Fucoxanthin Induces Ferroptosis in Hypopharyngeal Carcinoma Cells by Activating the p53/SLC7A11/GPX4 Axis

Abstract

Fucoxanthin, a marine carotenoid abundantly derived from brown algae, has been increasingly recognized for its broad-spectrum antitumor activities; however, its role in regulating ferroptosis remains insufficiently defined. Hypopharyngeal carcinoma is a highly aggressive head and neck malignancy with limited therapeutic options, highlighting the need for novel marine-derived anticancer agents. In this study, we investigated whether fucoxanthin induces ferroptosis in human hypopharyngeal carcinoma cells (Fadu) and elucidated the underlying molecular mechanisms. Transcriptome profiling combined with in vitro validation revealed that fucoxanthin markedly upregulated heme oxygenase−1 (HO−1), leading to increased intracellular Fe²⁺ levels, excessive reactive oxygen species (ROS) generation, and pronounced lipid peroxide accumulation. Fucoxanthin simultaneously reduced cysteine and glutathione (GSH) levels, disrupted mitochondrial membrane potential, and triggered ferroptotic cell death, which was significantly reversed by the ferroptosis inhibitor ferrostatin−1. Mechanistically, fucoxanthin activated the p53 pathway while suppressing SLC7A11 and GPX4, thereby impairing antioxidant defenses. Pharmacological inhibition of p53 with Pifithrin−α markedly attenuated fucoxanthin-induced cytotoxicity and ferroptosis. Together, these findings identify fucoxanthin as a promising marine-derived compound capable of inducing ferroptosis via modulation of the p53/SLC7A11/GPX4 axis, providing new insights into its potential application in hypopharyngeal carcinoma therapy.

1. Introduction

The hypopharyngeal region, extending from the hyoid bone to the lower border of the cricoid cartilage, serves as a critical junction between the digestive and respiratory tracts. Its prolonged exposure to environmental carcinogens, combined with a rich lymphatic network and thin mucosal lining, may increase susceptibility to malignant transformation and contribute to the unfavorable clinical features of hypopharyngeal squamous cell carcinoma, which often presents with dysphagia, respiratory distress, and phonatory impairment [1]. Hypopharyngeal squamous cell carcinoma (HSCC) is particularly alarming because of its concealed anatomical location, aggressive behavior, early lymph node metastasis, and poor prognosis, rendering it one of the most challenging malignancies in head and neck oncology [2,3]. Current treatments including surgical resection and chemoradiotherapy (CRT) remain the standard of care; however, their clinical efficacy is limited by severe functional impairment, treatment resistance, and persistent mortality rates of 40–50% [4]. These shortcomings highlight an urgent need for novel anticancer strategies and safe therapeutic agents capable of improving HSCC outcomes.

Ferroptosis is an iron-dependent, non-apoptotic form of regulated cell death characterized by excessive lipid peroxidation and redox imbalance [5]. Mechanistically, intracellular iron overload accelerates glutathione (GSH) depletion and suppresses glutathione peroxidase 4 (GPX4) activity, thereby enhancing Fenton reaction-driven reactive oxygen species (ROS) generation and promoting lipid peroxide (LPO) accumulation [6,7]. When lipid peroxides fail to be metabolically neutralized, oxidative damage to cellular membranes ensues, ultimately culminating in ferroptotic cell death. Growing evidence indicates that ferroptosis plays a crucial role in tumor progression and therapeutic responses. For example, fatostatin has been shown to induce ferroptosis in glioblastoma by inhibiting the AKT/mTORC1/GPX4 pathway [8], while a molybdenum-based compound initiates ferroptosis in SKOV3 ovarian cancer cells by promoting nitric oxide (NO)-mediated GSH depletion [9]. Compared with synthetic drugs, natural compounds offer advantages such as safety and widespread availability [10,11]. Scientific research has identified numerous natural substances that induce ferroptosis in cancer [12,13,14,15]. However, ferroptosis in HSCC remains insufficiently explored, and the identification of natural agents capable of targeting ferroptotic pathways in this malignancy is still in its early stages. A deeper understanding of ferroptosis and its therapeutic potential in HSCC may offer new opportunities for improving patient prognosis.

