Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum
Abstract
1. Introduction

2. Results
2.1. Phylogenetic Analyses of P. tricornutum Strain NRIA-0065
2.2. RNA-Seq Analysis of P. tricornutum and Sequence Analysis of P. tricornutum PSY


2.3. Screening of Transformants


2.4. Analysis of mRNA Expression of the Introduced PSY Gene in the P. tricornutum Transformants

2.5. HPLC Analysis of Extracted Carotenoids


2.6. Localization of eGFP-Fused PSY and the Number of Integrated Copies in the Transformants

3. Discussion
4. Experimental Section
4.1. Algal Culture
4.2. Genomic DNA and RNA-Seq Analysis
4.3. Screening of PSY Gene in P. tricornutum Strain NRIA-0065
4.4. Isolation of PSY Gene
4.5. Joint PCR for the Fusion of the PSY Gene and the EGFP Gene
4.6. Transformation Vector Construction
| Primer Number | Name | Sequence (5′–3′) | Annotation |
|---|---|---|---|
| 1 | PtPSY-(attB4r)F | ggggacaacttttctatacaaagttgctATGAAAGTTTCGACAAAGCTCTG | add att to 5′ terminal of Ptpsy |
| 2 | PtPSY-(Gx5)R | tccacctccgcctccTACTTGATCCAATTGGACC | add Gx5 linker to 3′ terminal of Ptpsy |
| 3 | PtfcpA Pro-(attB1)F | ggggacaagtttgtacaaaaaagcaggcttaGGGCTGCAGGACGCAATGGAG | add att to 5′ terminal of PtfcpA promoter |
| 4 | PtfcpA Pro-(attB4)R | ggggacaactttgtatagaaaagttgggtgTCTCGAAACGGCAGACAA | add att to 3′ terminal of PtfcpA promoter |
| 5 | CffcpTer/F/attB3 | ggggacaactttgtataataaagttgTGCGGCCGCATTGCTTGTTG | add att to 5′ terminal of CffcpA terminator |
| 6 | CffcpTer/R/attB2 | ggggaccactttgtacaagaaagctgggtGAGCTCTGGAAGCAT | add att to 3′ terminal of CffcpA terminator |
| 7 | EGFP-(Gx5)F | ggaggcggaggtggaATGGTGAGCAAGGGCGAGGAGCT | add Gx5 linker to 5′ terminal of egfp |
| 8 | EGFP-(B3r)R | ggggacaactttattatacaaagttgtTTACTTGTACAGCTCGTCC | add att to 3′ terminal of egfp |
| 9 | EGFP(qPCR)-R | CACGAACTCCAGCAGGACCA | used for genomic PCR analysis |
| 10 | PtPSY(qPCR)-F | ATGTTTGGTGTCGACGAACG | detect endogenous and introduced psy |
| 11 | PtPSY(qPCR)-R | TTGCCACAAACGCTCCAATC | detect endogenous and introduced psy |
| 12 | PtPSY-Gx5-EGFP(qPCR)-F | GGACGCAAGACATTTCTCAATGG | detect introduced psy |
| 13 | PtPSY-Gx5-EGFP(qPCR)-R | TCGCCCTTGCTCACCATTC | detect introduced psy |
| 14 | Q-rps-fw | CGAAGTCAACCAGGAAACCAA | detect rps |
| 15 | Q-rps-rv | GTGCAAGAGACCGGACATACC | detect rps |
4.7. Microparticle Bombardment and Selection of Transformants
4.8. Microscopic Analysis
4.9. PCR Analysis of the Introduced Gene and Promoter in Transformed Cells
4.10. Preparation of Cells Used for qRT-PCR and Carotenoid Analyses of Transformants
4.11. Quantitative RT-PCR
4.12. Carotenoid Extraction and Analysis
4.13. Genomic Quantitative Real-Time PCR
4.14. Statistical Analyses
5. Conclusions
Supplementary Files
Supplementary File 1Acknowledgments
Author Contributions
Conflicts of Interest
References
- Mann, D.G.; Droop, S.J.M. Biodiversity, biogeography and conservation of diatoms. Hydrobiologia 1996, 336, 19–32. [Google Scholar] [CrossRef]
