Functional Characterization and Evolutionary Analysis of Glycine-Betaine Biosynthesis Pathway in Red Seaweed Pyropia yezoensis
Abstract
:1. Introduction
2. Results
2.1. GB Contents in Dehydrated P. yezoensis Blades
2.2. GB Biosynthesis Pathway in P. yezoensis
2.3. Transcriptional Variations of CDH, BADH, and PEAMT Genes Under Dehydration
2.4. CDH Activity under Dehydration Stress in P. yezoensis Seaweeds
3. Discussion
4. Materials and Methods
4.1. Algal Material and Stress Treatment
4.2. RNA Isolation and cDNA Synthesis
4.3. Quantitative Real-Time PCR (RT-PCR)
4.4. GB Extraction and Liquid Chromatography Analysis
4.5. Detecting Content of GB
4.6. Determination of Choline Dehydrogenase Activity
4.7. Statistics
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Abraham, B. Effective use of water (EUW) and not water-use efficiency (WUE) is the target of crop yield improvement under drought stress. Field Crops Res. 2009, 112, 119–123. [Google Scholar] [CrossRef]
- Chaves, M.M.; Maroco, J.P.; Pereira, J.S. Understanding plant responses to drought – from genes to the whole plant. Funct. Plant Biol. 2003, 30, 239–264. [Google Scholar] [CrossRef]
- Reynolds, M.; Foulkes, J.; Furbank, R.; Griffiths, S.; King, J.; Murchie, E.; Parry, M.; Slafer, G. Achieving yield gains in wheat. Plant Cell Environ. 2012, 35, 1799–1823. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, G.H.; Ren, D.L.; Wang, X.Q.; Wu, J.K.; Zhao, M.S. Evaluation on drought tolerance of maize hybrids in China. J. Maize Sci. 2010, 3, 20–24. [Google Scholar] [CrossRef]
- Ashraf, M. Review Inducing drought tolerance in plants: Recent advances. Biotechnol. Adv. 2010, 28, 169–183. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, R.; Kim, M.D.; Back, K.H.; Kim, H.S.; Lee, H.S.; Kwon, S.Y.; Murata, N.; Chung, W.I.; Kwak, S.S. Stress-induced expression of choline oxidase in potato plant chloroplasts confers enhanced tolerance to oxidative, salt, and drought stresses. Plant Cell Rep. 2008, 27, 687–698. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.H.; Murata, N. Enhancement of tolerance to abiotic stress by metabolic engineering of betaines and other compatible solutes. Curr. Opin. Plant Biol. 2002, 5, 250–257. [Google Scholar] [CrossRef]
- Takabe, T.; Rai, V.; Hibino, T. Metabolic engineering of glycinebetaine. In Abiotic Stress Tolerance in Plants: Toward the Improvement of Global Environment and Food; Springer: Dordrecht, The Netherlands, 2006; pp. 137–151. [Google Scholar]
- Chen, T.H.; Murata, N. Glycinebetaine: An effective protectant against abiotic stress in plants. Trends Plant Sci. 2008, 13, 499–505. [Google Scholar] [CrossRef]
- Yang, X.; Liang, Z.; Lu, C. Genetic engineering of the biosynthesis of glycine betaine enhances photosynthesis against high temperature stress in transgenic tobacco plants. Plant Physiol. 2005, 138, 2299–2309. [Google Scholar] [CrossRef]
- Yang, X.; Wen, X.; Gong, H.; Lu, Q.; Yang, Z.; Tang, Y.; Liang, Z.; Lu, C. Genetic engineering of the biosynthesis of glycinebetaine enhances thermo tolerance of photosystem II in tobacco plants. Planta 2007, 225, 719–733. [Google Scholar] [CrossRef]
