Attenuation of Immunogenicity in MOG-Induced Oligodendrocytes by the Probiotic Bacterium Lactococcus Sp. PO3
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and Handling Procedures
2.2. Isolation of Beneficial Bacteria from Cow Milk
2.3. Catalase and Hemolytic Activity
2.4. Identification Methods
2.4.1. Phenotypic Characterization
2.4.2. Bile Salt Hydrolase (BSH) Activity
2.4.3. Cell Surface Hydrophobicity
2.4.4. Cholesterol Assimilation
= (Cholesterol [µg mL−1]) 0 h − (Cholesterol [µg mL−1]) 24 h
= (Cholesterol assimilated [µg mL−1]/Cholesterol [µg mL−1] 0 h) × 100%
2.5. In Vitro Screening of Probiotic Properties
Acid and Bile Tolerance
2.6. Effect of Probiotics on Neuroanti-Inflammatory Activity
Cell Culture and Cell Differentiation
2.7. Adhesion Assay
2.8. Measurement of NO Production
2.9. Cytokine Assays
2.10. RT-PCR Analysis of Genes on the Inflammatory Signaling Pathway
2.11. Genotypic Characterization
2.12. Statistical Analysis
3. Results
3.1. Bacterial Adhesion
3.2. Molecular Identification of PO3 Using Sequencing of the 16S rRNA Gene
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Houbad, K.; Bekada, A.M.A.; Homrani, A.; Djellid, Y. Phenotypic and Genotypic Characterization of Lactococci Isolated from Different Kinds of Raw Milk (Goat, Cow, Sheep and Camel). Ukr. J. Ecol. 2022, 12, 45–60. [Google Scholar]
- Santacroce, L.; Charitos, I.A.; Bottalico, L. A Successful History: Probiotics and Their Potential as Antimicrobials. Expert. Rev. Anti Infect. Ther. 2019, 17, 635–645. [Google Scholar] [CrossRef]
- Maślak, E.; Złoch, M.; Arendowski, A.; Sugajski, M.; Janczura, I.; Rudnicka, J.; Walczak-Skierska, J.; Buszewska-Forajta, M.; Rafińska, K.; Pomastowski, P.; et al. Isolation and Identification of Lactococcus lactis and Weissella cibaria Strains from Fermented Beetroot and an Investigation of Their Properties as Potential Starter Cultures and Probiotics. Foods 2022, 11, 2257. [Google Scholar] [CrossRef] [PubMed]
- Baig, D.N.; Mehnaz, S. An Overview of Dairy Microflora. In Probiotic Bacteria and Postbiotic Metabolites: Role in Animal and Human Health; Springer: Singapore, 2021; pp. 101–137. [Google Scholar]
- Abushelaibi, A.; Al-Mahadin, S.; El-Tarabily, K.; Shah, N.P.; Ayyash, M. Characterization of Potential Probiotic Lactic Acid Bacteria Isolated from Camel Milk. LWT 2017, 79, 316–325. [Google Scholar] [CrossRef]
- Amara, A.A.; Shibl, A. Role of Probiotics in Health Improvement, Infection Control and Disease Treatment and Management. Saudi Pharm. J. 2015, 23, 107–114. [Google Scholar] [CrossRef]
- Addis, M.F.; Tedde, V.; Puggioni, G.M.G.; Pisanu, S.; Casula, A.; Locatelli, C.; Rota, N.; Bronzo, V.; Moroni, P.; Uzzau, S. Evaluation of Milk Cathelicidin for Detection of Bovine Mastitis. J. Dairy Sci. 2016, 99, 8250–8258. [Google Scholar] [CrossRef]