- Nelson, D.M.; Treguer, P.; Brzezinski, M.A.; Leynaert, A.; Queguiner, B. Production and dissolution of biogenic silica in the ocean: Revised global estimates, comparison with regional data and relationship to biogenic sedimentation. Global Biogeochem. Cycle 1995, 9, 359–372. [Google Scholar] [CrossRef]
- Falkowski, P.G.; Katz, M.E.; Knoll, A.H.; Quigg, A.; Raven, J.A.; Schofield, O.; Taylor, F.J. The evolution of modern eukaryotic phytoplankton. Science 2004, 305, 354–360. [Google Scholar] [CrossRef] [PubMed]
- Martin-Jézéquel, V.; Hildebrand, M.; Brzezinski, M.A. Silicon metabolism in diatoms: Implications for growth. J. Phycol. 2000, 36, 821–840. [Google Scholar] [CrossRef]
- Pulz, O.; Gross, W. Valuable products from biotechnology of microalgae. Appl. Microbiol. Biotechnol. 2004, 65, 635–648. [Google Scholar] [CrossRef] [PubMed]
- Armbrust, E.V.; Berges, J.A.; Bowler, C.; Green, B.R.; Martinez, D.; Putnam, N.H.; Zhou, S.; Allen, A.E.; Apt, K.E.; Bechner, M.; et al. The genome of the diatom Thalassiosira pseudonana: Ecology, evolution, and metabolism. Science 2004, 306, 79–86. [Google Scholar] [CrossRef] [PubMed]
- Bowler, C.; Allen, A.E.; Badger, J.H.; Grimwood, J.; Jabbari, K.; Kuo, A.; Maheswari, U.; Martens, C.; Maumus, F.; Otillar, R.P.; et al. The Phaeodactylum genome reveals the evolutionary history of diatom genomes. Nature 2008, 456, 239–244. [Google Scholar] [CrossRef] [PubMed]
- Maheswari, U.; Montsant, A.; Goll, J.; Krishnasamy, S.; Rajyashri, K.R.; Patell, V.M.; Bowler, C. The Diatom EST Database. Nucleic Acids Res. 2005, 33, D344–D347. [Google Scholar] [CrossRef] [PubMed]
- JGI Genome Home Page. Available online: http://jgi.doe.gov/ (accessed on 30 June 2015).
- Apt, K.E.; Kroth-Pancic, P.G.; Grossman, A.R. Stable nuclear transformation of the diatom Phaeodactylum tricornutum. Mol. Gen. Genet. 1996, 252, 572–579. [Google Scholar] [PubMed]
- Zaslavskaia, L.A.; Casey Lippmeier, J.; Kroth, P.G.; Grossman, A.R.; Apt, K.E. Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes. J. Phycol. 2000, 36, 379–386. [Google Scholar] [CrossRef]
- Miyagawa, A.; Okami, T.; Kira, N.; Yamaguchi, H.; Ohnishi, K.; Adachi, M. Research note: High efficiency transformation of the diatom Phaeodactylum tricornutum with a promoter from the diatom Cylindrotheca fusiformis. Phycological Res. 2009, 57, 142–146. [Google Scholar] [CrossRef]
- Miyahara, M.; Aoi, M.; Inoue-Kashino, N.; Kashino, Y.; Ifuku, K. Highly efficient transformation of the diatom Phaeodactylum tricornutum by multi-pulse electroporation. Biosci. Biotechnol. Biochem. 2013, 77, 874–876. [Google Scholar] [CrossRef] [PubMed]
- Fischer, H.; Robl, I.; Sumper, M.; Kröger, N. Targeting and covalent modification of cell wall and membrane proteins heterologously expressed in the diatom Cylindrotheca fusiformis (Bacillariophyceae). J. Phycol. 1999, 35, 113–120. [Google Scholar] [CrossRef]
- Poulsen, N.; Kröger, N. A new molecular tool for transgenic diatoms: Control of mRNA and protein biosynthesis by an inducible promoter-terminator cassette. FEBS J. 2005, 272, 3413–3423. [Google Scholar] [CrossRef] [PubMed]
