Effect of Echinochrome A on Submandibular Gland Dysfunction in Ovariectomized Rats
Abstract
1. Introduction
2. Results
2.1. Effect of Ech A on Basic Health Conditions
2.2. Ech A Suppressed Lipid Accumulation
2.3. Ech A Inhibited the Expression of Lipid Metabolic Genes
2.4. Ech A Reduced Ferroptosis
2.5. Ech A Reduced Inflammation and Fibrosis
2.6. Ech A Improved Submandibular Gland Functions
3. Discussion
4. Materials and Methods
4.1. Echinochrome A
4.2. Experimental Design
4.3. Serum Estradiol Analysis
4.4. Tissue Preparations
4.5. Staining and Immunohistochemistry Analysis
4.6. Quantitation of Redox Status and Ferroptosis Response
4.7. Electron Microscopy
4.8. Quantitative Real-Time PCR
4.9. Saliva Secretion
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Llaneza, P.; García-Portilla, M.P.; Llaneza-Suárez, D.; Armott, B.; Pérez-López, F.R. Depressive disorders and the menopause transition. Maturitas 2012, 71, 120–130. [Google Scholar] [CrossRef]
- Finkelstein, J.S.; Brockwell, S.E.; Mehta, V.; Greendale, G.A.; Sowers, M.R.; Ettinger, B.; Lo, J.C.; Johnston, J.M.; Cauley, J.A.; Danielson, M.E.; et al. Bone mineral density changes during the menopause transition in a multiethnic cohort of women. J. Clin. Endocrinol. Metab. 2008, 93, 861–868. [Google Scholar] [CrossRef]
- Lizcano, F.; Guzmán, G. Estrogen deficiency and the origin of obesity during menopause. BioMed Res. Int. 2014, 2014, 757461. [Google Scholar] [CrossRef]
- Suri, V.; Suri, V. Menopause and oral health. J. Midlife Health 2014, 5, 115–120. [Google Scholar] [CrossRef]
- Chi, A.C.; Neville, B.W.; Krayer, J.W.; Gonsalves, W.C. Oral manifestations of systemic disease. Am. Fam. Physician 2010, 82, 1381–1388. [Google Scholar]
- Frutos, R.; Rodríguez, S.; Miralles-Jorda, L.; Machuca, G. Oral manifestations and dental treatment in menopause. Med. Oral 2002, 7, 26–30. [Google Scholar]
- Meurman, J.H.; Tarkkila, L.; Tiitinen, A. The menopause and oral health. Maturitas 2009, 63, 56–62. [Google Scholar] [CrossRef]
- Mortazavi, H.; Baharvand, M.; Movahhedian, A.; Mohammadi, M.; Khodadoustan, A. Xerostomia due to systemic disease: A review of 20 conditions and mechanisms. Ann. Med. Health Sci. Res. 2014, 4, 503–510. [Google Scholar] [CrossRef]
- Tommaselli, G.A.; Di Carlo, C.; Pellicano, M.; Nasti, A.; Ferrara, C.; Di Spiezio Sardo, A.; Nola, B.; Nappi, C. Changes of leptin levels in menopause. Minerva Ginecol. 2001, 53, 193–198. [Google Scholar]
- Medina-Contreras, J.; Villalobos-Molina, R.; Zarain-Herzberg, A.; Balderas-Villalobos, J. Ovariectomized rodents as a menopausal metabolic syndrome model. A minireview. Mol. Cell. Biochem. 2020, 475, 261–276. [Google Scholar] [CrossRef]
- Kwon, H.K.; Kim, J.M.; Shin, S.C.; Sung, E.S.; Kim, H.S.; Park, G.C.; Cheon, Y.I.; Lee, J.C.; Lee, B.J. The mechanism of submandibular gland dysfunction after menopause may be associated with the ferroptosis. Aging 2020, 12, 21376–21390. [Google Scholar] [CrossRef]
