Sodium Butyrate: A Multifaceted Modulator in Colorectal Cancer Therapy
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture Conditions
2.2. Viability Analysis
2.3. Cell Confluence and Cell Number Evaluation
2.4. Assessment of Cellular Morphology
2.5. Nuclear Morphology Evaluation
2.6. Gene Expression
2.7. Statistical Analysis
3. Results
3.1. NaB Exerts Cytotoxic Effects on the CRC Cell Line HCT-116
3.2. NaB Promotes Apoptosis and Triggers Cell Cycle Arrest in HCT-116 Colon Cancer Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Smith, J.G.; Yokoyama, W.H.; German, J.B. Butyric acid from the diet: Actions at the level of gene expression. Crit. Rev. Food Sci. 1998, 38, 259–297. [Google Scholar] [CrossRef] [PubMed]
- Stachowska, E.; Wiśniewska, M.; Dzieżyc, A.; Bohatyrewicz, A. Could the use of butyric acid have a positive effect on microbiota and treatment of type 2 diabetes? Eur. Rev. Med. Pharmacol. Sci. 2021, 25, 7052–7064. [Google Scholar] [CrossRef]
- Zhang, N.; Qu, Y.; Qin, B. Sodium butyrate ameliorates non-alcoholic fatty liver disease by upregulating miR-150 to suppress CXCR4 expression. Clin. Exp. Pharmacol. Physiol. 2021, 48, 1125–1136. [Google Scholar] [CrossRef] [PubMed]
- Draghici, G.A.; Moaca, A.; Nica, D.; Ardelean, S.; Simu, S.; Dehelean, C. P24-03 Modulation of glucose-lipid metabolism in Type II Diabetes through butyric acid-mediated epigenetic regulation: A probiotic intervention study in mice. Toxicol. Lett. 2024, 399, S349. [Google Scholar] [CrossRef]
- Fusco, W.; Lorenzo, M.B.; Cintoni, M.; Porcari, S.; Rinninella, E.; Kaitsas, F.; Ianiro, G. Short-chain fatty-acid-producing bacteria: Key components of the human gut microbiota. Nutrients 2023, 15, 2211. [Google Scholar] [CrossRef]
- Kaźmierczak-Siedlecka, K.; Skonieczna-Żydecka, K.; Hupp, T.; Duchnowska, R.; Marek-Trzonkowska, N.; Połom, K. Next-generation probiotics—Do they open new therapeutic strategies for cancer patients? Gut Microbes 2022, 14, 2035659. [Google Scholar] [CrossRef]
- Singh, V.; Lee, G.; Son, H.; Koh, H.; Kim, E.S.; Unno, T.; Shin, J.H. Butyrate producers, “The Sentinel of Gut”: Their intestinal significance with and beyond butyrate, and prospective use as microbial therapeutics. Front. Microbiol. 2023, 13, 1103836. [Google Scholar] [CrossRef]
- Liu, H.; Wang, J.; He, T.; Becker, S.; Zhang, G.; Li, D.; Zhu, W.; Ma, Q.; Huang, Y.; Fan, Z.; et al. Butyrate: A double-edged sword for health? Adv. Nutr. 2018, 9, 21–29. [Google Scholar] [CrossRef]
- Kaźmierczak-Siedlecka, K.; Marano, L.; Merola, E.; Roviello, F.; Połom, K. Sodium butyrate in both prevention and supportive treatment of colorectal cancer. Front. Cell. Infect. Microbiol. 2022, 12, 1023806. [Google Scholar] [CrossRef]
- Alzahrani, S.M.; Al Doghaither, H.A.; Al-Ghafari, A.B. General insight into cancer: An overview of colorectal cancer. Mol. Clin. Oncol. 2021, 15, 271. [Google Scholar] [CrossRef]