- Boix-Amorós, A.; Collado, M.C.; Mira, A. Relationship between Milk Microbiota, Bacterial Load, Macronutrients, and Human Cells during Lactation. Front. Microbiol. 2016, 7, 492. [Google Scholar] [CrossRef]
- Derakhshani, E.; Naghizadeh, A. Optimization of Humic Acid Removal by Adsorption onto Bentonite and Montmorillonite Nanoparticles. J. Mol. Liq. 2018, 259, 76–81. [Google Scholar] [CrossRef]
- Hoque, M.N.; Istiaq, A.; Clement, R.A.; Sultana, M.; Crandall, K.A.; Siddiki, A.Z.; Hossain, M.A. Metagenomic Deep Sequencing Reveals Association of Microbiome Signature with Functional Biases in Bovine Mastitis. Sci. Rep. 2019, 9, 13536. [Google Scholar] [CrossRef]
- Murphy, K.; Curley, D.; O’callaghan, T.F.; O’shea, C.A.; Dempsey, E.M.; O’toole, P.W.; Ross, R.P.; Ryan, C.A.; Stanton, C. The Composition of Human Milk and Infant Faecal Microbiota over the First Three Months of Life: A Pilot Study. Sci. Rep. 2017, 7, 40597. [Google Scholar] [CrossRef]
- Lima, S.F.; De Souza Bicalho, M.L.; Bicalho, R.C. Evaluation of Milk Sample Fractions for Characterization of Milk Microbiota from Healthy and Clinical Mastitis Cows. PLoS ONE 2018, 13, e0193671. [Google Scholar] [CrossRef]
- Erhardt, M.M.; de Oliveira, W.C.; Fröder, H.; Marques, P.H.; Oliveira, M.B.P.P.; Richards, N.S.P.d.S. Lactic Bacteria in Artisanal Cheese: Characterization through Metagenomics. Fermentation 2023, 9, 41. [Google Scholar] [CrossRef]
- Kothe, C.I.; Mohellibi, N.; Renault, P. Revealing the Microbial Heritage of Traditional Brazilian Cheeses through Metagenomics. Food Res. Int. 2022, 157, 111265. [Google Scholar] [CrossRef] [PubMed]
- Zago, M.; Bonvini, B.; Rossetti, L.; Fergonzi, G.; Tidona, F.; Giraffa, G.; Carminati, D. Raw Milk for Provolone Valpadana PDO Cheese: Impact of Modified Cold Storage Conditions on the Composition of the Bacterial Biota. Dairy 2022, 3, 700–709. [Google Scholar] [CrossRef]
- Vithanage, N.R.; Dissanayake, M.; Bolge, G.; Palombo, E.A.; Yeager, T.R.; Datta, N. Microbiological Quality of Raw Milk Attributable to Prolonged Refrigeration Conditions. J. Dairy Res. 2017, 84, 92–101. [Google Scholar] [CrossRef]
- Gobbetti, M.; Neviani, E.; Fox, P.; Varanini, G.M. The Cheeses of Italy: Science and Technology; Springer: Cham, Switzerland, 2018. [Google Scholar]
- Li, L.; Renye, J.A.; Feng, L.; Zeng, Q.; Tang, Y.; Huang, L.; Ren, D.; Yang, P. Characterization of the Indigenous Microflora in Raw and Pasteurized Buffalo Milk during Storage at Refrigeration Temperature by High-Throughput Sequencing. J. Dairy Sci. 2016, 99, 7016–7024. [Google Scholar] [CrossRef]
- Crane, J.D.; Palanivel, R.; Mottillo, E.P.; Bujak, A.L.; Wang, H.; Ford, R.J.; Collins, A.; Blümer, R.M.; Fullerton, M.D.; Yabut, J.M.; et al. Inhibiting Peripheral Serotonin Synthesis Reduces Obesity and Metabolic Dysfunction by Promoting Brown Adipose Tissue Thermogenesis. Nat. Med. 2015, 21, 166–172. [Google Scholar] [CrossRef]
