IL24 Expression in Synovial Myofibroblasts: Implications for Female Osteoarthritis Pain through Propensity Score Matching Analysis
Abstract
1. Introduction
2. Materials and Methods
2.1. Patients
2.2. Magnetic Isolation of Myofibroblast
2.3. qPCR
2.4. Statistical Analyses
3. Results
3.1. Expression of Myofibroblast Makers and IL24 in ST from Male and Female Knee OA Patients
3.2. Relationship between IL24 Expression and OA Pathology in Male and Female Knee OA Patients
3.3. Relationship between IL24 Expression and Age in Male and Female Knee OA Patients
3.4. Expression of IL24 in Myofibroblasts
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chen, H.W.; Huang, C.H.; Huang, C.F.; Chang, C.H.; Liao, H.J. Distinct subsets of synovial fibroblasts control cartilage destruction in joint diseases. Clin. Exp. Rheumatol. 2023. [Google Scholar] [CrossRef]
- Zou, Z.; Li, H.; Yu, K.; Ma, K.; Wang, Q.; Tang, J.; Liu, G.; Lim, K.; Hooper, G.; Woodfield, T.; et al. The potential role of synovial cells in the progression and treatment of osteoarthritis. Exploration 2023, 3, 20220132. [Google Scholar] [CrossRef]
- Tschon, M.; Contartese, D.; Pagani, S.; Borsari, V.; Fini, M. Gender and Sex Are Key Determinants in Osteoarthritis Not Only Confounding Variables. A Systematic Review of Clinical Data. J. Clin. Med. 2021, 10, 3178. [Google Scholar] [CrossRef]
- Franke, M.; Mancino, C.; Taraballi, F. Reasons for the Sex Bias in Osteoarthritis Research: A Review of Preclinical Studies. Int. J. Mol. Sci. 2023, 24, 10386. [Google Scholar] [CrossRef]
- Di, J.; Bai, J.; Zhang, J.; Chen, J.; Hao, Y.; Bai, J.; Xiang, C. Regional disparities, age-related changes and sex-related differences in knee osteoarthritis. BMC Musculoskelet. Disord. 2024, 25, 66. [Google Scholar] [CrossRef]
- Segal, N.A.; Nilges, J.M.; Oo, W.M. Sex Differences in Osteoarthritis Prevalence, Pain Perception, Physical Function and Therapeutics. Osteoarthr. Cartil. 2024, in press. [CrossRef]
- Prieto-Alhambra, D.; Judge, A.; Javaid, M.K.; Cooper, C.; Diez-Perez, A.; Arden, N.K. Incidence and risk factors for clinically diagnosed knee, hip and hand osteoarthritis: Influences of age, gender and osteoarthritis affecting other joints. Ann. Rheum. Dis. 2014, 73, 1659–1664. [Google Scholar] [CrossRef]
- Althomali, O.W.; Amin, J.; Acar, T.; Shahanawaz, S.; Talal Abdulrahman, A.; Alnagar, D.K.; Almeshari, M.; Alzamil, Y.; Althomali, K.; Alshoweir, N.; et al. Prevalence of Symptomatic Knee Osteoarthritis in Saudi Arabia and Associated Modifiable and Non-Modifiable Risk Factors: A Population-Based Cross-Sectional Study. Healthcare 2023, 11, 728. [Google Scholar] [CrossRef]
- Ji, S.; Liu, L.; Li, J.; Zhao, G.; Cai, Y.; Dong, Y.; Wang, J.; Wu, S. Prevalence and factors associated with knee osteoarthritis among middle-aged and elderly individuals in rural Tianjin: A population-based cross-sectional study. J. Orthop. Surg. Res. 2023, 18, 266. [Google Scholar] [CrossRef]