Fucoxanthin, a marine carotenoid abundantly found in edible brown algae such as Undaria pinnatifida and Laminaria japonica, has drawn considerable attention due to its broad biological activities, including anti-obesity, antioxidant, and anti-inflammatory effects [16,17]. Recognized as a safe marine-derived natural compound [18,19], fucoxanthin possesses a unique chemical structure containing a 5,6−monoepoxide moiety, an allenic bond, and multiple oxygenated functional groups (Figure 1A). These structural characteristics contribute to its potent antitumor effects, such as suppressing cancer cell proliferation, inhibiting metastatic behaviors, and modulating key signaling pathways [20,21]. While the anticancer properties of fucoxanthin have been widely investigated, previous studies have mainly focused on its effects on apoptosis, proliferation, and cell cycle regulation, leaving its potential involvement in ferroptosis particularly in HSCC largely unexplored.

Given the limited research on ferroptosis in hypopharyngeal carcinoma and the therapeutic promise of marine-derived compounds, this study aimed to determine whether fucoxanthin induces ferroptosis in human hypopharyngeal carcinoma cells (Fadu) and to elucidate the underlying molecular mechanisms. By identifying how fucoxanthin modulates ferroptotic pathways, we seek to provide new insights into its potential application as a therapeutic candidate for HSCC prevention and treatment.

2. Results

2.1. Fucoxanthin Reduces the Viability of FaDu Cells

To evaluate how fucoxanthin influences HSCC cell growth, we measured its cytotoxic effects on FaDu cells using an MTT viability assay. As illustrated in Figure 1B, longer exposure times and increasing fucoxanthin concentrations led to a gradual decline in FaDu cell viability, demonstrating clear dose- and time-associated inhibitory effects. The suppression of cell viability became most evident following 48 h of fucoxanthin treatment, demonstrating a dose-dependent response. Under these conditions, the half-maximal inhibitory concentration (IC₅₀) of fucoxanthin in FaDu cells was determined to be 6.49 μg/mL. Our previous studies demonstrated the IC₅₀ for normal cells was significantly higher (18.13 μg/mL) [22]. These results suggest that fucoxanthin exhibits preferential cytotoxicity toward FaDu cells compared with normal controls. Therefore, subsequent experiments were conducted with fucoxanthin treatment for 48 h at concentrations of 3, 6, and 9 μg/mL.

2.2. Fucoxanthin Induces Non-Apoptotic Cell Death in FaDu Hypopharyngeal Carcinoma Cells

The annexin V/PI assay to investigate whether FaDu cells undergo apoptosis. Surprisingly, even at increasing concentrations, fucoxanthin induced only slight increases in apoptotic populations (Figure 2A). To further clarify the mode of cell death triggered by fucoxanthin, we evaluated mitochondrial membrane potential alterations in fucoxanthin-treated FaDu cells using the JC−1 assay. We quantified mitochondrial depolarization by measuring the ratio of red to green fluorescence signals. As depicted in Figure 2B, JC−1 monomers accounted for only 1.96% of the population in untreated FaDu cells; however, following exposure to 3, 6, and 9 μg/mL fucoxanthin, these values rose to 4.15%, 14.00%, and 39.70%, respectively, reflecting a marked loss of mitochondrial membrane potential. Considering the MTT data, the fucoxanthin-induced reductions in cell viability and mitochondrial membrane potential were far more pronounced than the modest rise observed in apoptosis. Therefore, this disparity indicates that apoptosis does not represent the primary mechanism underlying fucoxanthin-induced cytotoxicity, implying that additional death pathways may contribute to its cytotoxic effects.

