Polymorphism of the XRCC1 Gene Is Associated with Susceptibility and Short-Term Recovery of Ischemic Stroke
Abstract
:1. Introduction
2. Methods
2.1. Study Subjects
2.2. Data Collection
2.3. SNP Selection and Genotyping
2.4. Statistical Analyses
3. Results
3.1. Clinical Characteristics of Participants
3.2. Association of SNP Genotypes with IS Susceptibility
3.3. Association of rs25487 SNP with IS Severity, Short-Term Recovery and Functional Outcomes
4. Discussion
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
Appendix A
Polymorphism | Sequence (5’–3’) | |
---|---|---|
rs25487 | Primer | F: AAGGAGTGGGTGCTGGACTGT |
R: CCAGCACAGGATAAGGAGCAG | ||
Probe | FAM-CCTCCCGGAGGTAA-MGB | |
HEX-CCCTCCCAGAGGTA-MGB | ||
rs12645561 | Primer | F: CCTAGTTTCATGACTTGCTCATTACTG |
R: CAAAGGTCAGCTGTATTCAAAATCTATT | ||
Probe | FAM- AAGAAATAATACGCCTTGC-MGB | |
HEX- ATAATACACCTTGCCAATT-MGB | ||
rs4462560 | Primer | F: ATGGCTTCCCAGGTATTTGGT |
R: GCTTCTCAACTCATGGTCTCTTCA | ||
Probe | FAM- ACCTCGAGGCACCA-MGB | |
HEX- ACCTCGAGCCACCA-MGB |
References
- Murray, C.J.; Lopez, A.D. Mortality by cause for eight regions of the world: Global Burden of Disease Study. Lancet 1997, 349, 1269–1276. [Google Scholar] [CrossRef]
- Yang, G.; Wang, Y.; Zeng, Y.; Gao, G.F.; Liang, X.; Zhou, M.; Wan, X.; Yu, S.; Jiang, Y.; Naghavi, M.; et al. Rapid health transition in China, 1990–2010: Findings from the Global Burden of Disease Study 2010. Lancet 2013, 381, 1987–2015. [Google Scholar] [CrossRef]
- Dichgans, M. Genetics of ischaemic stroke. Lancet Neurol. 2007, 6, 149–161. [Google Scholar] [CrossRef]
- Jeffs, B.; Clark, J.S.; Anderson, N.H.; Gratton, J.; Brosnan, M.J.; Gauguier, D.; Reid, J.L.; Macrae, I.M.; Dominiczak, A.F. Sensitivity to cerebral ischaemic insult in a rat model of stroke is determined by a single genetic locus. Nat. Genet. 1997, 16, 364–367. [Google Scholar] [CrossRef] [PubMed]
- Marousi, S.; Ellul, J.; Antonacopoulou, A.; Gogos, C.; Papathanasopoulos, P.; Karakantza, M. Functional polymorphisms of interleukin 4 and interleukin 10 may predict evolution and functional outcome of an ischaemic stroke. Eur. J. Neurol. 2011, 18, 637–643. [Google Scholar] [CrossRef] [PubMed]
- Lewen, A.; Matz, P.; Chan, P.H. Free radical pathways in CNS injury. J. Neurotrauma 2000, 17, 871–890. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Zhu, M.; Zhang, Z.; Jiang, G.; Fu, X.; Fan, M.; Sun, M.; Wei, Q.; Zhao, K. A NEIL1 single nucleotide polymorphism (rs4462560) predicts the risk of radiation-induced toxicities in esophageal cancer patients treated with definitive radiotherapy. Cancer 2013, 119, 4205–4211. [Google Scholar] [CrossRef] [PubMed]
- Skarpengland, T.; Laugsand, L.E.; Janszky, I.; Luna, L.; Halvorsen, B.; Platou, C.G.; Wang, W.; Vatten, L.J.; Damas, J.K.; Aukrust, P.; et al. Genetic variants in the DNA repair gene NEIL3 and the risk of myocardial infarction in a nested case-control study. The HUNT Study. DNA Repair. (Amst.) 2015, 28, 21–27. [Google Scholar] [CrossRef] [PubMed]
- Ladiges, W.; Wiley, J.; MacAuley, A. Polymorphisms in the DNA repair gene XRCC1 and age-related disease. Mech. Ageing Dev. 2003, 124, 27–32. [Google Scholar] [CrossRef]
- Smith, T.R.; Miller, M.S.; Lohman, K.; Lange, E.M.; Case, L.D.; Mohrenweiser, H.W.; Hu, J.J. Polymorphisms of XRCC1 and XRCC3 genes and susceptibility to breast cancer. Cancer Lett. 2003, 190, 183–190. [Google Scholar] [CrossRef]