- Dunahay, T.G.; Jarvis, E.E.; Roessler, P.G. Genetic transformation of the diatoms Cyclotella cryptia and Navicula saprophila. J. Phycol. 1995, 31, 1004–1012. [Google Scholar] [CrossRef]
- Sabatino, V.; Russo, M.T.; Patil, S.; d'Ippolito, G.; Fontana, A.; Ferrante, M.I. Establishment of genetic transformation in the sexually reproducing diatoms Pseudo-nitzschia multistriata and Pseudo-nitzschia arenysensis and inheritance of the transgene. Mar. Biotechnol. 2015, 17, 452–462. [Google Scholar] [CrossRef] [PubMed]
- Poulsen, N.; Chesley, P.M.; Kröger, N. Molecular genetic manipulation of the diatom Thalassiosira pseudonana (Bacillariophyceae). J. Phycol. 2006, 42, 1059–1065. [Google Scholar] [CrossRef]
- Falciatore, A.; Casotti, R.; Leblanc, C.; Abrescia, C.; Bowler, C. Transformation of nonselectable reporter genes in marine diatoms. Mar. Biotechnol. 1999, 1, 239–251. [Google Scholar] [CrossRef] [PubMed]
- Miyagawa-Yamaguchi, A.; Okami, T.; Kira, N.; Yamaguchi, H.; Ohnishi, K.; Adachi, M. Stable nuclear transformation of the diatom Chaetoceros sp. Phycol. Res. 2011, 59, 113–119. [Google Scholar] [CrossRef]
- Ifuku, K.; Yan, D.; Miyahara, M.; Inoue-Kashino, N.; Yamamoto, Y.Y.; Kashino, Y. A stable and efficient nuclear transformation system for the diatom Chaetoceros gracilis. Photosynth. Res. 2015, 123, 203–211. [Google Scholar] [CrossRef] [PubMed]
- Muto, M.; Fukuda, Y.; Nemoto, M.; Yoshino, T.; Matsunaga, T.; Tanaka, T. Establishment of a genetic transformation system for the marine pennate diatom Fistulifera sp. strain JPCC DA0580—A high triglyceride producer. Mar. Biotechnol. 2013, 15, 48–55. [Google Scholar] [CrossRef] [PubMed]
- De Riso, V.; Raniello, R.; Maumus, F.; Rogato, A.; Bowler, C.; Falciatore, A. Gene silencing in the marine diatom Phaeodactylum tricornutum. Nucleic Acids Res. 2009, 37, e96. [Google Scholar] [CrossRef] [PubMed]
- Sakaguchi, T.; Nakajima, K.; Matsuda, Y. Identification of the UMP synthase gene by establishment of uracil auxotrophic mutants and the phenotypic complementation system in the marine diatom Phaeodactylum tricornutum. Plant Physiol. 2011, 156, 78–89. [Google Scholar] [CrossRef] [PubMed]
- Lavaud, J.; Materna, A.C.; Sturm, S.; Vugrinec, S.; Kroth, P.G. Silencing of the violaxanthin de-epoxidase gene in the diatom Phaeodactylum tricornutum reduces diatoxanthin synthesis and non-photochemical quenching. PLoS ONE 2012, 7, e36806. [Google Scholar] [CrossRef] [PubMed]
- Daboussi, F.; Leduc, S.; Maréchal, A.; Dubois, G.; Guyot, V.; Perez-Michaut, C.; Amato, A.; Falciatore, A.; Juillerat, A.; Beurdeley, M.; et al. Genome engineering empowers the diatom Phaeodactylum tricornutum for biotechnology. Nat. Commun. 2014, 5, 3831. [Google Scholar] [CrossRef] [PubMed]
- Weyman, P.D.; Beeri, K.; Lefebvre, S.C.; Rivera, J.; McCarthy, J.K.; Heuberger, A.L.; Peers, G.; Allen, A.E.; Dupont, C.L. Inactivation of Phaeodactylum tricornutum urease gene using transcription activator-like effector nuclease-based targeted mutagenesis. Plant Biotechnol. J. 2014, 13, 460–470. [Google Scholar] [CrossRef] [PubMed]