2.3. Functional Enrichment Analysis of RNA-Seq–Derived Differentially Expressed Genes (DEGs)

To gain deeper insight into how fucoxanthin influences FaDu cells, we performed transcriptome sequencing on cells treated with either DMSO (control) or fucoxanthin (in triplicate). Transcriptomic profiling identified a total of 960 genes that were significantly altered following fucoxanthin treatment (291 downregulated and 669 upregulated; Figure 3A). Gene Ontology enrichment demonstrated that these DEGs were predominantly associated with stimuli responses, nutrient processing, and DNA replication (Figure 3B). Kyoto Encyclopedia of Genes and Genomes pathway analysis identified five significantly enriched signaling pathways related to cellular activities: cell cycle, cellular senescence, p53 signaling pathway, ferroptosis, and autophagy (Figure 3C). Gene set enrichment analysis of these pathways indicated that only the ferroptosis, p53 and cell cycle pathways were activated in FaDu cells after fucoxanthin treatment (Figure 3D–H). To confirm the reliability of the RNA-Seq results, we performed RT-qPCR on a randomly chosen set of ten DEGs. The RT-qPCR outcomes closely matched the RNA-Seq findings, reinforcing the precision and dependability of the sequencing data. (Figure 3I). The RNA-Seq data provide valuable insights that can guide future research.

2.4. Fucoxanthin Induces Ferroptosis in FaDu Cells

Based on experimental and transcriptomic analyses, we investigated the role of fucoxanthin in inducing ferroptosis in FaDu cells. As illustrated in Figure 4A, MTT analysis showed that Fer−1 effectively mitigated the fucoxanthin-mediated reduction in cell viability. To further validate the induction of ferroptosis by fucoxanthin in FaDu cells, we examined key ferroptosis markers. Heme oxygenase−1 (HO−1) contributes to the initiation of ferroptosis by modulating intracellular iron homeostasis. Our findings revealed that exposure to fucoxanthin markedly elevated both HO−1 mRNA and protein expression in FaDu cells, with the magnitude of induction rising in a dose-dependent fashion (Figure 4B). Subsequent assays measuring intracellular ferrous ion (Fe²⁺) content revealed a significant, dose-dependent increase in Fe²⁺ levels after fucoxanthin treatment. Importantly, the addition of Fer−1 reversed this fucoxanthin-induced increase in Fe²⁺ levels (Figure 4C,D). Subsequently, we examined the intracellular levels of ROS, LPO, Cys, and GSH. As shown in Figure 4D,E, an increase in fucoxanthin concentration led to significant increases in ROS and LPO levels within FaDu cells. Co-treatment with Fer−1 largely suppressed the fucoxanthin-induced rise in ROS and lipid peroxidation. Conversely, fucoxanthin exposure caused a marked depletion of intracellular Cys and GSH pools; these decreases were also reversed by Fer−1 (Figure 4F,G). As shown in Figure 5A, the percentage of JC−1 monomers decreased from 28.3% to 8.1% after the addition of Fer−1, indicating a significant reversal of the fucoxanthin-induced decline in mitochondrial membrane potential. In addition, we conducted an LDH release assay to quantitatively evaluate plasma membrane integrity. Fucoxanthin treatment resulted in a significant increase in LDH release into the culture medium, indicating membrane damage. Importantly, this LDH release was substantially attenuated by Fer−1 (Figure 5B). In summary, our results indicate that fucoxanthin induces ferroptosis-like cell death in HSCC FaDu cells, characterized by iron-dependent lipid peroxidation and ferrostatin−1–reversible cytotoxicity.

2.5. Impact of Fucoxanthin on the mRNA and Protein Expression of p53, SLC7A11, and GPX4 in FaDu Cells

To clarify the molecular basis of fucoxanthin-induced ferroptosis in FaDu cells, we assessed the expression of key ferroptosis-associated regulators—p53, SLC7A11, and GPX4—through RT-qPCR and Western blot analyses. The data showed that p53 mRNA levels increased significantly upon administration of fucoxanthin at concentrations of 3 μg/mL and higher (Figure 6A, p < 0.05). Conversely, the mRNA expression of SLC7A11 and GPX4 declined in a concentration-dependent manner as fucoxanthin dosage increased (Figure 6B,C). Importantly, exposure to fucoxanthin at concentrations of 6 μg/mL or higher produced marked reductions in SLC7A11 and GPX4 mRNA levels (p < 0.01). As illustrated in Figure 6D, the Western blot results demonstrated that fucoxanthin at concentrations of 3 μg/mL or higher significantly elevated p53 protein levels, with the increase occurring in a dose-dependent fashion (p < 0.05). In addition, fucoxanthin at concentrations of 6 μg/mL or above markedly diminished the protein levels of SLC7A11 and GPX4 (p < 0.01).