- Wan, J.; Ren, H.; Wang, J. Iron toxicity, lipid peroxidation and ferroptosis after intracerebral haemorrhage. Stroke Vasc. Neurol. 2019, 4, 93–95. [Google Scholar] [CrossRef]
- Latunde-Dada, G.O. Ferroptosis: Role of lipid peroxidation, iron and ferritinophagy. Biochim. Biophys. Acta Gen. Subj. 2017, 1861, 1893–1900. [Google Scholar] [CrossRef]
- Chen, H.; Wang, C.; Liu, Z.; He, X.; Tang, W.; He, L.; Feng, Y.; Liu, D.; Yin, Y.; Li, T. Ferroptosis and its multifaceted role in cancer: Mechanisms and therapeutic approach. Antioxidants 2022, 11, 1504. [Google Scholar] [CrossRef]
- Thapa, K.; Singh, T.G.; Kaur, A. Targeting ferroptosis in ischemia/reperfusion renal injury. Naunyn Schmiedebergs Arch. Pharmacol. 2022, 395, 1331–1341. [Google Scholar] [CrossRef]
- Jeong, S.H.; Kim, H.K.; Song, I.S.; Lee, S.J.; Ko, K.S.; Rhee, B.D.; Kim, N.; Mishchenko, N.P.; Fedoryev, S.A.; Stonik, V.A.; et al. Echinochrome A protects mitochondrial function in cardiomyocytes against cardiotoxic drugs. Mar. Drugs 2014, 12, 2922–2936. [Google Scholar] [CrossRef]
- Fedoreyev, S.A.; Krylova, N.V.; Mishchenko, N.P.; Vasileva, E.A.; Pislyagin, E.A.; Iunikhina, O.V.; Lavrov, V.F.; Svitich, O.A.; Ebralidze, L.K.; Leonova, G.N. Antiviral and antioxidant properties of echinochrome A. Mar. Drugs 2018, 16, 509. [Google Scholar] [CrossRef]
- Shikov, A.N.; Pozharitskaya, O.N.; Krishtopina, A.S.; Makarov, V.G. Naphthoquinone pigments from sea urchins: Chemistry and pharmacology. Phytochem. Rev. 2018, 17, 509–534. [Google Scholar] [CrossRef]
- Prokopov, I.A.; Kovaleva, E.L.; Minaeva, E.D.; Pryakhina, E.A.; Savin, E.V.; Gamayunova, A.V.; Pozharitskaya, O.N.; Makarov, V.G.; Shikov, A.N. Animalderived medicinal products in Russia: Current nomenclature and specific aspects of quality control. J. Ethnopharmacol. 2019, 240, 111933. [Google Scholar] [CrossRef]
- Kim, H.K.; Vasileva, E.A.; Mishchenko, N.P.; Fedoreyev, S.A.; Han, J. Multifaceted clinical effects of echinochrome. Mar. Drugs 2021, 19, 412. [Google Scholar] [CrossRef]
- Talalaeval, O.S.; Zverev, Y.F.; Bryukhanov, V.M.; Mishchenko, N.R. Specific features and prospects of the pharmaco kinetic study of histochrome. Eksp. Klin. Farmakol. 2016, 79, 34–44. [Google Scholar]
- Mohamed, A.S.; Soliman, A.M.; Marie, M.A.S. Mechanisms of echinochrome potency in modulating diabetic complications in liver. Life Sci. 2016, 151, 41–49. [Google Scholar] [CrossRef]
- Lennikov, A.; Kitaichi, N.; Noda, K.; Mizuuchi, K.; Ando, R.; Dong, Z.; Fukuhara, J.; Kinoshita, S.; Namba, K.; Ohno, S.; et al. Amelioration of endotoxin-induced uveitis treated with the sea urchin pigment echinochrome in rats. Mol. Vis. 2014, 20, 171–177. [Google Scholar]
- Kim, J.M.; Kim, J.H.; Shin, S.-C.; Park, G.C.; Kim, H.S.; Kim, K.; Kim, H.K.; Han, J.; Mishchenko, N.P.; Vasileva, E.A.; et al. The protective effect of echinochrome A on extracellular matrix of vocal folds in ovariectomized rats. Mar. Drugs 2020, 18, 77. [Google Scholar] [CrossRef]
- Lebedev, A.V.; Ivanova, M.V.; Krasnovid, N.I.; Kol’tsova, E.A. Acidity and interaction with superoxide anion radical of echinochrome and its structural analogs. Vopr. Med. Khim. 1999, 45, 123–130. [Google Scholar]