- Yano, J.M.; Yu, K.; Donaldson, G.P.; Shastri, G.G.; Ann, P.; Ma, L.; Nagler, C.R.; Ismagilov, R.F.; Mazmanian, S.K.; Hsiao, E.Y. Indigenous Bacteria from the Gut Microbiota Regulate Host Serotonin Biosynthesis. Cell 2015, 161, 264–276. [Google Scholar] [CrossRef]
- Varesi, A.; Campagnoli, L.I.M.; Fahmideh, F.; Pierella, E.; Romeo, M.; Ricevuti, G.; Nicoletta, M.; Chirumbolo, S.; Pascale, A. The Interplay between Gut Microbiota and Parkinson’s Disease: Implications on Diagnosis and Treatment. Int. J. Mol. Sci. 2022, 23, 12289. [Google Scholar] [CrossRef]
- Wong, R.K.; Yang, C.; Song, G.H.; Wong, J.; Ho, K.Y. Melatonin Regulation as a Possible Mechanism for Probiotic (VSL#3) in Irritable Bowel Syndrome: A Randomized Double-Blinded Placebo Study. Dig. Dis. Sci. 2015, 60, 186–194. [Google Scholar] [CrossRef]
- Erny, D.; De Angelis, A.L.H.; Jaitin, D.; Wieghofer, P.; Staszewski, O.; David, E.; Keren-Shaul, H.; Mahlakoiv, T.; Jakobshagen, K.; Buch, T.; et al. Host Microbiota Constantly Control Maturation and Function of Microglia in the CNS. Nat. Neurosci. 2015, 18, 965–977. [Google Scholar] [CrossRef] [PubMed]
- Freedman, S.N.; Shahi, S.K.; Mangalam, A.K. The “Gut Feeling”: Breaking Down the Role of Gut Microbiome in Multiple Sclerosis. Neurotherapeutics 2018, 15, 109–125. [Google Scholar] [CrossRef] [PubMed]
- Jiang, J.; Chu, C.; Wu, C.; Wang, C.; Zhang, C.; Li, T.; Zhai, Q.; Yu, L.; Tian, F.; Chen, W. Efficacy of Probiotics in Multiple Sclerosis: A Systematic Review of Preclinical Trials and Meta-Analysis of Randomized Controlled Trials. Food Funct. 2021, 12, 2354–2377. [Google Scholar] [CrossRef] [PubMed]
- Hosseinifard, E.-S.; Morshedi, M.; Bavafa-Valenlia, K.; Saghafi-Asl, M. The Novel Insight into Anti-Inflammatory and Anxiolytic Effects of Psychobiotics in Diabetic Rats: Possible Link between Gut Microbiota and Brain Regions. Eur. J. Nutr. 2019, 58, 3361–3375. [Google Scholar] [CrossRef] [PubMed]
- Khalifa, A.; Sheikh, A.; Ibrahim, H.I.M. Bacillus amyloliquefaciens Enriched Camel Milk Attenuated Colitis Symptoms in Mice Model. Nutrients 2022, 14, 1967. [Google Scholar] [CrossRef] [PubMed]
- Ganji-Arjenaki, M.; Rafieian-Kopaei, M. Probiotics Are a Good Choice in Remission of Inflammatory Bowel Diseases: A Meta Analysis and Systematic Review. J. Cell Physiol. 2018, 233, 2091–2103. [Google Scholar] [CrossRef]
- Ibrahim, H.I.M.; Sheikh, A.; Khalil, H.E.; Khalifa, A. Bacillus amyloliquifaciens-Supplemented Camel Milk Suppresses Neuroinflammation of Autoimmune Encephalomyelitis in a Mouse Model by Regulating Inflammatory Markers. Nutrients 2023, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Khalifa, A.; Ibrahim, H.I.M.; Sheikh, A.; Khalil, H.E. Probiotic-Fermented Camel Milk Attenuates Neurodegenerative Symptoms via SOX5/MiR-218 Axis Orchestration in Mouse Models. Pharmaceuticals 2023, 16, 357. [Google Scholar] [CrossRef] [PubMed]
