Effects of Lactobacillus Plantarum and Lactobacillus Helveticus on Renal Insulin Signaling, Inflammatory Markers, and Glucose Transporters in High-Fructose-Fed Rats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Diets
2.2. Preparation of L. plantarum and L. helveticus
2.3. Measurement of Inflammatory Parameters in Kidney
2.4. Determination of Gene Expressions With Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.5. Determination of Protein Expressions by Western Blot
2.6. Measurement of Fructose Level in Plasma and Kidney
2.7. Statistical Analysis
3. Results
3.1. The Influences of Dietary Fructose and the Supplementation of L. plantarum and L.helveticus on the Expression of Renal Insulin Signaling Effectors and Glucose Transporters
3.2. The Influences of Dietary Fructose and the Supplementation of L. plantarum and L. helveticus on Inflammatory Factors
3.3. The Influences of Dietary Fructose and the Supplementation of L. plantarum and L. helveticus on Fructose Levels
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Gomes, A.C.; Bueno, A.A.; de Souza, R.G.; Mota, J.F. Gut microbiota, probiotics and diabetes. Nutr. J. 2014, 13, 60. [Google Scholar] [CrossRef]
- Toop, C.R.; Gentili, S. Fructose beverage consumption induces a metabolic syndrome phenotype in the rat: A systematic review and meta-analysis. Nutrients 2016, 8, 577. [Google Scholar] [CrossRef]
- Babacanoglu, C.; Yildirim, N.; Sadi, G.; Pektas, M.B.; Akar, F. Resveratrol prevents high fructose corn syrup-induced vascular insulin resistance and dysfunction in rats. Food Chem. Toxicol. 2013, 60, 160–167. [Google Scholar] [CrossRef]
- Sadi, G.; Ergin, V.; Yilmaz, G.; Pektas, M.B.; Yildirim, O.G.; Menevse, A.; Akar, F. High-fructose corn syrup-induced hepatic dysfunction in rats: Improving effect of resveratrol. Eur. J. Nutr. 2015, 54, 895–904. [Google Scholar] [CrossRef]
- Pektas, M.B.; Sadi, G.; Akar, F. Long-term dietary fructose causes gender different metabolic and vascular dysfunction in rats: Modulatory effects of resveratrol. Cell. Physiol. Biochem. 2015, 37, 1407–1420. [Google Scholar] [CrossRef]
- Pektas, M.B.; Koca, H.B.; Sadi, G.; Akar, F. Dietary fructose activates insulin signaling and inflammation in adipose tissue: Modulatory role of resveratrol. BioMed. Res. Int. 2016. [Google Scholar] [CrossRef] [PubMed]
- Pektas, M.B.; Yucel, G.; Koca, H.B.; Sadi, G.; Yildirim, O.G.; Ozturk, G.; Akar, F. Dietary fructose-induced hepatic injury in male and female rats: Influence of resveratrol. Drug. Res. (Stuttg.) 2017, 67, 103–110. [Google Scholar] [CrossRef]
- Yildirim, O.G.; Sumlu, E.; Aslan, E.; Koca, H.B.; Pektas, M.B.; Sadi, G.; Akar, F. High-fructose in drinking water initiates activation of inflammatory cytokines and testicular degeneration in rat. Toxicol. Mech. Methods 2019, 29, 224–232. [Google Scholar] [CrossRef]
- Hu, Q.H.; Zhang, X.; Pan, Y.; Li, Y.C.; Kong, L.D. Allopurinol, quercetin and rutin ameliorate renal NLRP3 inflammasome activation and lipid accumulation in fructose-fed rats. Biochem. Pharmacol. 2012, 84, 113–125. [Google Scholar] [CrossRef] [PubMed]
- Fan, C.Y.; Wang, M.X.; Ge, C.X.; Wang, X.; Li, J.M.; Kong, L.D. Betaine supplementation protects against high-fructose-induced renal injury in rats. J. Nutr. Biochem. 2014, 25, 353–362. [Google Scholar] [CrossRef] [PubMed]
- Prince, P.D.; Lanzi, C.R.; Toblli, J.E.; Elesgaray, R.; Oteiza, P.I.; Fraga, C.G.; Galleano, M. Dietary (–)-epicatechin mitigates oxidative stress, NO metabolism alterations, and inflammation in renal cortex from fructose-fed rats. Free Radic. Biol. Med. 2016, 90, 35–46. [Google Scholar] [CrossRef] [PubMed]