2.6. Fucoxanthin Promotes Ferroptosis in FaDu Cells Through the p53/SLC7A11/GPX4 Cascade

On the basis of these observations, we propose that the alterations induced by fucoxanthin in FaDu cells may result from sequential modulation of the p53/SLC7A11/GPX4 signaling pathway. To test this hypothesis, we performed reverse validation using the p53 inhibitor PFT−α. The MTT assay revealed that PFT−α substantially alleviated the cytotoxic effects elicited by fucoxanthin (Figure 7A). Additionally, we measured the intracellular levels of Cys, GSH, and LPO in PFT−α-treated FaDu cells. As shown in Figure 7B–D, PFT−α reversed the fucoxanthin-induced decreases in Cys and GSH levels and the increase in LPO levels. Western blot analysis further supported our hypothesis, demonstrating that PFT−α treatment rescued the fucoxanthin-induced increase in p53 protein levels and the decreases in SLC7A11 and GPX4 protein expression in FaDu cells (Figure 7E). Collectively, these findings suggested that fucoxanthin induces ferroptosis in FaDu human hypopharyngeal carcinoma cells through the p53/SLC7A11/GPX4 pathway.

3. Discussion

The prognosis of hypopharyngeal carcinoma remains a persistent clinical challenge, with survival rates showing minimal improvement over the years. Epidemiological analyses consistently report a 5-year survival rate of only around 30–35%, underscoring the urgent need for more effective interventions [23,24]. The choice of treatment modality is crucial for patient recovery and survival. Although therapeutic strategies have evolved, clinical management of this malignancy continues to be hampered by multiple unresolved obstacles. Surgery combined with adjuvant radiotherapy and chemotherapy is a common approach, but this regimen is not risk-free [25]. “Standard therapies often induce substantial treatment-related morbidity, which can significantly compromise patient quality of life [26]. For some patients, surgery and adjuvant chemoradiotherapy may not be the optimal choice. Additionally, tumors in the hypopharyngeal region can obstruct eating and swallowing, posing a risk of malnutrition that further complicates treatment and worsens the patient’s condition [27]. Hypopharyngeal cancer is often diagnosed at an advanced stage, affecting treatment goals. For some patients, the primary objective may be to maintain quality of life and function; other patients may prioritize long-term survival. This variability increases the complexity of treatment strategy selection [28]. Compared with conventional chemotherapeutics, bioactive compounds derived from natural sources frequently display lower toxicity profiles and favorable tolerability, making them attractive candidates for adjunct or alternative therapies. Such agents frequently achieve meaningful biological effects while minimizing adverse reactions, providing patients with safer and more effective treatment options [29].

Fucoxanthin, a well-known carotenoid in the fucoxanthin and xanthophyll family, is primarily produced by marine organisms such as large algae of the genus Fucus, including Sargassum fusiforme [20]. Fucoxanthin is widely recognized for its multifunctional bioactivity, encompassing metabolic regulation, anti-inflammatory actions, and tumor-suppressive effects [30,31,32]. Most published studies on fucoxanthin have concentrated on its roles in regulating cell proliferation and apoptotic signaling cascades, whereas its involvement in ferroptosis remains far less understood [33]. In our study, we found that fucoxanthin exhibits significant in vitro cytotoxicity against FaDu cells, with an IC₅₀ value of 6.49 μg/mL. However, flow cytometry analysis of apoptosis revealed that at this concentration, the apoptosis rate of FaDu cells did not correspond to the proportion of cells exhibiting decreased mitochondrial membrane potential. The discrepancy between apoptotic rates and the extent of cytotoxicity strongly implies that fucoxanthin provokes an alternative, non-apoptotic form of cell death.

