Methotrexate and Cetuximab—Biological Impact on Non-Tumorigenic Models: In Vitro and In Ovo Assessments
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Line and Cell Culture Conditions
2.2. Cell Viability Evaluation by Means of Alamar Blue Colorimetric Assay
2.3. Scratch Assay Technique—A Wound Healing Method
2.4. RT-PCR Analysis
2.5. HET–CAM Method
2.6. Statistical Analysis
3. Results
3.1. Cell Viability Assessment
3.2. Evaluation of Antiproliferative and Antimigratory Capacity
3.3. Gene Expression
3.4. HET-CAM Test
4. Discussion
5. Conclusions
Author Contributions
Funding
Informed Consent Statement
Conflicts of Interest
References
- Marur, S.; Forastiere, A.A. Head and neck squamous cell carcinoma: Update on epidemiology, diagnosis, and treatment. Mayo Clin. Proc. 2016, 91, 386–396. [Google Scholar] [CrossRef] [Green Version]
- Watts, T.L.; Cui, R.; Szaniszlo, P.; Resto, V.A.; Powell, D.W.; Pinchuk, I. V PDGF-AA Mediates mesenchymal stromal cell chemotaxis to the head and neck squamous cell carcinoma tumor microenvironment. J. Transl. Med. 2016, 14, 337. [Google Scholar] [CrossRef] [Green Version]
- Fulcher, C.D.; Haigentz, M.J.; Ow, T.J. AHNS series: Do you know your guidelines? Principles of treatment for locally advanced or unresectable head and neck squamous cell carcinoma. Head Neck 2018, 40, 676–686. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, M.; Silva, E.; Barreiros, L.; Segundo, M.A.; Costa Lima, S.A.; Reis, S. Methotrexate loaded lipid nanoparticles for topical management of skin-related diseases: Design, characterization and skin permeation potential. Int. J. Pharm. 2016, 512, 14–21. [Google Scholar] [CrossRef] [PubMed]
- Medellín-Luna, M.F.; Castañeda-Delgado, J.E.; Fernández-Ruiz, J.C.; Ochoa-González, F.L.; Troncoso-Vázquez, L.; García-Cruz, S.; Zapata-Zúñiga, M.; Serrano, C.J.; Portales-Pérez, D.; Enciso-Moreno, J.A.; et al. Methotrexate reduces keratinocyte proliferation, migration and induces apoptosis in HaCaT keratinocytes in vitro and reduces wound closure in Skh1 mice in vivo. J. Tissue Viability 2021, 30, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Sapino, S.; Oliaro-Bosso, S.; Zonari, D.; Zattoni, A.; Ugazio, E. Mesoporous silica nanoparticles as a promising skin delivery system for methotrexate. Int. J. Pharm. 2017, 530, 239–248. [Google Scholar] [CrossRef]
- Zhao, Y.; Guo, Y.; Li, R.; Wang, T.; Han, M.; Zhu, C.; Wang, X. Methotrexate nanoparticles prepared with codendrimer from polyamidoamine (PAMAM) and oligoethylene glycols (OEG) dendrons: Antitumor efficacy in vitro and in vivo. Sci. Rep. 2016, 6, 28983. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Z.; Chan, A.; Wang, Z.; Huang, X.; Yu, G.; Jacobson, O.; Wang, S.; Liu, Y.; Shan, L.; Dai, Y.; et al. Synchronous chemoradiation nanovesicles by X-Ray triggered cascade of drug release. Angew. Chemie Int. Ed. 2018, 57, 8463–8467. [Google Scholar] [CrossRef]