- The World Health Organization. MONICA Project (monitoring trends and determinants in cardiovascular disease): A major international collaboration. WHO MONICA Project Principal Investigators. J. Clin. Epidemiol. 1988, 41, 105–114. [Google Scholar]
- Adams, H.P., Jr.; Bendixen, B.H.; Kappelle, L.J.; Biller, J.; Love, B.B.; Gordon, D.L.; Marsh, E.E., 3rd. Classification of subtype of acute ischemic stroke. Definitions for use in a multicenter clinical trial. TOAST. Trial of Org 10172 in Acute Stroke Treatment. Stroke 1993, 24, 35–41. [Google Scholar] [CrossRef] [PubMed]
- Jerrard-Dunne, P.; Cloud, G.; Hassan, A.; Markus, H.S. Evaluating the genetic component of ischemic stroke subtypes: A family history study. Stroke 2003, 34, 1364–1369. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.; Yang, H.; ZhiPing, T. Association studies of genetic polymorphism, environmental factors and their interaction in ischemic stroke. Neurosci. Lett. 2006, 398, 172–177. [Google Scholar] [CrossRef] [PubMed]
- Kidd, D.; Stewart, G.; Baldry, J.; Johnson, J.; Rossiter, D.; Petruckevitch, A.; Thompson, A.J. The Functional Independence Measure: A comparative validity and reliability study. Disabil. Rehabil. 1995, 17, 10–14. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Hu, X.; Gan, Y.; Gao, Y.; Liang, W.; Chen, J. Mechanistic insight into DNA damage and repair in ischemic stroke: Exploiting the base excision repair pathway as a model of neuroprotection. Antioxid Redox Signal. 2011, 14, 1905–1918. [Google Scholar] [CrossRef] [PubMed]
- Canugovi, C.; Misiak, M.; Ferrarelli, L.K.; Croteau, D.L.; Bohr, V.A. The role of DNA repair in brain related disease pathology. DNA Repair. (Amst.) 2013, 12, 578–587. [Google Scholar] [CrossRef] [PubMed]
- Mahabir, S.; Abnet, C.C.; Qiao, Y.L.; Ratnasinghe, L.D.; Dawsey, S.M.; Dong, Z.W.; Taylor, P.R.; Mark, S.D. A prospective study of polymorphisms of DNA repair genes XRCC1, XPD23 and APE/ref-1 and risk of stroke in Linxian, China. J. Epidemiol. Community Health 2007, 61, 737–741. [Google Scholar] [CrossRef] [PubMed]
- Shyu, H.Y.; Shieh, J.C.; Ji-Ho, L.; Wang, H.W.; Cheng, C.W. Polymorphisms of DNA repair pathway genes and cigarette smoking in relation to susceptibility to large artery atherosclerotic stroke among ethnic Chinese in Taiwan. J. Atheroscler. Thromb. 2012, 19, 316–325. [Google Scholar] [CrossRef] [PubMed]
- Miller, S.A.; Dykes, D.D.; Polesky, H.F. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988, 16, 1215. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Wu, H.; Zheng, L.; Weng, Y.; Mo, Y. Brain-derived neurotrophic factor G196A polymorphism predicts 90-day outcome of ischemic stroke in Chinese: A novel finding. Brain Res. 2013, 1537, 312–318. [Google Scholar] [CrossRef] [PubMed]
- Stanne, T.M.; Tjarnlund-Wolf, A.; Olsson, S.; Jood, K.; Blomstrand, C.; Jern, C. Genetic variation at the BDNF locus: Evidence for association with long-term outcome after ischemic stroke. PLoS ONE 2014, 9, e114156. [Google Scholar] [CrossRef] [PubMed]
- Liu, P.K. Ischemia-reperfusion-related repair deficit after oxidative stress: Implications of faulty transcripts in neuronal sensitivity after brain injury. J. Biomed. Sci. 2003, 10, 4–13. [Google Scholar] [CrossRef] [PubMed]
Characteristics | Cases (n = 320) | Control (n = 303) | p Value |
---|---|---|---|
Age, year (mean ± SD) | 65.61 ± 11.12 | 67.11 ± 9.32 | 0.068 |