Since its discovery in 2012, ferroptosis has been established as a unique cell death modality, clearly distinguished from classical apoptosis, necrosis, and autophagy [34]. This mode of cell death is defined by its tight association with iron handling, the accumulation of lipid peroxides, and the regulation of oxidative stress. At the core of ferroptosis is the activity of iron ions, whose ability to accept and donate electrons enables ongoing redox cycling through the interconversion of Fe²⁺ and Fe³⁺ [35]. Thus, the maintenance of iron ion homeostasis is crucial for normal cellular function. To evaluate whether fucoxanthin drives ferroptosis in FaDu cells, we analyzed several hallmark indicators of this cell death pathway. Under normal culture conditions, extracellular LDH activity remains at background levels due to intact plasma membrane integrity. Fucoxanthin-induced cytotoxicity is associated with increased LDH release, which was significantly attenuated by ferrostatin−1, supporting ferroptosis-associated membrane damage rather than nonspecific necrosis. It should be noted that ferroptosis is primarily driven by iron-dependent lipid peroxidation rather than by pronounced mitochondrial depolarization. Therefore, alterations in mitochondrial membrane potential should be interpreted as supportive, but not definitive, evidence of ferroptotic cell death. Consistent with this notion, our data demonstrate that fucoxanthin markedly enhances intracellular Fe²⁺ accumulation and promotes excessive ROS generation and lipid peroxidation, which represent hallmark biochemical features of ferroptosis. Notably, co-administration of ferrostatin−1 effectively reversed these changes, further substantiating the involvement of ferroptotic mechanisms in fucoxanthin-induced cytotoxicity. Further analyses using RT-qPCR and Western blot revealed that fucoxanthin treatment significantly upregulated HO−1 expression and downregulated SLC7A11 and GPX4 expression, both in a dose-dependent manner. HO−1 is a heme-degrading enzyme that releases carbon monoxide (CO), biliverdin, and ferrous ions during heme metabolism, making HO−1 a major source of labile iron within cells [36,37]. Intracellular iron predominantly exists in the form of ferrous ions; their excessive accumulation can disrupt the intracellular redox balance, leading to ROS generation. These ROS interact with cellular lipids, causing lipid peroxidation and ultimately inducing ferroptosis [38]. GPX4 is a key enzyme that utilizes Cys and GSH as cofactors to eliminate intracellular LPOs, thereby inhibiting ferroptosis [39]. GPX4 serves as a key regulatory enzyme governing this process. There is evidence that GPX4 is essential for the survival of cancer cells; it often demonstrates overexpression in various cancers [40,41,42]. SLC7A11, a subunit of System xc- (an antioxidant system), is responsible for primary transport activity within the system. Inhibition of System xc- activity suppresses Cys uptake, affecting GSH synthesis. Consequently, GPX4 activity decreases, reducing the cell’s antioxidant capacity and promoting ferroptosis [43]. These combined biochemical and phenotypic alterations strongly indicate that fucoxanthin drives ferroptotic cell death in FaDu cells.