- Mayo-Yáñez, M.; González-Torres, L. Recurrent Penicillin-Resistant Tonsillitis Due to Lactococcus garvieae, a New Zoonosis from Aquaculture. Zoonotic Dis. 2023, 3, 1–5. [Google Scholar] [CrossRef]
- Ramalho, J.B.; Spiazzi, C.C.; Bicca, D.F.; Rodrigues, J.F.; Sehn, C.P.; da Silva, W.P.; Cibin, F.W.S. Beneficial Effects of Lactococcus lactis subsp. cremoris LL95 Treatment in an LPS-Induced Depression-like Model in Mice. Behav. Brain Res. 2022, 426, 113847. [Google Scholar]
- Gao, K.; Farzi, A.; Ke, X.; Yu, Y.; Chen, C.; Chen, S.; Yu, T.; Wang, H.; Li, Y. Oral Administration of Lactococcus lactis WHH2078 Alleviates Depressive and Anxiety Symptoms in Mice with Induced Chronic Stress. Food Funct. 2022, 13, 957–969. [Google Scholar] [CrossRef]
- Matsuura, N.; Motoshima, H.; Uchida, K.; Yamanaka, Y. Effects of Lactococcus lactis subsp. cremoris YRC3780 Daily Intake on the HPA Axis Response to Acute Psychological Stress in Healthy Japanese Men. Eur. J. Clin. Nutr. 2022, 76, 574–580. [Google Scholar] [PubMed]
- Guimaraes, M.A.F.; Pinheiro-Rosa, N.; Oliveira, R.P.; Aguiar, S.L.F.; Miranda, M.C.G.; Lemos, L.; Souza, A.L.; Dos Reis, D.S.; Medeiros, S.R.; Gonçalves, W.A. Hsp65-Producing Lactococcus lactis Inhibits Experimental Autoimmune Encephalomyelitis by Preventing Cell Migration into Spinal Cord. Cell Immunol. 2023, 384, 104661. [Google Scholar] [CrossRef] [PubMed]
- Lin, W.H.; Hwang, C.F.; Chen, L.W.; Tsen, H.Y. Viable Counts, Characteristic Evaluation for Commercial Lactic Acid Bacteria Products. Food Microbiol. 2006, 23, 74–81. [Google Scholar] [CrossRef]
- Angmo, K.; Kumari, A.; Savitri; Bhalla, T.C. Probiotic Characterization of Lactic Acid Bacteria Isolated from Fermented Foods and Beverage of Ladakh. LWT 2016, 66, 428–435. [Google Scholar] [CrossRef]
- Khalifa, A.; Ibrahim, H.I.M. Enterococcus faecium from Chicken Feces Improves Chicken Immune Response and Alleviates Salmonella Infections: A Pilot Study. J. Anim. Sci. 2023, 101, skad016. [Google Scholar] [CrossRef]
- Shehata, M.G.; El Sohaimy, S.A.; El-Sahn, M.A.; Youssef, M.M. Screening of Isolated Potential Probiotic Lactic Acid Bacteria for Cholesterol Lowering Property and Bile Salt Hydrolase Activity. Ann. Agric. Sci. 2016, 61, 65–75. [Google Scholar] [CrossRef]
- Hairul Islam, V.I.; Saravanan, S.; Preetam Raj, J.P.; Gabriel Paulraj, M.; Ignacimuthu, S. Myroides Pelagicus from the Gut of Drosophila melanogaster Attenuates Inflammation on Dextran Sodium Sulfate-Induced Colitis. Dig. Dis. Sci. 2014, 59, 1121–1133. [Google Scholar] [CrossRef]
- Pithva, S.; Shekh, S.; Dave, J.; Vyas, B.R.M. Probiotic Attributes of Autochthonous Lactobacillus rhamnosus Strains of Human Origin. Appl. Biochem. Biotechnol. 2014, 173, 259–277. [Google Scholar] [CrossRef]