- Faghfoori, M.H.; Nosrati, H.; Rezaeejam, H.; Charmi, J.; Kaboli, S.; Johari, B.; Danafar, H. Anticancer effect of X-Ray triggered methotrexate conjugated albumin coated bismuth sulfide nanoparticles on SW480 colon cancer cell line. Int. J. Pharm. 2020, 582, 119320. [Google Scholar] [CrossRef]
- Nosrati, H.; Attari, E.; Abhari, F.; Barsbay, M.; Ghaffarlou, M.; Mousazadeh, N.; Vaezi, R.; Kavetskyy, T.; Rezaeejam, H.; Webster, T.J.; et al. Complete Ablation of tumors using synchronous chemoradiation with bimetallic theranostic nanoparticles. Bioact. Mater. 2022, 7, 74–84. [Google Scholar] [CrossRef] [PubMed]
- Johari, B.; Rahmati, M.; Nasehi, L.; Mortazavi, Y.; Faghfoori, M.H.; Rezaeejam, H. Evaluation of STAT3 decoy oligodeoxynucleotides’ synergistic effects on radiation and/or chemotherapy in metastatic breast cancer cell line. Cell Biol. Int. 2020, 44, 2499–2511. [Google Scholar] [CrossRef]
- Fornasier, G.; Francescon, S.; Baldo, P. An update of efficacy and safety of cetuximab in metastatic colorectal cancer: A narrative review. Adv. Ther. 2018, 35, 1497–1509. [Google Scholar] [CrossRef] [PubMed]
- Landmesser, M.E.; Raup-Konsavage, W.M.; Lehman, H.L.; Stairs, D.B. Loss of P120ctn causes EGFR-targeted therapy resistance and failure. PLoS ONE 2020, 15, e0241299. [Google Scholar] [CrossRef]
- Muraro, E.; Fanetti, G.; Lupato, V.; Giacomarra, V.; Steffan, A.; Gobitti, C.; Vaccher, E.; Franchin, G. Cetuximab in locally advanced head and neck squamous cell carcinoma: Biological mechanisms involved in efficacy, toxicity and resistance. Crit. Rev. Oncol. Hematol. 2021, 164, 103424. [Google Scholar] [CrossRef] [PubMed]
- Lin, P.H.; Tseng, C.L.; Cheng, Y.C.; Ho, C.H.; Chen, S.C.; Wang, Y.; Liu, E.; Issafras, H.; Jiang, W. Distinguishing features of a novel humanized anti-EGFR monoclonal antibody based on cetuximab with superior antitumor efficacy. Expert Opin. Biol. Ther. 2021, 21, 1491–1507. [Google Scholar] [CrossRef] [PubMed]
- Lacouture, M.E.; Wainberg, Z.A.; Patel, A.B.; Anadkat, M.J.; Stemmer, S.M.; Shacham-Shmueli, E.; Medina, E.; Zelinger, G.; Shelach, N.; Ribas, A. Reducing skin toxicities from EGFR inhibitors with topical BRAF inhibitor therapy. Cancer Discov. 2021, 11, 2158–2167. [Google Scholar] [CrossRef]
- Piipponen, M.; Li, D.; Landén, N.X. The immune functions of keratinocytes in skin wound healing. Int. J. Mol. Sci. 2020, 21, 8790. [Google Scholar] [CrossRef] [PubMed]
- Colombo, I.; Sangiovanni, E.; Maggio, R.; Mattozzi, C.; Zava, S.; Corbett, Y.; Fumagalli, M.; Carlino, C.; Corsetto, P.A.; Scaccabarozzi, D.; et al. HaCaT cells as a reliable in vitro differentiation model to dissect the inflammatory/repair response of human keratinocytes. Mediators Inflamm. 2017, 2017, 7435621. [Google Scholar] [CrossRef]
- Corlan, I.V.; Cheveresan, A.; Vaduva, D.B.; Nica, C.; Faur, A.; Rumel, R.C.; Popovici, R.A. Characterization of healthy and tumor oral cell lines of human origin: The preliminary stage in the assessment of relevant chemical compounds with impact on dentistry. Rev. Chim. 2018, 69, 2891–2894. [Google Scholar] [CrossRef]