The p53 gene, a crucial tumor suppressor, regulates the p53/SLC7A11/GPX4 pathway, playing a key role in iron metabolism and oxidative stress responses [44,45]. In tumors, p53 can inhibit SLC7A11 expression, leading to decreased Cys and GSH levels, reduced GPX4 activity, and the promotion of ferroptosis [46]. Flubendazole, a United States Food and Drug Administration-approved drug, reportedly inhibits prostate cancer cell proliferation in vitro and induces p53 expression. These effects lead to transcriptional repression of SLC7A11 and subsequent downregulation of GPX4, indicating that flubendazole is a novel p53 inducer capable of activating ferroptosis [47]. Similarly, we assessed p53 mRNA and protein expression levels after fucoxanthin treatment. In this study, fucoxanthin robustly activated p53 expression at both transcriptional and translational levels, indicating that p53 may serve as an upstream mediator in the ferroptotic cascade initiated by this compound. To further validate the regulatory role of p53 in this pathway, we used the p53 inhibitor PFT−α for reverse verification. Pharmacological inhibition of p53 using PFT−α effectively negated fucoxanthin-induced alterations in cellular redox status, further reinforcing the central role of p53 in this regulatory axis. Additionally, Western blot analysis showed that PFT−α treatment mitigated the fucoxanthin-induced upregulation of p53 protein and the downregulation of SLC7A11 and GPX4. It should be noted that fucoxanthin exhibits limited systemic bioavailability and is subject to metabolic transformation in vivo, which may constrain the direct translational extrapolation of in vitro findings. Therefore, the present study aims to provide mechanistic insight into ferroptosis regulation rather than immediate therapeutic application. Future studies evaluating fucoxanthin metabolites, optimized delivery strategies, and in vivo hypopharyngeal carcinoma models will be essential to further assess translational potential. In this context, our findings demonstrate that fucoxanthin acts as a mechanistic modulator of ferroptosis in FaDu cells through the p53/SLC7A11/GPX4 signaling axis. These results provide a biological rationale supporting the further exploration of fucoxanthin or its bioactive metabolites, as well as optimized delivery strategies, in in vivo hypopharyngeal carcinoma models to evaluate their translational and therapeutic potential.

4. Materials and Methods

4.1. Cell Origin and Culture Conditions

Human hypopharyngeal carcinoma cells (FaDu) were obtained from the Chinese Academy of Sciences Cell Bank in Shanghai. The cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM; Corning, New York, NY, USA) containing 10% fetal bovine serum (Gibco, Carlsbad, CA, USA) and supplemented with antibiotics (100 IU/mL penicillin and 100 μg/mL streptomycin; TransGen, Beijing, China). All cultures were incubated at 37 °C in a humidified atmosphere containing 5% CO₂.

4.2. Assessment of Cell Viability

FaDu cells (5 × 10⁴ cells/mL) were plated into each well of a 96-well plate and subsequently exposed to Ferrostatin−1 (Fer−1, MedChemExpress, Monmouth Junction, NJ, USA), Pifithrin−α (PFT−α, Yuanye Bio-Technology, Shanghai, China), or different concentrations of fucoxanthin (provided by Zhejiang Wanli University; purity > 95% confirmed by high-performance liquid chromatography, Figure S1) for 48 h. Cell viability was assessed using methyl thiazolyl tetrazolium (MTT, Solarbio, Beijing, China). In accordance with the manufacturer’s instructions, 10 μL of MTT (5 mg/mL) reagent was added to each well and incubated for 4 h at 37 °C. After removal of culture media and addition of dimethyl sulfoxide (DMSO), absorbance was measured at 570 nm using a microplate reader.

4.3. Analysis of Apoptosis

FaDu cells (5 × 10⁴ cells/mL) exposed to fucoxanthin for 48 h were harvested and assessed using an apoptosis detection kit (BD Biosciences, Tokyo, Japan), as described in the protocol provided by the manufacturer. Cells were washed twice with cold PBS and resuspended in 1× binding buffer at 1 × 10⁶ cells per mL, and 100 μL aliquots containing 1 × 10⁵ cells each were transferred to 5 mL culture tubes. After being added 5 μL FITC annexin V and 5 μL PI, the cells were gently vortexed and incubated for 15 min at room temperature (25 °C) in the dark. Following fluorescence compensation, the apoptotic fraction of FaDu cells was quantified by flow cytometry (BD FACSVerse, San Jose, CA, USA) using Annexin V–FITC/PI staining.

4.4. Assessment of Mitochondrial Membrane Potential

The JC−1 Mitochondrial Membrane Potential Detection Kit (Absin, Shanghai, China) was used to evaluate changes in mitochondrial transmembrane potential. FaDu cells (5 × 10⁴ cells/mL) were plated in 6-well dishes and exposed to fucoxanthin and Fer−1 for 48 h. After treatment with fucoxanthin and Fer−1, cells were trypsinized, resuspended, and incubated with JC−1 reagent in a cell culture incubator for 20 min, as described in the protocol provided by the manufacturer. After flow cytometry analysis, the red-to-green fluorescence ratio was calculated to determine mitochondrial membrane potential.