- Carillo, P.; Mastrolonardo, G.; Nacca, F.; Parisi, D.; Verlotta, A.; Fuggi, A. Nitrogen metabolism in durum wheat under salinity: Accumulation of proline and glycine betaine. Funct. Plant Biol. 2008, 35, 412–426. [Google Scholar] [CrossRef]
- Kewei, Z.; Juan, W.; Lijun, L.; Wenju, F.; Ning, G.; Sulian, L. Increased Chilling Tolerance Following Transfer of a betA Gene Enhancing Glycinebetaine Synthesis in Cotton (Gossypium hirsutum L.). Plant Mol. Biol. Rep. 2012, 30, 1158–1171. [Google Scholar] [CrossRef]
- Rontein, D.; Basset, G.; Hanson, A.D. Metabolic engineering of osmoprotectant accumulation in plants. Metab. Eng. 2002, 4, 49–56. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.H.; Murata, N. Glycinebetaine protects plants against abiotic stress: Mechanisms and biotechnological applications. Plant Cell Environ. 2015, 34, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Rathinasabapathi, B.; Burnet, M.; Russell, B.L.; Gage, D.A.; Liao, P.O.; Nye, G.J.; Scott, P.; Golbeck, J.H.; Hanson, A.D. Choline monooxygenase, an unusual iron–sulfur enzyme catalyzing the first step of glycine betaine synthesis in plants: Prosthetic group characterization and cDNA cloning. Proc. Natl. Acad. Sci. USA 1997, 94, 3454–3458. [Google Scholar] [CrossRef] [PubMed]
- Burnet, M.; Lafontaine, P.J.; Hanson, A.D. Assay, purification, and partial characterization of choline monooxygenase from spinach. Plant Physiol. 1995, 108, 581–588. [Google Scholar] [CrossRef]
- Salvi, F.; Gadda, G. Human choline dehydrogenase: Medical promises and biochemical challenges. Arch. Biochem. Biophys. 2013, 537, 243–252. [Google Scholar] [CrossRef]
- Kageyama, H.; Tanaka, Y.; Takabe, T.T. Biosynthetic pathways of glycinebetaine in Thalassiosira pseudonana; functional characterization of enzyme catalyzing three-step methylation of glycine. Plant Physiol. Biochem. 2018, 127, 248–255. [Google Scholar] [CrossRef]
- McNeil, S.D.; Nuccio, M.L.; Ziemak, M.J.; Hanson, A.D. Enhanced synthesis of choline and glycine betaine in transgenic tobacco plants that overexpress phosphoethanolamine N-methyltransferase. Proc. Natl. Acad. Sci. USA 2001, 98, 10001–10005. [Google Scholar] [CrossRef] [Green Version]
- Lorenzin, D.; Webb, C.; Summers, P.S.; Weretilnyk, E.A. Enzymes of choline synthesis in diverse plants: Variation in phosphobase N-methyltransferase activities. Can. J. Bot. 2001, 79, 897–904. [Google Scholar] [CrossRef]
- Waditee, R.; Bhuiyan, M.N.H.; Rai, V.; Aoki, K.; Tanaka, Y.; Hibino, T.; Suzuki, S.; Takano, J.; Jagendorf, A.T.; Takabe, T.; et al. Genes for direct methylation of glycine provide high levels of glycine betaine and abiotic-stress tolerance in Synechococcus and Arabidopsis. Proc. Natl. Acad. Sci. USA 2005, 102, 1318–1323. [Google Scholar] [CrossRef] [PubMed]
- Waditee-Sirisattha, R.; Singh, M.; Kageyama, H.; Sittipol, D.; Rai, A.K.; Takabe, T. Anabaena sp. PCC7120 transformed with glycine methylation genes from Aphanothece halophytica synthesized glycine betaine showing tolerance to salt. Arch. Microbiol. 2012, 194, 909–914. [Google Scholar] [CrossRef] [PubMed]