- Cui, A.; Li, H.; Wang, D.; Zhong, J.; Chen, Y.; Lu, H. Global, regional prevalence, incidence and risk factors of knee osteoarthritis in population-based studies. EClinicalMedicine 2020, 29–30, 100587. [Google Scholar] [CrossRef]
- Radu, A.F.; Bungau, S.G.; Tit, D.M.; Behl, T.; Uivaraseanu, B.; Marcu, M.F. Highlighting the Benefits of Rehabilitation Treatments in Hip Osteoarthritis. Medicina 2022, 58, 494. [Google Scholar] [CrossRef] [PubMed]
- Uivaraseanu, B.; Vesa, C.M.; Tit, D.M.; Abid, A.; Maghiar, O.; Maghiar, T.A.; Hozan, C.; Nechifor, A.C.; Behl, T.; Patrascu, J.M.; et al. Therapeutic approaches in the management of knee osteoarthritis (Review). Exp. Ther. Med. 2022, 23, 328. [Google Scholar] [CrossRef]
- Alwhaibi, M.; Balkhi, B. Gender Differences in Potentially Inappropriate Medication Use among Older Adults. Pharmaceuticals 2023, 16, 869. [Google Scholar] [CrossRef]
- Bierman, A.S.; Pugh, M.J.; Dhalla, I.; Amuan, M.; Fincke, B.G.; Rosen, A.; Berlowitz, D.R. Sex differences in inappropriate prescribing among elderly veterans. Am. J. Geriatr. Pharmacother. 2007, 5, 147–161. [Google Scholar] [CrossRef]
- Dominick, K.L.; Ahern, F.M.; Gold, C.H.; Heller, D.A. Gender differences in NSAID use among older adults with osteoarthritis. Ann. Pharmacother. 2003, 37, 1566–1571. [Google Scholar] [CrossRef]
- Remst, D.F.; Blaney Davidson, E.N.; van der Kraan, P.M. Unravelling osteoarthritis-related synovial fibrosis: A step closer to solving joint stiffness. Rheumatology 2015, 54, 1954–1963. [Google Scholar] [CrossRef] [PubMed]
- Rim, Y.A.; Ju, J.H. The Role of Fibrosis in Osteoarthritis Progression. Life 2020, 11, 3. [Google Scholar] [CrossRef]
- Mathiessen, A.; Conaghan, P.G. Synovitis in osteoarthritis: Current understanding with therapeutic implications. Arthritis Res. Ther. 2017, 19, 18. [Google Scholar] [CrossRef]
- Smith, M.D. The normal synovium. Open Rheumatol. J. 2011, 5, 100–106. [Google Scholar] [CrossRef]
- Jay, G.D.; Britt, D.E.; Cha, C.J. Lubricin is a product of megakaryocyte stimulating factor gene expression by human synovial fibroblasts. J. Rheumatol. 2000, 27, 594–600. [Google Scholar]
- Jay, G.D.; Waller, K.A. The biology of lubricin: Near frictionless joint motion. Matrix Biol. 2014, 39, 17–24. [Google Scholar] [CrossRef] [PubMed]
- Bong, M.R.; Di Cesare, P.E. Stiffness after total knee arthroplasty. J. Am. Acad. Orthop. Surg. 2004, 12, 164–171. [Google Scholar] [CrossRef] [PubMed]
- Loeuille, D.; Chary-Valckenaere, I.; Champigneulle, J.; Rat, A.C.; Toussaint, F.; Pinzano-Watrin, A.; Goebel, J.C.; Mainard, D.; Blum, A.; Pourel, J.; et al. Macroscopic and microscopic features of synovial membrane inflammation in the osteoarthritic knee: Correlating magnetic resonance imaging findings with disease severity. Arthritis Rheum. 2005, 52, 3492–3501. [Google Scholar] [CrossRef] [PubMed]