- Siegel, R.L.; Miller, K.D.; Goding Sauer, A.; Fedewa, S.A.; Butterly, L.F.; Anderson, J.C.; Cercek, A.; Smith, R.A.; Meester, R.G.; Jemal, A. Colorectal cancer statistics, 2020. CA Cancer J. Clin. 2020, 70, 145–164. [Google Scholar] [CrossRef] [PubMed]
- Donohoe, D.R.; Holley, D.; Collins, L.B.; Montgomery, S.A.; Whitmore, A.C.; Hillhouse, A.; Curry, K.P.; Renner, S.W.; Greenwalt, A.; Ryan, E.P.; et al. A gnotobiotic mouse model demonstrates that dietary fiber protects against colorectal tumorigenesis in a microbiota- and butyrate-dependent manner. Cancer Discov. 2014, 4, 1387–1397. [Google Scholar] [CrossRef] [PubMed]
- Rosato, R.R.; Grant, S. Histone deacetylase inhibitors in cancer therapy. Cancer Biol. Ther. 2003, 2, 31–38. [Google Scholar] [CrossRef] [PubMed]
- Fung, K.Y.; Cosgrove, L.; Lockett, T.; Head, R.; Topping, D.L. A review of the potential mechanisms for the lowering of colorectal oncogenesis by butyrate. Br. J. Nutr. 2012, 108, 820–831. [Google Scholar] [CrossRef]
- Wang, L.; Luo, H.S.; Xia, H. Sodium butyrate induces human colon carcinoma HT-29 cell apoptosis through a mitochondrial pathway. J. Int. Med. Res. 2009, 37, 803–811. [Google Scholar] [CrossRef]
- Canani, R.B.; Costanzo, M.D.; Leone, L.; Pedata, M.; Meli, R.; Calignano, A. Potential beneficial effects of butyrate in intestinal and extraintestinal diseases. World J. Gastroenterol. 2011, 17, 1519–1528. [Google Scholar] [CrossRef]
- Davie, J.R. Inhibition of histone deacetylase activity by butyrate. J. Nutr. 2003, 133 (Suppl. S7), 2485S–2493S. [Google Scholar] [CrossRef]
- Hassani, I.; Anbiah, B.; Moore, A.L.; Abraham, P.T.; Odeniyi, I.A.; Habbit, N.L.; Torres, M.P.; Ortega, F.B.; Dutta, A.; Lipke, E.A.; et al. Establishment of a tissue-engineered colon cancer model for comparative analysis of cancer cell lines. J. Biomed. Mater. Res. Part A 2024, 112, 231–249. [Google Scholar] [CrossRef]
- Ashouri, K.; Wong, A.; Mittal, P.; Torres-Gonzalez, L.; Lo, J.H.; Soni, S.; Battaglin, F. Exploring predictive and prognostic biomarkers in colorectal cancer: A comprehensive review. Cancers 2024, 16, 2796. [Google Scholar] [CrossRef]
- Zhang, Q.; Qin, Y.; Sun, X.; Bian, Z.; Liu, L.; Liu, H.; Liang, H.; Wang, M.; Hu, L.; Sun, S. Sodium butyrate blocks the growth of colorectal cancer by inhibiting the aerobic glycolysis mediated by SIRT4/HIF-1α. Chem. Biol. Interact. 2024, 403, 111227. [Google Scholar] [CrossRef]
- Bian, Z.; Sun, X.; Liu, L.; Qin, Y.; Zhang, Q.; Liu, H.; Wu, L.; Tang, X.; Wang, M.; Sun, S. Sodium butyrate induces CRC cell ferroptosis via the CD44/SLC7A11 pathway and exhibits a synergistic therapeutic effect with erastin. Cancers 2023, 15, 423. [Google Scholar] [CrossRef] [PubMed]
- Mashayekhi, A.; Forouzesh, F.; Mashayekhi, M. Promotion of extrinsic apoptosis pathway in HCT-116 human colorectal cancer cell line by sodium butyrate as histone deacetylase inhibitor. Iran. Red Crescent Med. J. 2021, 23, e190. [Google Scholar] [CrossRef]