- Arranz-Valsero, I.; Soriano-Romaní, L.; García-Posadas, L.; López-García, A.; Diebold, Y. IL-6 as a Corneal Wound Healing Mediator in an in Vitro Scratch Assay. Exp. Eye Res. 2014, 125, 183–192. [Google Scholar] [CrossRef]
- Phuengjaya, S.; Phinkian, N.; Tanasupawa, S.; Teeradakor, S. Diversity and Succinic Acid Production of Lactic Acid Bacteria Isolated from Animals, Soils and Tree Barks. Res. J. Microbiol. 2017, 12, 177–186. [Google Scholar] [CrossRef]
- Yoon, S.H.; Ha, S.M.; Kwon, S.; Lim, J.; Kim, Y.; Seo, H.; Chun, J. Introducing EzBioCloud: A Taxo-nomically United Database of 16S RRNA Gene Sequences and Whole-Genome Assemblies. Int. J. Syst. Evol. Microbiol. 2017, 67, 1613–1617. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Saitou, N.; Nei, M. The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [PubMed]
- El-Sohaimy, S.A.; Hussain, M.A. Functional Probiotic Foods Development: Trends, Concepts, and Products. Fermentation 2023, 9, 249. [Google Scholar] [CrossRef]
- Miljkovic, M.; Marinkovic, P.; Novovic, K.; Jovcic, B.; Terzic-Vidojevic, A.; Kojic, M. AggLr, a Novel Aggregation Factor in Lactococcus raffinolactis BGTRK10-1: Its Role in Surface Adhesion. Biofouling 2018, 34, 685–698. [Google Scholar] [CrossRef]
- Saroha, T.; Sharma, S.; Choksket, S.; Korpole, S.; Patil, P.B. Limosilactobacillus walteri sp. Nov., a Novel Probiotic Antimicrobial Lipopeptide-Producing Bacterium. FEMS Microbiol. Lett. 2023, 370, fnad004. [Google Scholar] [CrossRef]
- Dinkçi, N.; Akdeniz, V.; Akalın, A.S. Probiotic Whey-Based Beverages from Cow, Sheep and Goat Milk: Antioxidant Activity, Culture Viability, Amino Acid Contents. Foods 2023, 12, 610. [Google Scholar] [CrossRef]
- Yaylaci, E.U. Antibacterial Activity and In Vitro Probiotic Properties of Lactococcus lactis Isolated from Sea Bass (Dicentrarchus labrax). J. Anatol. Environ. Anim. Sci. 2022, 7, 251–256. [Google Scholar]
- Mileriene, J.; Aksomaitiene, J.; Kondrotiene, K.; Asledottir, T.; Vegarud, G.E.; Serniene, L.; Malakauskas, M. Whole-Genome Sequence of Lactococcus lactis subsp. lactis LL16 Confirms Safety, Probiotic Potential, and Reveals Functional Traits. Microorganisms 2023, 11, 1034. [Google Scholar]
- Efrizal; Ismail, S.; Ameen, F.; Bhat, S.A.; Dadrasnia, A.; Ajeng, A.A.; Nasir, N.N.M.; Abdullah, R. Analysis and Characterization of Potential Probiotic Properties of Lactobacillus and Bacillus salmalaya 139SI. Emir. J. Food Agric. 2022, 34, 595–604. [Google Scholar] [CrossRef]
- Pytka, M.; Kordowska-Wiater, M.; Wajs, J.; Glibowski, P.; Sajnaga, E. Usefulness of Potentially Probiotic L. lactis Isolates from Polish Fermented Cow Milk for the Production of Cottage Cheese. Appl. Sci. 2022, 12, 12088. [Google Scholar] [CrossRef]
- Plimack, E.R.; LoRusso, P.M.; McCoon, P.; Tang, W.; Krebs, A.D.; Curt, G.; Eckhardt, S.G. AZD1480: A Phase I Study of a Novel JAK2 Inhibitor in Solid Tumors. Oncologist 2013, 18, 819–820. [Google Scholar] [CrossRef] [PubMed]