- Bonnevie, E.D.; Scanzello, C.R.; Mauck, R.L. Modulating mechanobiology as a therapeutic target for synovial fibrosis to restore joint lubrication. Osteoarthr. Cartil. 2024, 32, 41–51. [Google Scholar] [CrossRef] [PubMed]
- Maglaviceanu, A.; Wu, B.; Kapoor, M. Fibroblast-like synoviocytes: Role in synovial fibrosis associated with osteoarthritis. Wound Repair. Regen. 2021, 29, 642–649. [Google Scholar] [CrossRef] [PubMed]
- Tsuchiya, M.; Ohashi, Y.; Kodera, Y.; Satoh, M.; Matsui, T.; Fukushima, K.; Iwase, D.; Aikawa, J.; Mukai, M.; Inoue, G.; et al. CD39+CD55- Fb Subset Exhibits Myofibroblast-Like Phenotype and Is Associated with Pain in Osteoarthritis of the Knee. Biomedicines 2023, 11, 3047. [Google Scholar] [CrossRef] [PubMed]
- Garate-Carrillo, A.; Gonzalez, J.; Ceballos, G.; Ramirez-Sanchez, I.; Villarreal, F. Sex related differences in the pathogenesis of organ fibrosis. Transl. Res. 2020, 222, 41–55. [Google Scholar] [CrossRef] [PubMed]
- Kragstrup, T.W.; Otkjaer, K.; Holm, C.; Jorgensen, A.; Hokland, M.; Iversen, L.; Deleuran, B. The expression of IL-20 and IL-24 and their shared receptors are increased in rheumatoid arthritis and spondyloarthropathy. Cytokine 2008, 41, 16–23. [Google Scholar] [CrossRef] [PubMed]
- Scrivo, R.; Conigliaro, P.; Riccieri, V.; Di Franco, M.; Alessandri, C.; Spadaro, A.; Perricone, R.; Valesini, G. Distribution of interleukin-10 family cytokines in serum and synovial fluid of patients with inflammatory arthritis reveals different contribution to systemic and joint inflammation. Clin. Exp. Immunol. 2015, 179, 300–308. [Google Scholar] [CrossRef]
- Zhong, Y.; Zhang, X.; Chong, W. Interleukin-24 Immunobiology and Its Roles in Inflammatory Diseases. Int. J. Mol. Sci. 2022, 23, 627. [Google Scholar] [CrossRef]
- Maarof, G.; Bouchet-Delbos, L.; Gary-Gouy, H.; Durand-Gasselin, I.; Krzysiek, R.; Dalloul, A. Interleukin-24 inhibits the plasma cell differentiation program in human germinal center B cells. Blood 2010, 115, 1718–1726. [Google Scholar] [CrossRef] [PubMed]
- Rao, L.Z.; Wang, Y.; Zhang, L.; Wu, G.; Zhang, L.; Wang, F.X.; Chen, L.M.; Sun, F.; Jia, S.; Zhang, S.; et al. IL-24 deficiency protects mice against bleomycin-induced pulmonary fibrosis by repressing IL-4-induced M2 program in macrophages. Cell Death Differ. 2021, 28, 1270–1283. [Google Scholar] [CrossRef] [PubMed]
- Shefler, I.; Pasmanik-Chor, M.; Kidron, D.; Mekori, Y.A.; Hershko, A.Y. T cell-derived microvesicles induce mast cell production of IL-24: Relevance to inflammatory skin diseases. J. Allergy Clin. Immunol. 2014, 133, 217–224.e3. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.L.; Zhou, W.J.; Lu, H.; Lei, S.T.; Ha, S.Y.; Lai, Z.Z.; Zheng, Z.M.; Ruan, L.Y.; He, Y.Y.; Li, D.J.; et al. Decidual stromal cells promote the differentiation of CD56(bright) CD16(-) NK cells by secreting IL-24 in early pregnancy. Am. J. Reprod. Immunol. 2019, 81, e13110. [Google Scholar] [CrossRef] [PubMed]