- Zhang, J.; Yi, M.; Zha, L.; Chen, S.; Li, Z.; Li, C.; Xiao, C.; Wang, D.; He, H.; Sun, S. Sodium butyrate induces endoplasmic reticulum stress and autophagy in colorectal cells: Implications for apoptosis. PLoS ONE 2016, 11, e0147218. [Google Scholar] [CrossRef] [PubMed]
- Bultman, S.J. Molecular pathways: Gene–environment interactions regulating dietary fiber induction of proliferation and apoptosis via butyrate for cancer prevention. Clin. Cancer Res. 2014, 20, 799–803. [Google Scholar] [CrossRef] [PubMed]
- Fung, K.Y.; Brierley, G.V.; Henderson, S.; Hoffmann, P.; McColl, S.R.; Lockett, T.; Cosgrove, L. Butyrate-induced apoptosis in HCT116 colorectal cancer cells includes induction of a cell stress response. J. Proteome Res. 2011, 10, 1860–1869. [Google Scholar] [CrossRef]
- Wang, Y.L.; Wu, W.R.; Lin, P.L.; Shen, Y.C.; Lin, Y.Z.; Li, H.W.; Wang, S.C. The functions of PCNA in tumor stemness and invasion. Int. J. Mol. Sci. 2022, 23, 5679. [Google Scholar] [CrossRef]
- Fu, D.; Pfannenstiel, L.; Demelash, A.; Phoon, Y.P.; Mayell, C.; Cabrera, C.; Gastman, B. MCL1 nuclear translocation induces chemoresistance in colorectal carcinoma. Cell Death Dis. 2022, 13, 63. [Google Scholar] [CrossRef]
- Semenescu, A.D.; Moacă, E.A.; Iftode, A.; Dehelean, C.A.; Tchiakpe-Antal, D.S.; Vlase, L.; Chioibaş, R. Recent updates regarding the antiproliferative activity of Galium verum extracts on A375 human malignant melanoma cell line. Life 2024, 14, 112. [Google Scholar] [CrossRef]
- Semenescu, A.D.; Moacă, E.A.; Iftode, A.; Dehelean, C.A.; Tchiakpe-Antal, D.S.; Vlase, L.; Chioibaş, R. Phytochemical and nutraceutical screening of ethanol and ethyl acetate phases of Romanian Galium verum herba (Rubiaceae). Molecules 2023, 28, 7804. [Google Scholar] [CrossRef]
- Gruia, A.T.; Suciu, M.; Barbu-Tudoran, L.; Azghadi, S.M.R.; Cristea, M.I.; Nica, D.V.; Mic, A.A.; Mic, F.A. Mesenchymal stromal cells differentiating to adipocytes accumulate autophagic vesicles instead of functional lipid droplets. J. Cell. Physiol. 2016, 231, 863–875. [Google Scholar] [CrossRef]
- Manea, D.; Ienciu, A.A.; Ștef, R.; Peț, I.; Șmuleac, L.; Grozea, I.; Nica, D.V. The “sandwich” system: A potential solution for protecting overwintering Cornu aspersum snails reared in semi-intensive heliciculture farms in colder climates. Animals 2021, 11, 1420. [Google Scholar] [CrossRef] [PubMed]
- Azghadi, S.M.R.; Suciu, M.; Gruia, A.T.; Barbu-Tudoran, L.; Cristea, M.I.; Mic, A.A.; Mic, F.A. Mesenchymal stromal cells support the viability and differentiation of thymocytes through direct contact in autologous co-cultures. Histochem. Cell Biol. 2016, 146, 153–165. [Google Scholar] [CrossRef] [PubMed]
- Vîlcea, A.; Borta, S.M.; Popețiu, R.O.; Alexandra, R.L.; Pilat, L.; Nica, D.V.; Pușchiță, M. High ADMA is associated with worse health profile in heart failure patients hospitalized for episodes of acute decompensation. Medicina 2024, 60, 813. [Google Scholar] [CrossRef] [PubMed]
- Sebaugh, J.L. Guidelines for accurate EC50/IC50 estimation. Pharm. Stat. 2011, 10, 128–134. [Google Scholar] [CrossRef]