4.5. RNA-Seq Assay

FaDu cells (5 × 10⁴ cells/mL) were plated in 6-well dishes. Total RNA was isolated with TRIzol reagent (Ambion, Austin, TX, USA) from cells exposed to 9 μg/mL fucoxanthin for 48 h. Library construction was performed using the NEBNext^® Ultra™ RNA Library Prep Kit for Illumina^®. Sequencing was carried out on the Illumina NovaSeq 6000 platform by Novogene Technology (Beijing, China). Differential gene expression between the two groups was evaluated using the DESeq R package (version 4.0.3), applying thresholds of |log₂(fold change)| > 2 and p < 0.05.

4.6. Determination of Ferrous Ion Concentration

FaDu cells (5 × 10⁴ cells/mL) were plated in 6-well dishes and exposed to fucoxanthin and Fer−1 for 48 h. Following treatment, cells were washed thoroughly, lysed, and processed using a commercial ferrous iron detection kit (Solarbio) to quantify intracellular Fe²⁺ levels according to the manufacturer’s guidelines. The assay is based on the formation of a blue-colored complex between Fe²⁺ and ferrozine under acidic conditions, which exhibits a characteristic absorbance at 593 nm. The Fe²⁺ concentration was quantified by measuring the absorbance at this wavelength.

4.7. Measurement of LPOs

FaDu cells (5 × 10⁴ cells/mL) were plated in 6-well dishes and treated with fucoxanthin, Fer−1, and PFT−α for 48 h, then harvested by trypsinization. The relative LPO concentration in cell lysates was determined using the Lipid Peroxidation Assay Kit (Solarbio), as described in the protocol provided by the manufacturer. In this assay, lipid peroxidation–derived malondialdehyde (MDA) reacts with thiobarbituric acid under acidic and high-temperature conditions to yield a chromogenic adduct, which was subsequently quantified by measuring absorbance at 532 nm.

4.8. Measurement of ROS Level

FaDu cells (5 × 10⁴ cells/mL) were plated in 6-well dishes and treated with fucoxanthin and Fer−1 for 48 h, then harvested by trypsinization. Cells were then resuspended in 500 μL of serum-free DMEM supplemented with the DCFH−DA probe (10 μM, Solarbio) and incubated at 37 °C for 20 min. After being washed three times with serum-free medium to eliminate excess probe, fluorescence intensities were then recorded using a flow cytometer equipped with a 488 nm excitation laser.

4.9. LDH, GSH and Cys Quantification

FaDu cells (5 × 10⁴ cells/mL) were plated in 6-well dishes and treated with fucoxanthin, Fer−1, and PFT−α for 48 h, and subsequently lysed following the manufacturer’s protocol using the LDH, GSH and Cys Detection Kit (Solarbio). Absorbance values at 450 nm (LDH), 412 nm (GSH) and 600 nm (Cys) were measured with a microplate reader, and metabolite concentrations were calculated according to the kit instructions.

4.10. Reverse Transcription–Quantitative PCR (RT-qPCR) Analysis

FaDu cells (5 × 10⁴ cells/mL) exposed to fucoxanthin for 48 h were harvested. Total RNA was isolated from fucoxanthin-treated FaDu cells using an RNA extraction kit (Magen, Guangzhou, China), then quantified and normalized. cDNA was generated using a reverse transcription kit (TransGen). RT-qPCR was carried out on a QuantStudio real-time PCR platform (Thermo Fisher, Waltham, MA, USA) using SYBR Green chemistry (TransGen). The PCR program included an initial denaturation at 95 °C for 30 s, followed by 45 cycles of denaturation at 94 °C for 5 s and annealing/extension at 60 °C for 30 s. Relative transcript abundance was calculated using the 2^−ΔΔCt method, with β−actin employed as the internal reference gene. The sequences of all primers used in this study are provided in

Table 1. Primers used for RT-qPCR.