- Andoh, A.; Shioya, M.; Nishida, A.; Bamba, S.; Tsujikawa, T.; Kim-Mitsuyama, S.; Fujiyama, Y. Expression of IL-24, an activator of the JAK1/STAT3/SOCS3 cascade, is enhanced in inflammatory bowel disease. J. Immunol. 2009, 183, 687–695. [Google Scholar] [CrossRef] [PubMed]
- Imaeda, H.; Nishida, A.; Inatomi, O.; Fujiyama, Y.; Andoh, A. Expression of interleukin-24 and its receptor in human pancreatic myofibroblasts. Int. J. Mol. Med. 2011, 28, 993–999. [Google Scholar] [PubMed]
- Pap, D.; Veres-Szekely, A.; Szebeni, B.; Rokonay, R.; Onody, A.; Lippai, R.; Takacs, I.M.; Tisler, A.; Kardos, M.; Oswald, F.; et al. Characterization of IL-19, -20, and -24 in acute and chronic kidney diseases reveals a pro-fibrotic role of IL-24. J. Transl. Med. 2020, 18, 172. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Wang, L.; Wang, C.Y.; Ye, J.; Wang, Y.; Li, T.; Garcia-Godoy, F.; Sun, D.; Gu, W.; Postlethwaite, A.E. Sex Differences in Correlation with Gene Expression Levels between Ifi200 Family Genes and Four Sets of Immune Disease-Relevant Genes. J. Immunol. Res. 2018, 2018, 1290814. [Google Scholar] [CrossRef] [PubMed]
- Altman, R.; Asch, E.; Bloch, D.; Bole, G.; Borenstein, D.; Brandt, K.; Christy, W.; Cooke, T.D.; Greenwald, R.; Hochberg, M.; et al. Development of criteria for the classification and reporting of osteoarthritis. Classification of osteoarthritis of the knee. Diagnostic and Therapeutic Criteria Committee of the American Rheumatism Association. Arthritis Rheum. 1986, 29, 1039–1049. [Google Scholar] [CrossRef]
- Aletaha, D.; Neogi, T.; Silman, A.J.; Funovits, J.; Felson, D.T.; Bingham, C.O., 3rd; Birnbaum, N.S.; Burmester, G.R.; Bykerk, V.P.; Cohen, M.D.; et al. 2010 Rheumatoid arthritis classification criteria: An American College of Rheumatology/European League against Rheumatism collaborative initiative. Arthritis Rheum. 2010, 62, 2569–2581. [Google Scholar] [CrossRef]
- Aringer, M.; Costenbader, K.; Daikh, D.; Brinks, R.; Mosca, M.; Ramsey-Goldman, R.; Smolen, J.S.; Wofsy, D.; Boumpas, D.T.; Kamen, D.L.; et al. 2019 European League Against Rheumatism/American College of Rheumatology Classification Criteria for Systemic Lupus Erythematosus. Arthritis Rheumatol. 2019, 71, 1400–1412. [Google Scholar] [CrossRef]
- Andrade, C.M.; Wink, M.R.; Margis, R.; Borojevic, R.; Battastini, A.M.; Guma, F.C. Changes in E-NTPDase 3 expression and extracellular nucleotide hydrolysis during the myofibroblast/lipocyte differentiation. Mol. Cell. Biochem. 2010, 339, 79–87. [Google Scholar] [CrossRef]
- Duangrat, R.; Parichatikanond, W.; Mangmool, S. Dual Blockade of TGF-β Receptor and Endothelin Receptor Synergistically Inhibits Angiotensin II-Induced Myofibroblast Differentiation: Role of AT1R/Gαq-Mediated TGF-β1 and ET-1 Signaling. Int. J. Mol. Sci. 2023, 24, 6972. [Google Scholar] [CrossRef]
