Search Results (5)

Pseudomonas aeruginosa and Klebsiella pneumoniae are notorious for their resistance to antibiotics and propensity for biofilm formation, posing significant threats to human health. Epsilon-poly-L-lysine (ε-PL) emerges as a naturally occurring antimicrobial poly(amino acid), which positions it as a prospective agent for addressing challenges linked to multidrug resistance. ε-PL symbolizes a promising avenue in the pursuit of efficacious therapeutic strategies and warrants earnest consideration within the realm of clinical treatment. Thus, our objective was to determine the antibiotic susceptibility profiles of 38 selected P. aeruginosa and ESBL-producing K. pneumoniae clinical isolates and determine the ability of ε-PL to inhibit biofilm formation. After PCR analysis, detection of genes related to β-lactamases was observed among the selected isolates of P. aeruginosa [bla_SPM (35.7%), bla_KPC (35.7%), bla_SHV (14.3%), bla_CTX-M (14.3%), bla_OXA (14.3%), bla_TEM (7.1%), bla_PER (7.1%), bla_VIM (7.1%), and bla_VIM-2 (7.1%)] and K. pneumoniae [bla_CTX-M (91.7%), bla_TEM (83.3%), bla_KPC (16.7%), bla_NDM (12.5%), and bla_OXA (4.2%)]. The results of testing the activity of ε-PL against the clinical isolates showed relatively high minimum inhibitory concentrations (MICs) for the P. aeruginosa (range: 8–64 µg/mL) and K. pneumoniae isolates (range: 16–32 µg/mL). These results suggest the need for prior optimization of ε-PL concerning its viability as an alternative to antibiotics for treating infections caused by P. aeruginosa and K. pneumoniae of clinical origin. It is noteworthy that, in the context of a low antibiotic discovery rate, ε-PL could play a significant role in this quest, considering its low toxicity and the unlikely development of resistance. Upon exposure to ε-PL, P. aeruginosa and K. pneumoniae isolates exhibited a reduction in biofilm production, with ε-PL concentration showing an inverse relationship, particularly in isolates initially characterized as strong or moderate producers, indicating its potential as a natural antimicrobial agent with further research needed to elucidate optimal concentrations and application methods across different bacterial species. Further research is needed to optimize its use and explore its potential in various applications. Full article

Antimicrobial resistance has become a major problem over the years and threatens to remain in the future, at least until a solution is found. Silver nanoparticles (Ag-NPs) and antimicrobial polymers (APs) are known for their antimicrobial properties and can be considered an alternative approach to fighting resistant microorganisms. Hence, the main goal of this research is to shed some light on the antimicrobial properties of Ag-NPs and APs (chitosan (CH), poly-L-lysine (PLL), ε-poly-L-lysine (ε-PLL), and dopamine (DA)) when used alone and complexed to explore the potential enhancement of the antimicrobial effect of the combination Ag-NPs + Aps. The resultant nanocomplexes were chemically and morphologically characterized by UV-visible spectra, zeta potential, transmission electron microscopy, and Fourier-transform infrared spectroscopy. Moreover, the Ag-NPs, APs, and Ag-NPs + APs nanocomplexes were tested against Gram-positive Staphylococcus aureus (S. aureus) and the Gram-negative Escherichia coli (E. coli) bacteria, as well as the fungi Candida albicans (C. albicans). Overall, the antimicrobial results showed potentiation of the activity of the nanocomplexes with a focus on C. albicans. For the biofilm eradication ability, Ag-NPs and Ag-NPs + DA were able to significantly remove S. aureus preformed biofilm, and Ag-NPs + CH were able to significantly destroy C. albicans biofilm, with both performing better than Ag-NPs alone. Overall, we have proven the successful conjugation of Ag-NPs and APs, with some of these formulations showing potential to be further investigated for the treatment of microbial infections. Full article

With increasing human awareness of food safety, the replacement of highly toxic pesticides with biocompatible antimicrobials has become a trend. This study proposes a biocontrol microneedle (BMN) to expand the application of the food-grade preservative epsilon-poly-L-lysine (ε-PL) in fruit preservatives by utilizing a dissolving microneedle system. The macromolecular polymer ε-PL not only possesses broad-spectrum antimicrobial activity but also exhibits good mechanical properties. With the addition of a small amount of polyvinyl alcohol, the mechanical strength of the ε-PL-based microneedle patch could be further improved to achieve an enhanced failure force of needles at 1.6 N/needle and induce an approximately 96% insertion rate in citrus fruit pericarps. An ex vivo insertion test revealed that the microneedle tips could be effectively inserted into the citrus fruit pericarp, rapidly dissolve within 3 min, and produce inconspicuous needle holes. Moreover, the high drug loading capacity of BMN was observed to reach approximately 1890 μg/patch, which is essential for enhancing the concentration-dependent antifungal activity of ε-PL. The drug distribution study has confirmed the feasibility of mediating the local diffusion of EPL in the pericarp through BMN. Therefore, BMN has great potential to reduce the incidence of invasive fungal infections in local areas of citrus fruit pericarp. Full article

A mixed culture (polymicrobial) biofilm provides a favorable environment for pathogens to persist in the food processing environment and to contaminate food products. Inactivation and eradication of such biofilms from food processing environments are achieved by using harsh disinfectants, but their toxicity and environmentally hostile characteristics are unsustainable. This study aims to use food-grade natural nanoparticulated antimicrobials to control mixed-culture biofilms. Chitosan, a natural broad-spectrum antimicrobial biopolymer (polysaccharide) from crustaceans, was derivatized to produce chitosan nanoparticles (ChNP) as a carrier for another broad-spectrum antimicrobial agent, ε-poly-L-lysine (PL), to synthesize ChNP-PL conjugate. The antimicrobial activity of ChNP and ChNP-PL was tested against mixed-culture biofilms. ChNP-PL (~100 nm) exhibited a synergistic antimicrobial and anti-biofilm effect against mono or mixed-culture biofilms of five foodborne pathogens, including Listeria monocytogenes, Staphylococcus aureus, Salmonella enterica serovar Enteritidis, Escherichia coli O157:H7, and Pseudomonas aeruginosa. ChNP-PL treatment prevented biofilm formation by mono or mixed cultures of L. monocytogenes, P. aeruginosa, and E. coli O157:H7, and bacterial counts were either below the detection limit or caused 3.5–5 log reduction. ChNP-PL also inactivated preformed biofilms. In monoculture biofilm, ChNP-PL treatment reduced L. monocytogenes counts by 4.5 logs, S. Enteritidis by 2 logs, E. coli by 2 logs, and S. aureus by 0.5 logs, while ChNP-PL had no inhibitory effect on P. aeruginosa. In vitro mammalian cell-based cytotoxicity analysis confirmed ChNP-PL to have no deleterious effect on intestinal HCT-8 cell line. In conclusion, our results show ChNP-PL has strong potential to prevent the formation or inactivation of preformed polymicrobial biofilms of foodborne pathogens. Full article

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies. Full article