Sex (male) (%) | 189 (59.1) | 140 (46.2) | 0.001 |
Smoking (%) | 125 (39.1) | 75 (24.8) | <0.001 |
Drinking (%) | 151 (47.2) | 64 (21.1) | <0.001 |
Diabetes (%) | 68 (21.3) | 38 (12.5) | 0.004 |
Hypertension (%) | 201 (62.8) | 118 (38.9) | <0.001 |
BMI ≥ 25 kg/m2 (%) | 114 (35.6) | 101 (33.3) | 0.554 |
Total cholesterol (mmol/L) (mean ± SD) | 4.39 ± 1.12 | 5.19 ± 0.95 | <0.001 |
Triglycerides (mmol/L) (mean + SD) | 1.74 ± 1.45 | 1.56 ± 1.27 | 0.109 |
HDL-C (mmol/L) (mean ± SD) | 1.24 ± 0.51 | 1.18 ± 0.26 | 0.075 |
LDL-C (mmol/L) (mean ± SD) | 2.45 ± 0.95 | 2.65 ± 0.59 | 0.235 |
Genotype | Control (n = 303) | Cases (n = 320) | OR (95% CI) | p Value |
---|---|---|---|---|
rs25487 | ||||
GG | 182 (60.1%) | 212 (66.2%) | 1.00 | |
AG | 101 (33.3%) | 102 (31.9%) | 0.61 (0.41–0.92) | 0.018 |
AA | 20 (6.6%) | 6 (1.9%) | 0.16 (0.05–0.49) | 0.002 |
Dominant | 0.53 (0.36–0.79) | 0.002 | ||
Additive | 0.52 (0.37–0.74) | <0.001 | ||
rs12645561 | ||||
CC | 162 (53.4%) | 163 (50.9%) | 1.00 | |
CT | 122 (40.3%) | 124 (38.8%) | 0.97 (0.66–1.44) | 0.898 |
TT | 19 (6.3%) | 33 (10.3%) | 1.72 (0.85–3.49) | 0.132 |
Dominant | 1.07 (0.74–1.55) | 0.707 | ||
Additive | 1.15 (0.87–1.54) | 0.328 | ||
rs4462560 | ||||
CC | 88 (29.0%) | 96 (30.0%) | 1.00 | |
CG | 160 (52.8%) | 155 (48.4%) | 0.76 (0.49–1.16) | 0.196 |
GG | 55 (18.2%) | 69 (21.6%) | 1.10 (0.64–1.89) | 0.717 |
Dominant | 0.84 (0.56–1.25) | 0.395 | ||
Additive | 1.01(0.78–1.32) | 0.925 |
(a) SNPs Associated with IS Severity | ||||
Genotype | Mild (n = 228) | Severe (n = 92) | OR (95% CI) | p Value |
rs25487 | ||||
GG | 143 (62.7%) | 69 (75.0%) | 1.00 | |
AG | 81 (35.5%) | 21 (22.8%) | 0.54 (0.31–0.95) | 0.033 |
AA | 4 (1.8%) | 2 (2.2%) | 1.12 (0.19–6.50) | 0.897 |
Dominant | 0.57 (0.33–0.98) | 0.043 | ||
Additive | 0.63 (0.38–1.05) | 0.076 | ||
(b) SNPs Associated with IS Short-Term Recovery | ||||
Genotype | Improvement (n = 174) | No Change/Deterioration (n = 146) | OR (95% CI) | p Value |
rs25487 | ||||
GG | 105 (60.3%) | 107 (73.3%) | 1.00 | |
AG | 65 (37.4%) | 37 (25.3%) | 0.57 (0.35–0.94) | 0.026 |
AA | 4 (2.3%) | 2 (1.4%) | 0.53 (0.09–3.00) | 0.470 |
Dominant | 0.57 (0.35–0.92) | 0.022 | ||
Additive | 0.60 (0.38–0.94) | 0.026 |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, W.; Huang, P.; Liu, D.; Zhong, L.; Yu, R.; Li, J. Polymorphism of the XRCC1 Gene Is Associated with Susceptibility and Short-Term Recovery of Ischemic Stroke. Int. J. Environ. Res. Public Health 2016, 13, 1016. https://doi.org/10.3390/ijerph13101016
He W, Huang P, Liu D, Zhong L, Yu R, Li J. Polymorphism of the XRCC1 Gene Is Associated with Susceptibility and Short-Term Recovery of Ischemic Stroke. International Journal of Environmental Research and Public Health. 2016; 13(10):1016. https://doi.org/10.3390/ijerph13101016
Chicago/Turabian StyleHe, Wei, Peng Huang, Dinghua Liu, Lingling Zhong, Rongbin Yu, and Jianan Li. 2016. "Polymorphism of the XRCC1 Gene Is Associated with Susceptibility and Short-Term Recovery of Ischemic Stroke" International Journal of Environmental Research and Public Health 13, no. 10: 1016. https://doi.org/10.3390/ijerph13101016
APA StyleHe, W., Huang, P., Liu, D., Zhong, L., Yu, R., & Li, J. (2016). Polymorphism of the XRCC1 Gene Is Associated with Susceptibility and Short-Term Recovery of Ischemic Stroke. International Journal of Environmental Research and Public Health, 13(10), 1016. https://doi.org/10.3390/ijerph13101016