- Grelus, A.; Nica, D.V.; Miklos, I.; Belengeanu, V.; Ioiart, I.; Popescu, C. Clinical significance of measuring global hydroxymethylation of white blood cell DNA in prostate cancer: Comparison to PSA in a pilot exploratory study. Int. J. Mol. Sci. 2017, 18, 2465. [Google Scholar] [CrossRef]
- Hague, A.; Manning, A.M.; Hanlon, K.A.; Hart, D.; Paraskeva, C.; Huschtscha, L.I. Sodium butyrate induces apoptosis in human colonic tumor cell lines in a p53-independent pathway: Implications for the possible role of dietary fiber in the prevention of large-bowel cancer. Int. J. Cancer 1993, 55, 498–505. [Google Scholar] [CrossRef]
- Czabotar, P.E.; Garcia-Saez, A.J. Mechanisms of BCL-2 family proteins in mitochondrial apoptosis. Nat. Rev. Mol. Cell Biol. 2023, 24, 732–748. [Google Scholar] [CrossRef]
- Engeland, K. Cell cycle regulation: p53-p21-RB signaling. Cell Death Differ. 2022, 29, 946–960. [Google Scholar] [CrossRef]
- Głąbień, M.; Miłkowski, P.; Kuśnierz, A.; Kusiak, K.; Aleksandrowicz, D.; Wieczorek, O.; Bieńkowski, T.; Wójcik, M.; Kondratowicz, A. Sodium butyrate as gut microbiota modulators: Mechanisms of action and potential clinical applications—Literature review and new perspectives. Qual. Sport 2024, 27, 55233. [Google Scholar] [CrossRef]
- Min, X.; Liu, Y.G.; Zou, M.C.; Fei, Z. Sodium butyrate induces apoptosis of human colon cancer cells by modulating ERK and sphingosine kinase 2. Biomed. Environ. Sci. 2014, 27, 197–203. [Google Scholar] [CrossRef]
- Kim, Y.H.; Park, J.W.; Lee, J.Y.; Kwon, T.K. Sodium butyrate sensitizes TRAIL-mediated apoptosis by inducing transcription from the DR5 gene promoter through Sp1 sites in colon cancer cells. Carcinogenesis 2004, 25, 1813–1820. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Li, L.; Yang, H.; Shi, C.; Lei, Z.; Guo, L.; Wang, Y. Unraveling the role of TP53 in colorectal cancer therapy: From wild-type regulation to mutant. Front. Biosci.-Landmark 2024, 29, 272. [Google Scholar] [CrossRef] [PubMed]
- Eriksson, S.E.; Ceder, S.; Bykov, V.J.; Wiman, K.G. p53 as a hub in cellular redox regulation and therapeutic target in cancer. J. Mol. Cell Biol. 2019, 11, 330–341. [Google Scholar] [CrossRef] [PubMed]
- Luo, Z.W.; Zhu, M.G.; Zhang, Z.Q.; Ye, F.J.; Huang, W.H.; Luo, X.Z. Increased expression of Ki-67 is a poor prognostic marker for colorectal cancer patients: A meta-analysis. BMC Cancer 2019, 19, 123. [Google Scholar] [CrossRef]
- Kim, Y.J.; Lee, S.H.; Lee, J.; Kuh, H.J. Non-nuclear localization of Ki-67 in human colorectal cancer cells grown as multicellular layers. Arch. Pharm. Res. 2013, 36, 634–640. [Google Scholar] [CrossRef]
- Wang, H.; Guo, M.; Wei, H.; Chen, Y. Targeting MCL-1 in cancer: Current status and perspectives. J. Hematol. Oncol. 2021, 14, 67. [Google Scholar] [CrossRef]
- Schulze-Bergkamen, H.; Ehrenberg, R.; Hickmann, L.; Vick, B.; Urbanik, T.; Schimanski, C.C.; Meyer, T.; Galle, P.R.; Moehler, M. BCL-xL and myeloid cell leukemia-1 contribute to apoptosis resistance of colorectal cancer cells. World J. Gastroenterol. 2008, 14, 3829–3840. [Google Scholar] [CrossRef]