- Sutherland, J.E.; Lindstrom, S.C.; Nelson, W.A.; Brodie, J.; Lynch, M.D.J.; Hwang, M.S.; Choi, H.; Miyata, M.; Kikuchi, N.; Oliveira, M.C.; et al. A new look at an ancient order: Generic revision of the Bangiales (Rhodophyta). J. Phycol. 2011, 47, 1131–1151. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Chen, C.; Ji, D.; Hang, N.; Xie, C. Proteomic profile analysis of Pyropia haitanensis in response to high-temperature stress. J. Appl. Phycol. 2014, 26, 607–618. [Google Scholar] [CrossRef]
- Blouin, N.A.; Brodie, J.A.; Grossman, A.C.; Xu, P.; Brawley, S.H. Porphyra: A marine crop shaped by stress. Trends Plant Sci. 2011, 16, 29–37. [Google Scholar] [CrossRef] [PubMed]
- Weretilnyk, E.A.; Hanson, A.D. Molecular cloning of a plant betaine-aldehyde dehydrogenase, an enzyme implicated in adaption to salinity and drought. Proc. Natl. Acad. Sci. USA 1990, 87, 2745–2749. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.K.; Kraemer, G.P.; Yarish, C. Comparison of growth and nitrate uptake by New England Porphyra species from different tidal elevations in relation to desiccation. Phycol. Res. 2009, 57, 152–157. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 22DDCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Gene | GenBank Entry | ORF (bp) | Amino Acids | Conserved Domain |
---|---|---|---|---|
PyCDH1 | MK294537 | 3092 | 679 | GMC-oxred_N |
PyCDH2 | MK294538 | 1761 | 586 | GMC-oxred_N |
PyCDH3 | MK294539 | 2289 | 762 | GMC-oxred_N |
PyCDH4 | MK294540 | 1710 | 557 | GMC-oxred_N |
PyCDH5 | MK294541 | 1955 | 569 | GMC-oxred_N |
PyCDH6 | MK294542 | 2291 | 572 | GMC-oxred_N |
PyCDH7 | MK294543 | 1620 | 539 | GMC-oxred_N |
Primer Name | GenBank Entry | Sequence Information (5′–3′) |
---|---|---|
BADH | MK294535 | F: GCGTCCCTGCGAGCCACTCAC R: CCGTGTCAAAGGGGATAACCGT |
PEAMT | MK294536 | F: CTCTTCGCACCCGTGACCTG R: TGTCCAGGTAGGCGTCCGAG |
CDH-1 | MK294537 | F: GAACCGTTTTCGCCCTATCGC R: CGCCACGCCCTTGACCC |
CDH-2 | MK294538 | F: CCGCATTGTCTGGGCTGCA R: GACGCATCAACCACCCACAAGT |
CDH-3 | MK294539 | F: GCGGTGGGCACCTGCCGGAT R: GGCGTTGGTGTTGCCACTCC |
CDH-4 | MK294540 | F: CCGAGTGACCACAGGCGA R: AGCAGGTTGGTCTCCACACG |
UBC | ACI47322.1 | F: TCACAACGAGGATTTACCACC R: GAGGAGCACCTTGGAAACG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mao, Y.; Chen, N.; Cao, M.; Chen, R.; Guan, X.; Wang, D. Functional Characterization and Evolutionary Analysis of Glycine-Betaine Biosynthesis Pathway in Red Seaweed Pyropia yezoensis. Mar. Drugs 2019, 17, 70. https://doi.org/10.3390/md17010070
Mao Y, Chen N, Cao M, Chen R, Guan X, Wang D. Functional Characterization and Evolutionary Analysis of Glycine-Betaine Biosynthesis Pathway in Red Seaweed Pyropia yezoensis. Marine Drugs. 2019; 17(1):70. https://doi.org/10.3390/md17010070
Chicago/Turabian StyleMao, Yunxiang, Nianci Chen, Min Cao, Rui Chen, Xiaowei Guan, and Dongmei Wang. 2019. "Functional Characterization and Evolutionary Analysis of Glycine-Betaine Biosynthesis Pathway in Red Seaweed Pyropia yezoensis" Marine Drugs 17, no. 1: 70. https://doi.org/10.3390/md17010070