- Sayed, D.A.; Soliman, A.M.; Fahmy, S.R. Echinochrome pigment as novel therapeutic agent against experimentally-induced gastric ulcer in rats. Biomed. Pharmacother. 2018, 107, 90–95. [Google Scholar] [CrossRef]
- Mohamed, A.S.; Sadek, S.A.; Hassanein, S.S.; Soliman, A.M.J. Hepatoprotective effect of echinochrome pigment in septic rats. J. Surg. Res. 2019, 234, 317–324. [Google Scholar] [CrossRef]
- Hagen, R.M.; Rodriguez-Cuenca, S.; Vidal-Puig, A. An allostatic control of membrane lipid composition by SREBP1. FEBS Lett. 2010, 584, 2689–2698. [Google Scholar] [CrossRef]
- Li, C.; Zhang, L.; Qiu, Z.; Deng, W.; Wang, W. Key Molecules of Fatty Acid Metabolism in Gastric Cancer. Biomolecules 2022, 12, 706. [Google Scholar] [CrossRef]
- Kim, K.K.; Sheppard, D.; Chapman, H.A. TGF-β1 Signaling and Tissue Fibrosis. Cold Spring Harb. Perspect. Biol. 2018, 10, a022293. [Google Scholar] [CrossRef]
- Wang, L.; Zhu, L.; Yao, Y.; Ren, Y.; Zhang, H. Role of hormone replacement therapy in relieving oral dryness symptoms in postmenopausal women: A case control study. BMC Oral Health 2021, 21, 615. [Google Scholar] [CrossRef]
- Abd El-Haleem, M.R.; Selim, A.O.; Attia, G.M. Bone marrow–derived mesenchymal stem cells ameliorate parotid injury in ovariectomized rats. Cytotherapy 2018, 20, 204–217. [Google Scholar] [CrossRef]
- El-Naseery, N.I.; Elewa, Y.H.A.; Ichii, O.; Kon, Y. An experimental study of menopause induced by bilateral ovariectomy and mechanistic effects of mesenchymal stromal cell therapy on the parotid gland of a rat model. Ann. Anat. 2018, 220, 9–20. [Google Scholar] [CrossRef]
- Kim, J.M.; Kim, J.H.; Kim, K.; Shin, S.C.; Cheon, Y.I.; Kim, H.S.; Lee, J.C.; Sung, E.S.; Lee, M.; Park, G.C.; et al. Tonsil mesenchymal stem cells-derived extracellular vesicles prevent submandibular gland dysfunction in ovariectomized rats. Aging 2022, 14, 2194–2209. [Google Scholar] [CrossRef]
- Hajiabbas, M.; D’Agostino, C.; Simińska-Stanny, J.; Tran, S.D.; Shavandi, A.; Delporte, C.J. Bioengineering in salivary gland regeneration. J. Biomed. Sci. 2022, 29, 35. [Google Scholar] [CrossRef]
- Wu, D.; Lombaert, I.M.A.; DeLeon, M.; Pradhan-Bhatt, S.; Witt, R.L.; Harrington, D.A.; Trombetta, M.G.; Passineau, M.J.; Farach-Carson, M.C. Immunosuppressed miniswine as a model for testing cell therapy success: Experience with implants of human salivary stem/progenitor cell constructs. Front. Mol. Biosci. 2021, 8, 711602. [Google Scholar] [CrossRef]
- Dixon, S.J.; Lemberg, K.M.; Lamprecht, M.R.; Skouta, R.; Zaitsev, E.M.; Gleason, C.E.; Patel, D.N.; Bauer, A.J.; Cantley, A.M.; Yang, W.S.; et al. Ferroptosis: An iron-dependent form of nonapoptotic cell death. Cell 2012, 149, 1060–1072. [Google Scholar] [CrossRef]
- Xie, Y.; Hou, W.; Song, X.; Yu, Y.; Huang, J.; Sun, X.; Kang, R.; Tang, D. Ferroptosis: Process and function. Cell Death Differ. 2016, 23, 369–379. [Google Scholar] [CrossRef]