- Radakovits, R.; Eduafo, P.M.; Posewitz, M.C. Genetic engineering of fatty acid chain length in Phaeodactylum tricornutum. Metab. Eng. 2011, 13, 89–95. [Google Scholar] [CrossRef] [PubMed]
- Niu, Y.F.; Zhang, M.H.; Li, D.W.; Yang, W.D.; Liu, J.S.; Bai, W.B.; Li, H.Y. Improvement of neutral lipid and polyunsaturated fatty acid biosynthesis by overexpressing a type 2 diacylglycerol acyltransferase in marine diatom Phaeodactylum tricornutum. Mar. Drugs 2013, 11, 4558–4569. [Google Scholar] [CrossRef] [PubMed]
- Hamilton, M.L.; Haslam, R.P.; Napier, J.A.; Sayanova, O. Metabolic engineering of Phaeodactylum tricornutum for the enhanced accumulation of omega-3 long chain polyunsaturated fatty acids. Metab. Eng. 2014, 22, 3–9. [Google Scholar] [CrossRef] [PubMed]
- Hempel, F.; Bozarth, A.S.; Lindenkamp, N.; Klingl, A.; Zauner, S.; Linne, U.; Steinbuchel, A.; Maier, U.G. Microalgae as bioreactors for bioplastic production. Microb. Cell Fact. 2011, 10, 81. [Google Scholar] [CrossRef] [PubMed]
- Hempel, F.; Maier, U.G. An engineered diatom acting like a plasma cell secreting human IgG antibodies with high efficiency. Microb. Cell Fact. 2012, 11, 126. [Google Scholar] [CrossRef] [PubMed]
- Lichtenthaler, H.K. Evolution of carotenoid and isoprenoid biosynthesis in photosynthetic and non-photosynthetic organisms. In Proceedings of the 16th Plant Lipid Symposium, Budapest, Hungary, 1–4 June 2004; Biacs, P., Gercly, P., Eds.; Mete Publisher: Budapest, Hungary, 2004; pp. 11–24. [Google Scholar]
- Durnford, D.G.; Deane, J.A.; Tan, S.; McFadden, G.I.; Gantt, E.; Green, B.R. A phylogenetic assessment of the eukaryotic light-harvesting antenna proteins, with implications for plastid evolution. J. Mol. Evol. 1999, 48, 59–68. [Google Scholar] [CrossRef] [PubMed]
- Siefermann-Harms, D. The light-harvesting and protective functions of carotenoids in photosynthetic membranes. Physiol. Plant. 1987, 69, 561–568. [Google Scholar] [CrossRef]
- Ramel, F.; Birtic, S.; Cuine, S.; Triantaphylides, C.; Ravanat, J.L.; Havaux, M. Chemical quenching of singlet oxygen by carotenoids in plants. Plant Physiol. 2012, 158, 1267–1278. [Google Scholar] [CrossRef] [PubMed]
- Van den Berg, H.; Faulks, R.; Granado, H.F.; Hirschberg, J.; Olmedilla, B.; Sandmann, G.; Southon, S.; Stahl, W. The potential for the improvement of carotenoid levels in foods and the likely systemic effects. J. Sci. Food Agric. 2000, 80, 880–912. [Google Scholar] [CrossRef]
- Bertrand, M. Carotenoid biosynthesis in diatoms. Photosynth. Res. 2010, 106, 89–102. [Google Scholar] [CrossRef] [PubMed]
- Coesel, S.; Obornik, M.; Varela, J.; Falciatore, A.; Bowler, C. Evolutionary origins and functions of the carotenoid biosynthetic pathway in marine diatoms. PLoS ONE 2008, 3, e2896. [Google Scholar] [CrossRef] [PubMed]
