 2015. [Google Scholar] [CrossRef]
- Bloomfield, S.F.; Rook, G.A.; Scott, E.A.; Shanahan, F.; Stanwell-Smith, R.; Turner, P. Time to abandon the hygiene hypothesis: New perspectives on allergic disease, the human microbiome, infectious disease prevention and the role of targeted hygiene. Perspect. Public Health 2016, 136, 213–224. [Google Scholar] [CrossRef] [PubMed]
- Garzoni, C.; Brugger, S.D.; Qi, W.; Wasmer, S.; Cusini, A.; Dumont, P.; Gorgievski-Hrisoho, M.; Mühlemannn, K.; Von Garnier, C.; Hilty, M. Microbial communities in the respiratory tract of patients with interstitial lung disease. Thorax 2013, 68, 1150–1160. [Google Scholar] [CrossRef]
- Mbareche, H.; Morawaska, L.; Duchaine, C. Opinion paper on the challenges and proposed avenues for a better interpretation of bioaerosol exposure measurements and impacts on health. J. Air Waste Manag. Assoc. 2019. [Google Scholar] [CrossRef] [PubMed]
- Mahdavinia, M.; Keshavarzian, A.; Tobin, M.C.; Landay, A.L.; Schleimer, R.P. A comprehensive review of the nasal microbiome in chronic rhinosinusitis (CRS). Clin. Exp. Allergy 2016, 46, 21–41. [Google Scholar] [CrossRef]
- Dickson, R.P.; Erb-Downward, J.R.; Martinez, F.J.; Huffnagle, G.B. The Microbiome and the Respiratory Tract. Annu. Rev. Physiol. 2016, 78, 481–504. [Google Scholar] [CrossRef]
- Huffnagle, G.B.; Dickson, R.P.; Lukacs, N.W. The respiratory tract microbiome and lung inflammation: A two-way street. Mucosal Immunol. 2017, 10, 299–306. [Google Scholar] [CrossRef]
- Argudin, M.A.; Lauzat, B.; Kraushaar, B.; Alba, P.; Agerso, Y.; Cavaco, L.; Butaye, P.; Porrero, M.C.; Battisti, A.; Tenhagen, B.A.; et al. Heavy metal and disinfectant resistance genes among livestock-associated methicillin-resistant Staphylococcus aureus isolates. Vet. Microbiol. 2016, 191, 88–95. [Google Scholar] [CrossRef]
- Ventola, C.L. The antibiotic resistance crisis: Part 1: Causes and threats. Pharm. Ther. 2015, 40, 277–283. [Google Scholar]
- Biswas, S.; Brunel, J.M.; Dubus, J.C.; Reynaud-Gaubert, M.; Rolain, J.M. Colistin: An update on the antibiotic of the 21st century. Expert Rev. Anti Infect. Ther. 2012, 10, 917–934. [Google Scholar] [CrossRef] [PubMed]
Primers a | Sequences 5′ to 3′ |
---|---|
First-PCR primers | Forward: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCTACGCGHNRACCTTACC-3′ |
Reverse: 5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTACGGGCRGTGWGTRCA-3′ | |
Second-PCR primers | Forward: 5′AATGATACGGCGACCACCGATCTACA[index1]ACACTCTTTCCCTACACGAC-3′ |
Reverse: 5′CAAGCAGAAGACGGCATACGAGAT[index2]GTGACTGGAGTTCAGACGTGT-3′ |
Targeted Pathogenic Agents and Resistance Genes | Controls (n = 29) a % | Pig Farmers (n = 25) % |
---|---|---|
Staphylococcus aureus (Firmicutes) | 86.7 | 100 |
MRSA (Firmicutes) | 10 | 60 |
Salmonella spp. (Proteobacteria) | 80 | 60 |
Clostridium difficile (Firmicutes) | 0 | 12 |
Mycobacterium avium (Actinobacteria) | 0 | 0 |
Listeria monocytogenes (Firmicutes) | 3.33 | 24 |
czrC (zinc/cadmium) | 26.7 | 68 |
blaCTX-M-1 (cephalosporin) | 0 | 4 |
mcr-1 (colistin) | 0 | 12 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mbareche, H.; Veillette, M.; Pilote, J.; Létourneau, V.; Duchaine, C. Bioaerosols Play a Major Role in the Nasopharyngeal Microbiota Content in Agricultural Environment. Int. J. Environ. Res. Public Health 2019, 16, 1375. https://doi.org/10.3390/ijerph16081375
Mbareche H, Veillette M, Pilote J, Létourneau V, Duchaine C. Bioaerosols Play a Major Role in the Nasopharyngeal Microbiota Content in Agricultural Environment. International Journal of Environmental Research and Public Health. 2019; 16(8):1375. https://doi.org/10.3390/ijerph16081375
Chicago/Turabian StyleMbareche, Hamza, Marc Veillette, Jonathan Pilote, Valérie Létourneau, and Caroline Duchaine. 2019. "Bioaerosols Play a Major Role in the Nasopharyngeal Microbiota Content in Agricultural Environment" International Journal of Environmental Research and Public Health 16, no. 8: 1375. https://doi.org/10.3390/ijerph16081375
APA StyleMbareche, H., Veillette, M., Pilote, J., Létourneau, V., & Duchaine, C. (2019). Bioaerosols Play a Major Role in the Nasopharyngeal Microbiota Content in Agricultural Environment. International Journal of Environmental Research and Public Health, 16(8), 1375. https://doi.org/10.3390/ijerph16081375