- Guran, K.; Buzatu, R.; Pinzaru, I.; Boruga, M.; Marcovici, I.; Coricovac, D.; Avram, S.; Poenaru, M.; Susan, M.; Susan, R.; et al. In vitro pharmaco-toxicological characterization of melissa officinalis total extract using oral, pharynx and colorectal carcinoma cell lines. Processes 2021, 9, 850. [Google Scholar] [CrossRef]
- Pinzaru, I.; Tanase, A.; Enatescu, V.; Coricovac, D.; Bociort, F.; Marcovici, I.; Watz, C.; Vlaia, L.; Soica, C.; Dehelean, C. Proniosomal gel for topical delivery of rutin: Preparation, physicochemical characterization and in vitro toxicological profile using 3d reconstructed human epidermis tissue and 2d cells. Antioxidants 2021, 10, 85. [Google Scholar] [CrossRef]
- Maghiari, A.L.; Coricovac, D.; Pinzaru, I.A.; Macașoi, I.G.; Marcovici, I.; Simu, S.; Navolan, D.; Dehelean, C. High concentrations of aspartame induce pro-angiogenic effects in ovo and cytotoxic effects in HT-29 human colorectal carcinoma cells. Nutrients 2020, 12, 3600. [Google Scholar] [CrossRef]
- Hut, E.-F.; Radulescu, M.; Pilut, N.; Macasoi, I.; Berceanu, D.; Coricovac, D.; Pinzaru, I.; Cretu, O.; Dehelean, C. Two antibiotics, ampicillin and tetracycline, exert different effects in HT-29 colorectal adenocarcinoma cells in terms of cell viability and migration capacity. Curr. Oncol. 2021, 28, 2466–2480. [Google Scholar] [CrossRef] [PubMed]
- Farcas, C.G.; Dehelean, C.; Pinzaru, I.A.; Mioc, M.; Socoliuc, V.; Moaca, E.A.; Avram, S.; Ghiulai, R.; Coricovac, D.; Pavel, I.; et al. Thermosensitive betulinic acid-loaded magnetoliposomes: A promising antitumor potential for highly aggressive human breast adenocarcinoma cells under hyperthermic conditions. Int. J. Nanomed. 2020, 15, 8175–8200. [Google Scholar] [CrossRef] [PubMed]
- Batista-duharte, A.; Murillo, G.J.; Betancourt, J.E.; Oliver, P.; Damiana, T. The hen’s egg test on chorioallantoic membrane: An alternative assay for the assessment of the irritating effect of vaccine adjuvants. J. Toxicol. 2016, 35, 627–633. [Google Scholar] [CrossRef] [PubMed]
- Macașoi, I.; Pavel, I.Z.; Moacă, A.E.; Avram, Ș.; David, V.L.; Coricovac, D.; Mioc, A.; Spandidos, D.A.; Tsatsakis, A.; Șoica, C.; et al. Mechanistic investigations of antitumor activity of a rhodamine B-oleanolic acid derivative bioconjugate. Oncol. Rep. 2020, 44, 1169–1183. [Google Scholar] [CrossRef]
- Budai, P.; Kormos, É.; Buda, I.; Somody, G.; Lehel, J. Comparative evaluation of HET-CAM and ICE methods for objective assessment of ocular irritation caused by selected pesticide products. Toxicol. In Vitro 2021, 74, 105150. [Google Scholar] [CrossRef]
- Ozkan, A.; Erdogan, A.; Ozkan, O.; Manguoglu, E.; Kiraz, N. Enhanced anticancer effect of cetuximab combined with stabilized silver ion solution in EGFR-positive lung cancer cells. Turk. J. Biochem. 2019, 44, 426–437. [Google Scholar] [CrossRef]
- Kar, S.; Kundu, B.; Reis, R.L.; Sarkar, R.; Nandy, P.; Basu, R.; Das, S. Curcumin ameliorates the targeted delivery of methotrexate intercalated montmorillonite clay to cancer cells. Eur. J. Pharm. Sci. 2019, 135, 91–102. [Google Scholar] [CrossRef]
- Du, Z.; Lovly, C.M. Mechanisms of receptor tyrosine kinase activation in cancer. Mol. Cancer 2018, 17, 58. [Google Scholar] [CrossRef]