- Dambek, M.; Eilers, U.; Breitenbach, J.; Steiger, S.; Büchel, C.; Sandmann, G. Biosynthesis of fucoxanthin and diadinoxanthin and function of initial pathway genes in Phaeodactylum tricornutum. J. Exp. Bot. 2012, 63, 5607–5612. [Google Scholar] [CrossRef] [PubMed]
- Hemmerlin, A. Post-translational events and modifications regulating plant enzymes involved in isoprenoid precursor biosynthesis. Plant Sci. 2013, 203, 41–54. [Google Scholar] [CrossRef] [PubMed]
- Lohr, M.; Schwender, J.; Polle, J.E. Isoprenoid biosynthesis in eukaryotic phototrophs: A spotlight on algae. Plant Sci. 2012, 185, 9–22. [Google Scholar] [CrossRef] [PubMed]
- Mikami, K.; Hosokawa, M. Biosynthetic pathway and health benefits of fucoxanthin, an algae-specific xanthophyll in brown seaweeds. Int. J. Mol. Sci. 2013, 14, 13763–13781. [Google Scholar] [CrossRef] [PubMed]
- Vranová, E.; Coman, D.; Gruissem, W. Network analysis of the MVA and MEP pathways for isoprenoid synthesis. Annu. Rev. Plant Biol. 2013, 64, 665–700. [Google Scholar] [CrossRef] [PubMed]
- Guedes, A.C.; Amaro, H.M.; Malcata, F.X. Microalgae as sources of carotenoids. Mar. Drugs 2011, 9, 625–644. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.M.; Jung, Y.J.; Kwon, O.N.; Cha, K.H.; Um, B.H.; Chung, D.; Pan, C.H. A potential commercial source of fucoxanthin extracted from the microalga Phaeodactylum tricornutum. Appl. Biochem. Biotechnol. 2012, 166, 1843–1855. [Google Scholar] [CrossRef] [PubMed]
- Cazzonelli, C.I.; Pogson, B.J. Source to sink: Regulation of carotenoid biosynthesis in plants. Trends Plant Sci. 2010, 15, 266–274. [Google Scholar] [CrossRef] [PubMed]
- Shewmaker, C.K.; Sheehy, J.A.; Daley, M.; Colburn, S.; Ke, D.Y. Seed-specific overexpression of phytoene synthase: Increase in carotenoids and other metabolic effects. Plant J. 1999, 20, 401–412. [Google Scholar] [CrossRef] [PubMed]
- Fraser, P.D.; Romer, S.; Shipton, C.A.; Mills, P.B.; Kiano, J.W.; Misawa, N.; Drake, R.G.; Schuch, W.; Bramley, P.M. Evaluation of transgenic tomato plants expressing an additional phytoene synthase in a fruit-specific manner. Proc. Natl. Acad. Sci. USA 2002, 99, 1092–1097. [Google Scholar] [CrossRef] [PubMed]
- Lindgren, L.O.; Stalberg, K.G.; Hoglund, A.S. Seed-specific overexpression of an endogenous Arabidopsis phytoene synthase gene results in delayed germination and increased levels of carotenoids, chlorophyll, and abscisic acid. Plant Physiol. 2003, 132, 779–785. [Google Scholar] [CrossRef] [PubMed]
- Ducreux, L.J.; Morris, W.L.; Hedley, P.E.; Shepherd, T.; Davies, H.V.; Millam, S.; Taylor, M.A. Metabolic engineering of high carotenoid potato tubers containing enhanced levels of β-carotene and lutein. J. Exp. Bot. 2005, 56, 81–89. [Google Scholar] [CrossRef] [PubMed]
- Cordero, B.F.; Couso, I.; Leon, R.; Rodriguez, H.; Vargas, M.A. Enhancement of carotenoids biosynthesis in Chlamydomonas reinhardtii by nuclear transformation using a phytoene synthase gene isolated from Chlorella zofingiensis. Appl. Microbiol. Biotechnol. 2011, 91, 341–351. [Google Scholar] [CrossRef] [PubMed]