- Nabavi-Rad, A.; Sadeghi, A.; Asadzadeh Aghdaei, H.; Yadegar, A.; Smith, S.M.; Zali, M.R. The Double-Edged Sword of Probiotic Supplementation on Gut Microbiota Structure in Helicobacter pylori Management. Gut Microbes 2022, 14, 2108655. [Google Scholar] [CrossRef]
- Kaur, H.; Kaur, G.; Ali, S.A. Dairy-Based Probiotic-Fermented Functional Foods: An Update on Their Health-Promoting Properties. Fermentation 2022, 8, 425. [Google Scholar] [CrossRef]
Primer Name | Forward | Reverse | PCR Product Size | Ref. |
---|---|---|---|---|
STAT-3 | CTTTGAGACCGAGGTGTATCACC | GGTCAGCATGTTGTACCACAGG | 189 | [42] |
MBP | ATTCACCGAGGAGAGGCTGGAA | TGTGTGCTTGGAGTCTGTCACC | 245 | [30] |
GFAP | CTGGAGAGGAAGATTGAGTCGC | ACGTCAAGCTCCACATGGACCT | 144 | https://www.origene.com/catalog (accessed on 15 March 2023) |
GalC | ATCTCTGGGAGCCGATTTCCTC | CCACACTGTGTAGGTTCCAGGA | 135 | https://www.origene.com/catalog (accessed on 15 March 2023) |
GAPDH | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA | 188 | [30] |
One-Week Lactating Milk | 25th-Week Lactating Milk | ||||||||
---|---|---|---|---|---|---|---|---|---|
No of Isolates | PN1 | PN2 | PN3 | PN4 | PO1 | PO2 | PO3 | PO4 | PO5 |
Shape of the cell | Rod | Rod | Cocci | Cocci in chain | Cocci | Rod | Rod | Rod | Cocci |
Growth (at 8% NaCl) | + | + | + | − | − | + | + | + | + |
Growth (at pH 3) | + | + | − | − | + | + | + | − | − |
Catalase | − | − | − | + | − | − | − | − | − |
Hemolysis activity | − | − | + | + | − | − | − | − | − |
Selected Probiotic Strains | pH 3 | pH 4 | Bile 0.3% | Bile 0.6% |
---|---|---|---|---|
PN1 | 5.6 ± 0.7 | 6.12 ± 0.2 | 9.2 ± 0.57 * | 8.8 ± 0.3 * |
PN2 | 7.9 ± 0.2 * | 6.5 ± 0.3 | 9.1 ± 0.9 | 8.7 ± 0.2 |
PO2 | 5.5 ± 0.1 | 6.4 ± 0.4 | 8.8 ± 1.1 | 7.8 ± 0.3 |
PO3 | 6.64 ± 0.3 * | 6.9 ± 0.2 * | 9.25 ± 0.7 * | 8.9 ± 0.6 * |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khalifa, A.; Ibrahim, H.-I.M.; Sheikh, A.; Khalil, H.E. Attenuation of Immunogenicity in MOG-Induced Oligodendrocytes by the Probiotic Bacterium Lactococcus Sp. PO3. Medicina 2023, 59, 1731. https://doi.org/10.3390/medicina59101731
Khalifa A, Ibrahim H-IM, Sheikh A, Khalil HE. Attenuation of Immunogenicity in MOG-Induced Oligodendrocytes by the Probiotic Bacterium Lactococcus Sp. PO3. Medicina. 2023; 59(10):1731. https://doi.org/10.3390/medicina59101731
Chicago/Turabian StyleKhalifa, Ashraf, Hairul-Islam Mohamed Ibrahim, Abdullah Sheikh, and Hany Ezzat Khalil. 2023. "Attenuation of Immunogenicity in MOG-Induced Oligodendrocytes by the Probiotic Bacterium Lactococcus Sp. PO3" Medicina 59, no. 10: 1731. https://doi.org/10.3390/medicina59101731
APA StyleKhalifa, A., Ibrahim, H.-I. M., Sheikh, A., & Khalil, H. E. (2023). Attenuation of Immunogenicity in MOG-Induced Oligodendrocytes by the Probiotic Bacterium Lactococcus Sp. PO3. Medicina, 59(10), 1731. https://doi.org/10.3390/medicina59101731