- Shao, J.; Li, M.Q.; Meng, Y.H.; Chang, K.K.; Wang, Y.; Zhang, L.; Li, D.J. Estrogen promotes the growth of decidual stromal cells in human early pregnancy. Mol. Hum. Reprod. 2013, 19, 655–664. [Google Scholar] [CrossRef]
- Alquraini, A.; Garguilo, S.; D’Souza, G.; Zhang, L.X.; Schmidt, T.A.; Jay, G.D.; Elsaid, K.A. The interaction of lubricin/proteoglycan 4 (PRG4) with toll-like receptors 2 and 4: An anti-inflammatory role of PRG4 in synovial fluid. Arthritis Res. Ther. 2015, 17, 353. [Google Scholar] [CrossRef] [PubMed]
- Waller, K.A.; Zhang, L.X.; Elsaid, K.A.; Fleming, B.C.; Warman, M.L.; Jay, G.D. Role of lubricin and boundary lubrication in the prevention of chondrocyte apoptosis. Proc. Natl. Acad. Sci. USA 2013, 110, 5852–5857. [Google Scholar] [CrossRef]
- Qadri, M.M.; Jay, G.D.; Ostrom, R.S.; Zhang, L.X.; Elsaid, K.A. cAMP attenuates TGF-beta’s profibrotic responses in osteoarthritic synoviocytes: Involvement of hyaluronan and PRG4. Am. J. Physiol. Cell Physiol. 2018, 315, C432–C443. [Google Scholar] [CrossRef]
- Boldt, J.G.; Munzinger, U.K.; Zanetti, M.; Hodler, J. Arthrofibrosis associated with total knee arthroplasty: Gray-scale and power Doppler sonographic findings. AJR Am. J. Roentgenol. 2004, 182, 337–340. [Google Scholar] [CrossRef]
- Watson, R.S.; Gouze, E.; Levings, P.P.; Bush, M.L.; Kay, J.D.; Jorgensen, M.S.; Dacanay, E.A.; Reith, J.W.; Wright, T.W.; Ghivizzani, S.C. Gene delivery of TGF-beta1 induces arthrofibrosis and chondrometaplasia of synovium in vivo. Lab. Investig. 2010, 90, 1615–1627. [Google Scholar] [CrossRef]
- Cai, Y.; He, C.; Dai, Y.; Zhang, D.; Lv, G.; Lu, H.; Chen, G. Spinal interleukin-24 contributes to neuropathic pain after peripheral nerve injury through interleukin-20 receptor2 in mice. Exp. Neurol. 2024, 372, 114643. [Google Scholar] [CrossRef]
- Finan, P.H.; Buenaver, L.F.; Bounds, S.C.; Hussain, S.; Park, R.J.; Haque, U.J.; Campbell, C.M.; Haythornthwaite, J.A.; Edwards, R.R.; Smith, M.T. Discordance between pain and radiographic severity in knee osteoarthritis: Findings from quantitative sensory testing of central sensitization. Arthritis Rheum. 2013, 65, 363–372. [Google Scholar] [CrossRef] [PubMed]
- Muraki, S.; Oka, H.; Akune, T.; Mabuchi, A.; En-yo, Y.; Yoshida, M.; Saika, A.; Suzuki, T.; Yoshida, H.; Ishibashi, H.; et al. Prevalence of radiographic knee osteoarthritis and its association with knee pain in the elderly of Japanese population-based cohorts: The ROAD study. Osteoarthr. Cartil. 2009, 17, 1137–1143. [Google Scholar] [CrossRef] [PubMed]
- Murphy, S.L.; Lyden, A.K.; Phillips, K.; Clauw, D.J.; Williams, D.A. Association between pain, radiographic severity, and centrally-mediated symptoms in women with knee osteoarthritis. Arthritis Care Res. 2011, 63, 1543–1549. [Google Scholar] [CrossRef] [PubMed]
- Pang, H.; Chen, S.; Klyne, D.M.; Harrich, D.; Ding, W.; Yang, S.; Han, F.Y. Low back pain and osteoarthritis pain: A perspective of estrogen. Bone Res. 2023, 11, 42. [Google Scholar] [CrossRef] [PubMed]