- Couso, I.; Vila, M.; Rodriguez, H.; Vargas, M.A.; Leon, R. Overexpression of an exogenous phytoene synthase gene in the unicellular alga Chlamydomonas reinhardtii leads to an increase in the content of carotenoids. Biotechnol. Prog. 2011, 27, 54–60. [Google Scholar] [CrossRef] [PubMed]
- Eilers, U.; Bikoulis, A.; Breitenbach, J.; Büchel, C.; Sandmann, G. Limitations in the biosynthesis of fucoxanthin as targets for genetic engineering in Phaeodactylum tricornutum. J. Appl. Phycol. 2015. [Google Scholar] [CrossRef]
- Kaur, S.; Spillane, C. Reduction in carotenoid levels in the marine diatom Phaeodactylum tricornutum by artificial microRNAs targeted against the endogenous phytoene synthase gene. Mar. Biotechnol. 2015, 17. [Google Scholar] [CrossRef] [PubMed]
- Carreto, J.; Catoggio, J. Variations in pigment contents of the diatom Phaeodactylum tricornutum during growth. Mar. biol. 1976, 36, 105–112. [Google Scholar] [CrossRef]
- Rebolloso-Fuentes, M.; Navarro-Pérez, A.; Ramos-Miras, J.; Guil-Guerrero, J. Biomass nutrient profiles of the microalga Phaeodactylum tricornutum. J. Food Biochem. 2001, 25, 57–76. [Google Scholar] [CrossRef]
- Gu, P.; Ishii, Y.; Spencer, T.A.; Shechter, I. Function-structure studies and identification of three enzyme domains involved in the catalytic activity in rat hepatic squalene synthase. J. Biol. Chem. 1998, 273, 12515–12525. [Google Scholar] [CrossRef] [PubMed]
- Pandit, J.; Danley, D.E.; Schulte, G.K.; Mazzalupo, S.; Pauly, T.A.; Hayward, C.M.; Hamanaka, E.S.; Thompson, J.F.; Harwood, H.J., Jr. Crystal structure of human squalene synthase. A key enzyme in cholesterol biosynthesis. J. Biol. Chem. 2000, 275, 30610–30617. [Google Scholar] [CrossRef] [PubMed]
- Dogbo, O.; Laferriere, A.; D’Harlingue, A.; Camara, B. Carotenoid biosynthesis: Isolation and characterization of a bifunctional enzyme catalyzing the synthesis of phytoene. Proc. Natl. Acad. Sci. USA 1988, 85, 7054–7058. [Google Scholar] [CrossRef] [PubMed]
- Poulter, C.D. Biosynthesis of non-head-to-tail terpenes. Formation of 1′-1 and 1′-3 linkages. Acc. Chem. Res. 1990, 23, 70–77. [Google Scholar] [CrossRef]
- Shumskaya, M.; Bradbury, L.M.; Monaco, R.R.; Wurtzel, E.T. Plastid localization of the key carotenoid enzyme phytoene synthase is altered by isozyme, allelic variation, and activity. Plant Cell 2012, 24, 3725–3741. [Google Scholar] [CrossRef] [PubMed]
- Gruber, A.; Vugrinec, S.; Hempel, F.; Gould, S.B.; Maier, U.G.; Kroth, P.G. Protein targeting into complex diatom plastids: Functional characterisation of a specific targeting motif. Plant Mol. Biol. 2007, 64, 519–530. [Google Scholar] [CrossRef] [PubMed]
- Ryckebosch, E.; Muylaert, K.; Eeckhout, M.; Ruyssen, T.; Foubert, I. Influence of drying and storage on lipid and carotenoid stability of the microalga Phaeodactylum tricornutum. J. Agric. Food Chem. 2011, 59, 11063–11069. [Google Scholar] [CrossRef] [PubMed]