- Xu, Y.; Pang, B.; Hu, L.; Feng, X.; Hu, L.; Wang, J.; Zhang, C.; Wang, S. Dietary nitrate protects submandibular gland from hyposalivation in ovariectomized rats via suppressing cell apoptosis. Biochem. Biophys. Res. Commun. 2018, 497, 272–278. [Google Scholar] [CrossRef]
- Kim, J.H.; Lee, H.; Kim, J.M.; Kim, H.S.; Shin, S.-C.; Hwang, S.-K.; Lee, B.-J.; Kim, K.Y. Effects of oligonol on the submandibular gland in ovariectomized rats. Biomed. Pharmacother. 2021, 141, 111897. [Google Scholar] [CrossRef]
- Smith, P.K.; Krohn, R.I.; Hermanson, G.T.; Mallia, A.K.; Gartner, F.H.; Provenzano, M.D.; Fujimoto, E.K.; Goeke, N.M.; Olson, B.J.; Klenk, D.C. Measurement of protein using bicinchoninic acid. Anal. Biochem. 1985, 150, 76–85. [Google Scholar] [CrossRef]






| Gene | Direction | Sequence |
|---|---|---|
| Erβ | Forward | GAAGCTGAACCACCCAATGT |
| Reverse | CAGTCCCACCATTAGCACCT | |
| Srebp-1c | Forward | CTGTCGTCTACCATAAGCTGCAC |
| Reverse | ATAGCATCTCCTGCACACTCAGC | |
| Acc | Forward | AACATCCCGCACCTTCTTCTAC |
| Reverse | CTTCCACAAACCAGCGTCTC | |
| Fasn | Forward | TCCCAGGTCTTGCCGTGC |
| Reverse | GCGGATGCCTAGGATGTGTGC | |
| Cd36 | Forward | GATGACGTGGCAAAGAACAG |
| Reverse | TCCTCGGGGTCCTGAGTTAT | |
| Tgf-βI | Forward | GACGTTCGCCATAACCAAGT |
| Reverse | CTGCAGGTTCTCAATGCAAA | |
| Tgf-βII | Forward | CCAATCACGCAATAGTTCTGG |
| Reverse | CGCTGTATCGTATGGCGAT | |
| Aqp-1 | Forward | CCTGCTGGCCATTGACTACA |
| Reverse | TGGTTTGAGAAGTTGCGGGT | |
| Aqp-5 | Forward | CATGAACCCAGCCCGATCTT |
| Reverse | AGAAGACCCAGTGAGAGGGG | |
| Amy-1 | Forward | GCAACCAAGTAGCTTTTGGCA |
| Reverse | TGCCATCGACTTTGTCTCCAG | |
| Muc-1 | Forward | GAGTGAATATCCTACGACCAC |
| Reverse | TTCACCAGGCTAACGTGGTGAC | |
| Gapdh | Forward | ACCCCCAATGTATCCGTTGT |
| Reverse | TACTCCTTGGAGGCCATGTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, J.-M.; Shin, S.-C.; Cheon, Y.-I.; Kim, H.-S.; Park, G.-C.; Kim, H.-K.; Han, J.; Seol, J.-E.; Vasileva, E.A.; Mishchenko, N.P.; et al. Effect of Echinochrome A on Submandibular Gland Dysfunction in Ovariectomized Rats. Mar. Drugs 2022, 20, 729. https://doi.org/10.3390/md20120729
Kim J-M, Shin S-C, Cheon Y-I, Kim H-S, Park G-C, Kim H-K, Han J, Seol J-E, Vasileva EA, Mishchenko NP, et al. Effect of Echinochrome A on Submandibular Gland Dysfunction in Ovariectomized Rats. Marine Drugs. 2022; 20(12):729. https://doi.org/10.3390/md20120729
Chicago/Turabian StyleKim, Ji-Min, Sung-Chan Shin, Yong-Il Cheon, Hyung-Sik Kim, Gi-Cheol Park, Hyoung-Kyu Kim, Jin Han, Jung-Eun Seol, Elena A. Vasileva, Natalia P. Mishchenko, and et al. 2022. "Effect of Echinochrome A on Submandibular Gland Dysfunction in Ovariectomized Rats" Marine Drugs 20, no. 12: 729. https://doi.org/10.3390/md20120729
APA StyleKim, J.-M., Shin, S.-C., Cheon, Y.-I., Kim, H.-S., Park, G.-C., Kim, H.-K., Han, J., Seol, J.-E., Vasileva, E. A., Mishchenko, N. P., Fedoreyev, S. A., Stonik, V. A., & Lee, B.-J. (2022). Effect of Echinochrome A on Submandibular Gland Dysfunction in Ovariectomized Rats. Marine Drugs, 20(12), 729. https://doi.org/10.3390/md20120729