- Hofmanová, J.; Vaculová, A.; Lojek, A.; Kozubík, A. Interaction of polyunsaturated fatty acids and sodium butyrate during apoptosis in HT-29 human colon adenocarcinoma cells. Eur. J. Nutr. 2005, 44, 40–51. [Google Scholar] [CrossRef]
- Qian, S.; Wei, Z.; Yang, W.; Huang, J.; Yang, Y.; Wang, J. The role of BCL-2 family proteins in regulating apoptosis and cancer therapy. Front. Oncol. 2022, 12, 985363. [Google Scholar] [CrossRef]
- Ali, A.S.; Helal, D.S.; Mohamed, D.A.; Sallam, F.A. Immunohistochemical expression of FAP and PCNA in neoplastic epithelial colonic lesions. Tanta Med. J. 2022, 50, 236–243. [Google Scholar] [CrossRef]
- Emenaker, N.J.; Calaf, G.M.; Cox, D.; Basson, M.D.; Qureshi, N. Short-chain fatty acids inhibit invasive human colon cancer by modulating uPA, TIMP-1, TIMP-2, mutant p53, Bcl-2, Bax, p21, and PCNA protein expression in an in vitro cell culture model. J. Nutr. 2001, 131, 3041S–3046S. [Google Scholar] [CrossRef] [PubMed]
- Pitolli, C.; Wang, Y.; Candi, E.; Shi, Y.; Melino, G.; Amelio, I. p53-mediated tumor suppression: DNA-damage response and alternative mechanisms. Cancers 2019, 11, 1983. [Google Scholar] [CrossRef] [PubMed]
- Encarnação, J.C.; Pires, A.S.; Amaral, R.A.; Gonçalves, T.J.; Laranjo, M.; Casalta-Lopes, J.E.; Silva, F.; Ribeiro, A.B.; Almeida, L.; Botelho, M.F. Butyrate, a dietary fiber derivative that improves irinotecan effect in colon cancer cells. J. Nutr. Biochem. 2018, 56, 183–192. [Google Scholar] [CrossRef]
- Coffey, T. Bioassay case study applying the maximin D-optimal design algorithm to the four-parameter logistic model. Pharm. Stat. 2015, 14, 427–432. [Google Scholar] [CrossRef]
- Ghiaghi, M.; Forouzesh, F.; Rahimi, H. Effect of sodium butyrate on LHX1 mRNA expression as a transcription factor of HDAC8 in human colorectal cancer cell lines. Avicenna J. Med. Biotechnol. 2019, 11, 317–323. [Google Scholar]
- Pattayil, L.; Balakrishnan-Saraswathi, H.T. In vitro evaluation of apoptotic induction of butyric acid derivatives in colorectal carcinoma cells. Anticancer Res. 2019, 39, 3795–3801. [Google Scholar] [CrossRef]
- Li, Y.; He, P.; Chen, Y.; Hu, J.; Deng, B.; Liu, C.; Zhang, Z.; Wu, Q.; Tang, L.; Dong, W. Microbial metabolite sodium butyrate enhances the anti-tumor efficacy of 5-fluorouracil against colorectal cancer by modulating PINK1/Parkin signaling and intestinal flora. Sci. Rep. 2024, 14, 13063. [Google Scholar] [CrossRef]
- HCT116 Cell Line: A Pillar in Colorectal Cancer Research. Available online: https://www.cytion.com/Knowledge-Hub/Cell-Line-Insights/HCT116-Cell-Line-A-Comprehensive-Guide-to-Colorectal-Cancer-Research/ (accessed on 30 December 2024).
- 3D Cell Culture of Human Colon Cancer Cells (HCT116) on VitroGel® System. Available online: https://www.thewellbio.com/application-notes/3d-cell-culture-hct116/ (accessed on 30 December 2024).