- Boyan, B.D.; Hart, D.A.; Enoka, R.M.; Nicolella, D.P.; Resnick, E.; Berkley, K.J.; Sluka, K.A.; Kwoh, C.K.; Tosi, L.L.; O’Connor, M.I.; et al. Hormonal modulation of connective tissue homeostasis and sex differences in risk for osteoarthritis of the knee. Biol. Sex. Differ. 2013, 4, 3. [Google Scholar] [CrossRef] [PubMed]
- Cirillo, D.J.; Wallace, R.B.; Wu, L.; Yood, R.A. Effect of hormone therapy on risk of hip and knee joint replacement in the Women’s Health Initiative. Arthritis Rheum. 2006, 54, 3194–3204. [Google Scholar] [CrossRef]
- Liu, X.; Zhou, H.; Huang, X.; Cui, J.; Long, T.; Xu, Y.; Liu, H.; Yu, R.; Zhao, R.; Luo, G.; et al. A Broad Blockade of Signaling from the IL-20 Family of Cytokines Potently Attenuates Collagen-Induced Arthritis. J. Immunol. 2016, 197, 3029–3037. [Google Scholar] [CrossRef]
Female (n = 34) | Male (n = 34) | p | |
---|---|---|---|
Age (years) | 73.9 ± 7.3 | 72.1 ± 10.3 | 0.410 |
BMI (kg/m2) | 26.1 ± 4.4 | 26.3 ± 3.2 | 0.889 |
KL grade (3/4), N | 14/20 | 12/22 | 0.402 |
VAS | 7.2± 2.3 | 7.0 ± 2.3 | 0.700 |
Primer | Sequence (5′–3′) | Product Size (bp) |
---|---|---|
IL24-F | GCCTCTGGATGCTGTGAAGA | 200 |
IL24-R | ACTAAGCACCCATCCACTGC | |
ET1-F | CTCTGCTGTTTGTGGCTTGC | 103 |
ET1-R | GGACTGGGAGTGGGTTTCTC | |
ENTPD2-F | CCCTCAAGTATGGCATCGTC | 72 |
ENTPD2-R | CTGCCGGCCACTTGTAGATA | |
MYH11-F | GATCGAGAACCTCACCCAGC | 182 |
MYH11-R | TCTCCTCGGCTAACAACTGA | |
GAPDH-F | TGTTGCCATCAATGACCCCTT | 202 |
GAPDH-R | CTCCACGACGTACTCAGCG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shibata, N.; Ohashi, Y.; Tsukada, A.; Iwase, D.; Aikawa, J.; Mukai, M.; Metoki, Y.; Uekusa, Y.; Sato, M.; Inoue, G.; et al. IL24 Expression in Synovial Myofibroblasts: Implications for Female Osteoarthritis Pain through Propensity Score Matching Analysis. Medicina 2024, 60, 741. https://doi.org/10.3390/medicina60050741
Shibata N, Ohashi Y, Tsukada A, Iwase D, Aikawa J, Mukai M, Metoki Y, Uekusa Y, Sato M, Inoue G, et al. IL24 Expression in Synovial Myofibroblasts: Implications for Female Osteoarthritis Pain through Propensity Score Matching Analysis. Medicina. 2024; 60(5):741. https://doi.org/10.3390/medicina60050741
Chicago/Turabian StyleShibata, Naoya, Yoshihisa Ohashi, Ayumi Tsukada, Dai Iwase, Jun Aikawa, Manabu Mukai, Yukie Metoki, Yui Uekusa, Masashi Sato, Gen Inoue, and et al. 2024. "IL24 Expression in Synovial Myofibroblasts: Implications for Female Osteoarthritis Pain through Propensity Score Matching Analysis" Medicina 60, no. 5: 741. https://doi.org/10.3390/medicina60050741
APA StyleShibata, N., Ohashi, Y., Tsukada, A., Iwase, D., Aikawa, J., Mukai, M., Metoki, Y., Uekusa, Y., Sato, M., Inoue, G., Takaso, M., & Uchida, K. (2024). IL24 Expression in Synovial Myofibroblasts: Implications for Female Osteoarthritis Pain through Propensity Score Matching Analysis. Medicina, 60(5), 741. https://doi.org/10.3390/medicina60050741