- Joly-Tonetti, N.; Ondet, T.; Monshouwer, M.; Stamatas, G.N. EGFR Inhibitors switch keratinocytes from a proliferative to a differentiative phenotype affecting epidermal development and barrier function. BMC Cancer 2021, 21, 5. [Google Scholar] [CrossRef] [PubMed]
- Tougeron, D.; Emambux, S.; Favot, L.; Lecomte, T.; Wierzbicka-Hainaut, E.; Samimi, M.; Frouin, E.; Azzopardi, N.; Chevrier, J.; Serres, L.; et al. Skin Inflammatory response and efficacy of anti-epidermal growth factor receptor therapy in metastatic colorectal cancer (CUTACETUX). Oncoimmunology 2020, 9, 1848058. [Google Scholar] [CrossRef]
- Matsumura, S.; Terao, M.; Itami, S.; Katayama, I. Local cortisol activation is involved in EGF-induced immunosuppression. Dermatoendocrinol. 2017, 9, e1412018. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Johansen, C. Generation and culturing of primary human keratinocytes from adult skin. J. Vis. Exp. 2017, 130, 56863. [Google Scholar] [CrossRef]
- Yan, G.; Elbadawi, M.; Efferth, T. Multiple cell death modalities and their key features (Review). World Acad Sci J. 2020, 2, 39–48. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Wang, J.; Guan, T.; Xiang, Q.; Wang, M.; Guan, Z.; Li, G.; Zhu, Z.; Xie, Q.; Zhang, T.; et al. Role of methotrexate exposure in apoptosis and proliferation during early neurulation. J. Appl. Toxicol. 2014, 34, 862–869. [Google Scholar] [CrossRef] [PubMed]
- Walensky, L.D. Protein-protein interactions: A PUMA mechanism unfolds. Nat. Chem. Biol. 2013, 9, 141–143. [Google Scholar] [CrossRef] [Green Version]
- Elango, T.; Thirupathi, A.; Subramanian, S.; Ethiraj, P.; Dayalan, H.; Gnanaraj, P. Methotrexate treatment provokes apoptosis of proliferating keratinocyte in psoriasis patients. Clin. Exp. Med. 2017, 17, 371–381. [Google Scholar] [CrossRef] [PubMed]
- Burke, M.T.; Morais, C.; Oliver, K.A.; Lambie, D.L.J.; Gobe, G.C.; Carroll, R.P.; Staatz, C.E.; Sinnya, S.; Soyer, H.P.; Winterford, C.; et al. Expression of Bcl-XL and Mcl-1 in the nonmelanoma skin cancers of renal transplant recipients. Am. J. Clin. Pathol. 2015, 143, 514–526. [Google Scholar] [CrossRef] [Green Version]
- Schulze, A.; Lehmann, K.; Jefferies, H.B.; McMahon, M.; Downward, J. Analysis of the transcriptional program induced by raf in epithelial cells. Genes Dev. 2001, 15, 981–994. [Google Scholar] [CrossRef] [Green Version]
- Doody, J.F.; Wang, Y.; Patel, S.N.; Joynes, C.; Lee, S.P.; Gerlak, J.; Rolser, R.L.; Li, Y.; Steiner, P.; Bassi, R.; et al. Inhibitory activity of cetuximab on epidermal growth factor receptor mutations in non small cell lung cancers. Mol. Cancer Ther. 2007, 6, 2642–2651. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Resolution on Plans and Actions to Accelerate the Transition to Innovation without the Use of Animals in Research, Regulatory Testing and Education, European Parliament, 16 September 2021, 2021/2784(RSP). Available online: https://www.europarl.europa.eu/doceo/document/TA-9-2021-0387_EN.html (accessed on 14 November 2021).