- Rajput, A.; San Martin, I.D.; Rose, R.; Beko, A.; LeVea, C.; Sharratt, E.; Wang, J. Characterization of HCT116 human colon cancer cells in an orthotopic model. J. Surg. Res. 2008, 147, 276–281. [Google Scholar] [CrossRef]




| Gene | Forward | Reverse |
|---|---|---|
| BAX | TTTGCTTCAGGGTTTCATCC | AGACACTCGCTCAGCTTCTT |
| BCL-2 | TTCTTTGAGTTCGGTGGGGT | GACTTCACTTGTGGCCCAG |
| PCNA | TTGATGAGGCGCGTGAATTT | GTTTGCAGCAGTGGGTGTG |
| Ki-67 (MKI67) | ACCTACGGATTGAGACGTCAG | CTTCACTGTGTAGCCATTGTTGG |
| CASP3 | GTGGAACTGACGATGATATGGC | CGCAAAGTGACTGGATGAACC |
| PUMA (BBC3) | CCTGGAGGGTCG0ACAGTACGA | GCCACCTTCCCATAGTTCCG |
| TP53 | CACCATGAGCGCT0GCTCAGAT | TTGGGCAGTGCTCGCTTAGTG |
| MCL-1 | AGGACACCCAGGAA0ACGAAG | GGTGCTGTTGACATCTAGGTTC |
| NF-κB (NFKB1) | TGCTTCTCTGACGTCT0GCTG | GCGTTGATGGTGGAGAGTGG |
| CDKN1A (p21) | CCTGGTGATGTCCGACCTG | CCATGAGCGCATCGCAATC |
| Treatment Dose | BAX | BCL-2 | PCNA | Ki-67 | CASP3 |
|---|---|---|---|---|---|
| 5 mM | 2.52 (0.42) | 0.64 (0.10) | 0.54 (0.08) | 0.49 (0.12) | 2.54 (0.48) |
| 10 mM | 9.37 (0.96) * | 0.35 (0.05) **** | 0.28 (0.004) **** | 0.29 (0.05) * | 9.16 (2.21) |
| 15 mM | 26.59 (3.14) **** | 0.15 (0.02) **** | 0.17 (0.070) **** | 0.15 (0.04) **** | 25.62 (1.08) ** |
| 20 mM | 51.38 (3.65) **** | 0.05 (0.02) **** | 0.06 (0.01) **** | 0.06 (0.03) **** | 56.12 (9.75) **** |
| PUMA | TP53 | MCL-1 | NF-κ0B | CDKN1 | |
| 5 mM | 2.22 (0.17) | 0.73 (0.10) | 0.90 (0.07) | 0.63 (0.009) | 0.60 (0.14) |
| 10 mM | 5.49 (0.72) | 0.65 (0.06) | 0.46 (0.07) **** | 0.34 (0.05) **** | 0.34 (0.05) * |
| 15 mM | 12.20 (3.15) * | 0.50 (0.02) ** | 0.25 (0.03) **** | 0.20 (0.03) **** | 0.19 (0.02) **** |
| 20 mM | 34.59 (5.20) **** | 0.38 (0.03) **** | 0.13 (0.01) **** | 0.08 (0.02) **** | 00.13 (0.03) **** |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Published by MDPI on behalf of the Lithuanian University of Health Sciences. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mederle, A.L.; Semenescu, A.; Drăghici, G.A.; Dehelean, C.A.; Vlăduț, N.-V.; Nica, D.V. Sodium Butyrate: A Multifaceted Modulator in Colorectal Cancer Therapy. Medicina 2025, 61, 136. https://doi.org/10.3390/medicina61010136
Mederle AL, Semenescu A, Drăghici GA, Dehelean CA, Vlăduț N-V, Nica DV. Sodium Butyrate: A Multifaceted Modulator in Colorectal Cancer Therapy. Medicina. 2025; 61(1):136. https://doi.org/10.3390/medicina61010136
Chicago/Turabian StyleMederle, Alexandra Laura, Alexandra Semenescu, George Andrei Drăghici, Cristina Adriana Dehelean, Nicolae-Valentin Vlăduț, and Dragoş Vasile Nica. 2025. "Sodium Butyrate: A Multifaceted Modulator in Colorectal Cancer Therapy" Medicina 61, no. 1: 136. https://doi.org/10.3390/medicina61010136
APA StyleMederle, A. L., Semenescu, A., Drăghici, G. A., Dehelean, C. A., Vlăduț, N.-V., & Nica, D. V. (2025). Sodium Butyrate: A Multifaceted Modulator in Colorectal Cancer Therapy. Medicina, 61(1), 136. https://doi.org/10.3390/medicina61010136