Gene	Sense Primer (5′-3′)	Antisense Primer (5′-3′)
HO−1	GCCAGTGCCACCAAGTTCAAG	GATGTTGAGCAGGAACGCAGTC
p53	GCGTGTTTGTGCCTGTCCTG	GTGCTCGCTTAGTGCTCCCT
SLC7A11	TTTGTTGCCCTCTCCTGCTTTG	AGTGTGCTTGCGGACATGAATC
GPX4	CGCTGTGGAAGTGGATGAAGATC	TGTCGATGAGGAACTGTGGAGAG
β−actin	CCACGAAACTACCTTCAACTCCATC	AGTGATCTCCTTCTGCATCCTGTC
PTGS2	GGTTGCTGGTGGTAGGAATGTTC	CTGGTATTTCATCTGCCTGCTCTG
ATF3	GGCGACGAGAAAGAAATAAGATTGC	AGCCTTCAGTTCAGCATTCACAC
MAP1LC3B	AGCGTCTCCACACCAATCTCAG	ACAATTTCATCCCGAACGTCTCC
ARG2	AGAGGAAGAGGCGAAGACTACAG	ATCTGGTGAACTGGGAGTAGGAAG
CXCL8	CTCTTGGCAGCCTTCCTGATTTC	GGGTGGAAAGGTTTGGAGTATGTC
PNLIPRP3	CAGATGGCAAATGGCAGAGAGAC	CCACCTCAGCACCAACAACAC
PHKG2	TCTGTGGTCCGCCGTTGTG	TGTGTGTCTCTCGCCGTGTG
CDK1	TCAGTCTTCAGGATGTGCTTATGC	CCATGTACTGACCAGGAGGGATAG
CDK2	TGCCTGATTACAAGCCAAGTTTCC	GCGATAACAAGCTCCGTCCATC
KRT4	TGACAACCTGAAGAACACCAAGAG	AGCCACGGATACCTGAAGAGTC

.

4.11. Western Blot Analysis

FaDu cells (5 × 10⁴ cells/mL) were plated in 6-well dishes and allowed to grow for 24 h prior to being exposed to PFT−α and different concentrations of fucoxanthin for an additional 48 h. Cells were lysed on ice, and the resulting supernatant was harvested following centrifugation. Equal amounts of protein were resolved via sodium dodecyl sulfate–polyacrylamide gel electrophoresis and subsequently transferred onto nitrocellulose membranes (Pall, New York, NY, USA) for immunoblotting. After blocking the membrane with skim milk for 20 min, it was incubated overnight at 4 °C with primary antibodies, each diluted 1:1000. Following three washes with Tris-buffered saline containing Tween (TBST, Solarbio), membranes were then incubated with species-appropriate secondary antibodies for 2 h at ambient temperature. Following three more TBST washes, protein expression was detected using a gel imaging system and an enhanced chemiluminescence kit (EpiZyme, Shanghai, China). All antibodies (HO−1, p53, SLC7A11, GPX4, and secondary antibodies) were obtained from ABclonal (Wuhan, China).

4.12. Statistical Analysis

All experiments were performed in biological triplicate, and data are presented as mean ± standard deviation (SD). Statistical analyses were conducted using GraphPad Prism 8. For comparisons between two groups, Student’s t-test was applied. For comparisons among multiple groups, one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test was used. Differences were considered statistically significant at p < 0.05 and p < 0.01.

5. Conclusions

In this study, we demonstrate that the marine carotenoid fucoxanthin induces ferroptotic cell death in FaDu hypopharyngeal carcinoma cells through coordinated modulation of the p53/SLC7A11/GPX4 signaling cascade. Fucoxanthin upregulates HO−1, expanding the intracellular labile Fe²⁺ pool and intensifying oxidative injury via enhanced ROS and lipid peroxide formation. Concurrent activation of p53 and repression of SLC7A11 disrupt cystine uptake and GSH biosynthesis, thereby diminishing GPX4 activity and permitting the accumulation of cytotoxic lipid peroxides. These molecular alterations collectively commit cells to ferroptosis. While in vivo validation is still required to substantiate these findings, our work identifies fucoxanthin as a potent marine-derived modulator of ferroptosis and a promising candidate for the development of novel therapeutic strategies against hypopharyngeal carcinoma.