- Petersen, T.N.; Brunak, S.; von Heijne, G.; Nielsen, H. SignalP 4.0: Discriminating signal peptides from transmembrane regions. Nat. Methods 2011, 8, 785–786. [Google Scholar] [CrossRef] [PubMed]
- Cordero, B.F.; Obraztsova, I.; Couso, I.; Leon, R.; Vargas, M.A.; Rodriguez, H. Enhancement of lutein production in Chlorella sorokiniana (Chorophyta) by improvement of culture conditions and random mutagenesis. Mar. Drugs 2011, 9, 1607–1624. [Google Scholar] [CrossRef] [PubMed]
- Hara, K.Y.; Morita, T.; Mochizuki, M.; Yamamoto, K.; Ogino, C.; Araki, M.; Kondo, A. Development of a multi-gene expression system in Xanthophyllomyces dendrorhous. Microb. Cell Fact. 2014, 13, 175. [Google Scholar] [CrossRef] [PubMed]
- Smith, W.; Chanley, M.; Guillard, R.L. Culture of phytoplankton for feeding marine invertebrates. In Culture of Marine Invertebrate Animals; Smith, W., Chanley, M., Eds.; Springer: New York, NY, USA, 1975; pp. 29–60. [Google Scholar]
- Trapnell, C.; Pachter, L.; Salzberg, S.L. TopHat: Discovering splice junctions with RNA-seq. Bioinformatics 2009, 25, 1105–1111. [Google Scholar] [CrossRef] [PubMed]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef] [PubMed]
- Tran, D.; Haven, J.; Qiu, W.G.; Polle, J.E. An update on carotenoid biosynthesis in algae: Phylogenetic evidence for the existence of two classes of phytoene synthase. Planta 2009, 229, 723–729. [Google Scholar] [CrossRef] [PubMed]
- NCBI Conserced Domain Search. Available online: http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi (accessed on 30 June 2015).
- BioEdit Sequence Alignment Editor for Windows 95/98/NT/XP/Vista/7. Available online: http://www.mbio.ncsu.edu/bioedit/bioedit.html (accessed on 30 June 2015).
- Siaut, M.; Heijde, M.; Mangogna, M.; Montsant, A.; Coesel, S.; Allen, A.; Manfredonia, A.; Falciatore, A.; Bowler, C. Molecular toolbox for studying diatom biology in Phaeodactylum tricornutum. Gene 2007, 406, 23–35. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kadono, T.; Kira, N.; Suzuki, K.; Iwata, O.; Ohama, T.; Okada, S.; Nishimura, T.; Akakabe, M.; Tsuda, M.; Adachi, M. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum. Mar. Drugs 2015, 13, 5334-5357. https://doi.org/10.3390/md13085334
Kadono T, Kira N, Suzuki K, Iwata O, Ohama T, Okada S, Nishimura T, Akakabe M, Tsuda M, Adachi M. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum. Marine Drugs. 2015; 13(8):5334-5357. https://doi.org/10.3390/md13085334
Chicago/Turabian StyleKadono, Takashi, Nozomu Kira, Kengo Suzuki, Osamu Iwata, Takeshi Ohama, Shigeru Okada, Tomohiro Nishimura, Mai Akakabe, Masashi Tsuda, and Masao Adachi. 2015. "Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum" Marine Drugs 13, no. 8: 5334-5357. https://doi.org/10.3390/md13085334
APA StyleKadono, T., Kira, N., Suzuki, K., Iwata, O., Ohama, T., Okada, S., Nishimura, T., Akakabe, M., Tsuda, M., & Adachi, M. (2015). Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum. Marine Drugs, 13(8), 5334-5357. https://doi.org/10.3390/md13085334