- Preis, E.; Schulze, J.; Gutberlet, B.; Pinnapireddy, S.R.; Jedelská, J.; Bakowsky, U. The chorioallantoic membrane as a bio-barrier model for the evaluation of nanoscale drug delivery systems for tumour therapy. Adv. Drug Deliv. Rev. 2021, 174, 317–336. [Google Scholar] [CrossRef] [PubMed]
- Howard, S.C.; McCormick, J.; Pui, C.-H.; Buddington, R.K.; Harvey, R.D. Preventing and Managing toxicities of high-dose methotrexate. Oncologist 2016, 21, 1471–1482. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aickara, D.; Bashyam, A.M.; Pichardo, R.O.; Feldman, S.R. Topical methotrexate in dermatology: A review of the literature. J. Dermatol. Treat. 2020, 1–6. [Google Scholar] [CrossRef]
- Wohlrab, J.; Neubert, R.H.H.; Michael, J.; Naumann, S. Methotrexate for Topical Application in an Extemporaneous Preparation. J. der Dtsch. Dermatologischen Gesellschaft JDDG 2015, 13, 891–901. [Google Scholar] [CrossRef]
- Ho, C.; Sangha, R.; Beckett, L.; Tanaka, M.; Lau, D.H.; Eisen, D.B.; Burich, R.A.; Luciw, P.; Khan, I.; Mack, P.C.; et al. Escalating weekly doses of cetuximab and correlation with skin toxicity: A phase I study. Invest. New Drugs 2011, 29, 680–687. [Google Scholar] [CrossRef] [Green Version]
- Radu, G.; Luca, C.; Petrescu, L.; Bordejevic, D.A.; Tomescu, M.C.; Andor, M.; Cîtu, I.; Mavrea, A.; Buda, V.; Tomescu, C.; et al. The predictive value of endothelial inflammatory markers in the onset of schizophrenia. Neuropsychiatr. Dis. Treat. 2020, 16, 545–555. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Munteanu Ioan, A.; Manea, A.-M.; Jinca Marius, C.; Boia, M. Basic biochemical and hematological parameters in perinatal asphyxia and their correlation with hypoxic ischemic encephalopathy. Exp. Ther Med. 2021, 21, 259. [Google Scholar] [CrossRef]
- Merckx, G.; Tay, H.; Lo Monaco, M.; van Zandvoort, M.; De Spiegelaere, W.; Lambrichts, I.; Bronckaers, A. Chorioallantoic membrane assay as model for angiogenesis in tissue engineering: Focus on stem cells. Tissue Eng. Part B Rev. 2020, 26, 519–539. [Google Scholar] [CrossRef]
- Seow, L.-J.; Beh, H.K.; Sadikun, A.; Asmawi, M. Evaluation of anti-inflammatory effect of traditional medicinal plants, Gynura segetum. CELLMED 2014, 4, 4.1–4.4. [Google Scholar] [CrossRef] [Green Version]
- Jusoh, N.; Ko, J.; Jeon, N.L. Microfluidics-based skin irritation test using in vitro 3D angiogenesis platform. APL Bioeng. 2019, 3, 036101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- van Cruijsen, H.; Giaccone, G.; Hoekman, K. Epidermal growth factor receptor and angiogenesis: Opportunities for combined anticancer strategies. Int. J. Cancer 2005, 117, 883–888. [Google Scholar] [CrossRef] [PubMed]
- Debbasch, C.; Ebenhahn, C.; Dami, N.; Pericoi, M.; Van den Berghe, C.; Cottin, M.; Nohynek, G.J. Eye Irritation of low-irritant cosmetic formulations: Correlation of in vitro results with clinical data and product composition. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2005, 43, 155–165. [Google Scholar] [CrossRef] [PubMed]
- Kelly, F.L.; Weinberg, K.E.; Nagler, A.E.; Nixon, A.B.; Star, M.D.; Todd, J.L.; Brass, D.M.; Palmer, S.M. EGFR-Dependent IL8 production by airway epithelial cells after exposure to the food flavoring chemical 2,3-butanedione. Toxicol. Sci. 2019, 169, 534–542. [Google Scholar] [CrossRef] [PubMed]
- Perrotte, P.; Matsumoto, T.; Inoue, K.; Kuniyasu, H.; Eve, B.Y.; Hicklin, D.J.; Radinsky, R.; Dinney, C.P. Anti-epidermal growth factor receptor antibody C225 inhibits angiogenesis in human transitional cell carcinoma growing orthotopically in nude mice. Clin. cancer Res. Off. J. Am. Assoc. Cancer Res. 1999, 5, 257–265. [Google Scholar]
Primer | Forward | Reverse |
---|---|---|
18 S | 5′ GTAACCCGTTGAACCCCATT 3′ | 5′ CCA-TCC-AAT-CGG-TAGTAG-CG 3′ |
Bcl-xL | 5′GATCCCCATGGCAGCAGTAAAGCAAG 3′ | 5′CCCCATCCCGGAAGAGTTCATTCACT 3′ |
Bcl-2 | 5′ CGGGAGATGTCGCCCCTGGT 3′ | 5′ GCATGCTGGGGCCGTACAGT 3′ |
Bad | 5′ CCC-AGA-GTT-TGA-GCC-GAG-TG 30 | 5′ CCC-ATC-CCT-TCG-TCC-T 3′ |
Bax | 5′ GCCGGGTTGTCGCCCTTTT 3′ | 5′CCGCTCCCGGAGGAAGTCCA 3′ |
SDS 1% | H2O | Met 150 µg/mL | Cet 150 µg/mL | |
---|---|---|---|---|
IS | 19.41 | 0.14 | 7.83 | 1.75 |
tH | 19 s | 300 | 135 | 300 |
tL | 23 s | 297 | 196 | 285 |
tC | 27 s | 300 | 214 | 220 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kis, A.M.; Macasoi, I.; Paul, C.; Radulescu, M.; Buzatu, R.; Watz, C.G.; Cheveresan, A.; Berceanu, D.; Pinzaru, I.; Dinu, S.; et al. Methotrexate and Cetuximab—Biological Impact on Non-Tumorigenic Models: In Vitro and In Ovo Assessments. Medicina 2022, 58, 167. https://doi.org/10.3390/medicina58020167
Kis AM, Macasoi I, Paul C, Radulescu M, Buzatu R, Watz CG, Cheveresan A, Berceanu D, Pinzaru I, Dinu S, et al. Methotrexate and Cetuximab—Biological Impact on Non-Tumorigenic Models: In Vitro and In Ovo Assessments. Medicina. 2022; 58(2):167. https://doi.org/10.3390/medicina58020167
Chicago/Turabian StyleKis, Andreea M., Ioana Macasoi, Corina Paul, Matilda Radulescu, Roxana Buzatu, Claudia G. Watz, Adelina Cheveresan, Delia Berceanu, Iulia Pinzaru, Stefania Dinu, and et al. 2022. "Methotrexate and Cetuximab—Biological Impact on Non-Tumorigenic Models: In Vitro and In Ovo Assessments" Medicina 58, no. 2: 167. https://doi.org/10.3390/medicina58020167
APA StyleKis, A. M., Macasoi, I., Paul, C., Radulescu, M., Buzatu, R., Watz, C. G., Cheveresan, A., Berceanu, D., Pinzaru, I., Dinu, S., Manea, A., Poenaru, M., Borza, C., & Dehelean, C. A. (2022). Methotrexate and Cetuximab—Biological Impact on Non-Tumorigenic Models: In Vitro and In Ovo Assessments. Medicina, 58(2), 167. https://doi.org/10.3390/medicina58020167