- Nakayama, T.; Kosugi, T.; Gersch, M.; Connor, T.; Sanchez-Lozada, L.G.; Lanaspa, M.A.; Roncal, C.; Perez-Pozo, S.E.; Johnson, R.J.; Nakagawa, T. Dietary fructose causes tubulointerstitial injury in the normal rat kidney. Am. J. Physiol Renal Physiol. 2010, 298, 712–720. [Google Scholar] [CrossRef]
- Aoyama, M.; Isshiki, K.; Kume, S.; Chin-Kanasaki, M.; Araki, H.; Araki, S.I.; Koya, D.; Haneda, M.; Kashiwagi, A.; Maegawa, H.; et al. Fructose induces tubulointerstitial injury in the kidney of mice. Biochem. Biophys. Res. Commun. 2012, 419, 244–249. [Google Scholar] [CrossRef] [PubMed]
- Ng, H.Y.; Lee, Y.T.; Kuo, W.H.; Huang, P.C.; Lee, W.C.; Lee, C.T. Alterations of renal epithelial glucose and uric acid transporters in fructose induced metabolic syndrome. Kidney Blood Press. Res. 2018, 43, 1822–1831. [Google Scholar] [CrossRef]
- Markowiak, P.; Slizewska, K. Effects of probiotics, prebiotics, and synbiotics on human health. Nutrients 2017, 9, 1021. [Google Scholar] [CrossRef] [PubMed]
- Hendijani, F.; Akbari, V. Probiotic supplementation for management of cardiovascular risk factors in adults with type II diabetes: A systematic review and meta-analysis. Clin. Nutr. 2018, 37, 532–541. [Google Scholar] [CrossRef] [PubMed]
- Honda, K.; Moto, M.; Uchida, N.; He, F.; Hashizume, N. Anti-diabetic effects of lactic acid bacteria in normal and type 2 diabetic mice. J. Clin. Biochem. Nutr. 2012, 51, 96–101. [Google Scholar] [CrossRef]
- Choi, I.D.; Kim, S.H.; Jeong, J.W.; Lee, D.E.; Huh, C.S.; Hong, S.S.; Sim, J.H.; Ahn, Y.T. Triglyceride-lowering effects of two probiotics, Lactobacillus plantarum KY1032 and Lactobacillus curvatus HY7601, in a rat model of high-fat diet-induced hypertriglyceridemia. J. Microbiol. Biotechnol. 2015, 26, 483–487. [Google Scholar] [CrossRef] [PubMed]
- Plaza-Díaz, J.; Ruiz-Ojeda, F.J.; Vilchez-Padial, L.M.; Gil, A. Evidence of the anti-inflammatory effects of probiotics and synbiotics in intestinal chronic diseases. Nutrients 2017, 9, 555. [Google Scholar] [CrossRef]
- Wang, Y.; Wu, Y.; Wang, Y.; Xu, H.; Mei, X.; Yu, D.; Wang, Y.; Li, W. Antioxidant properties of probiotic bacteria. Nutrients 2017, 9, 521. [Google Scholar] [CrossRef]
- Yadav, H.; Jain, S.; Sinha, P.R. Antidiabetic effect of probiotic dahi containing Lactobacillus acidophilus and Lactobacillus casei in high fructose fed rats. Nutrition 2007, 23, 62–68. [Google Scholar] [CrossRef] [PubMed]
- Park, D.Y.; Ahn, Y.T.; Huh, C.S.; Mcgregor, R.A.; Choi, M.S. Dual probiotic strains suppress high fructose-induced metabolic syndrome. World J. Gastroenterol. 2013, 19, 274. [Google Scholar] [CrossRef]
- Huang, H.-Y.; Korivi, M.; Tsai, C.-H.; Yang, J.-H.; Tsai, Y.-C. Supplementation of Lactobacillus plantarum K68 and fruit-vegetable ferment along with high fat-fructose diet attenuates metabolic syndrome in rats with insulin resistance. Evidence-Based Complement. Altern. Med. 2013. [Google Scholar] [CrossRef]
- Hsieh, F.C.; Lee, C.L.; Chai, C.Y.; Chen, W.T.; Lu, Y.C.; Wu, C.S. Oral administration of Lactobacillus reuteri GMNL-263 improves insulin resistance and ameliorates hepatic steatosis in high fructose-fed rats. Nutr. Metab. 2013, 10, 35. [Google Scholar] [CrossRef]
- Ritze, Y.; Bárdos, G.; Claus, A.; Ehrmann, V.; Bergheim, I.; Schwiertz, A.; Bischoff, S.C. Lactobacillus rhamnosus GG Protects against non-alcoholic fatty liver disease in mice. PLoS One 2014, 9, e80169. [Google Scholar] [CrossRef]
- Korkmaz, O.; Sadi, G.; Kocabas, A.; Yildirim, O.; Sumlu, E.; Koca, B.; Nalbantoglu, B.; Pektas, B.; Akar, F. Lactobacillus helveticus and Lactobacillus plantarum modulate renal antioxidant status in a rat model of fructose-induced metabolic syndrome. Arch. Biol. Sci. 2019. [Google Scholar] [CrossRef]
- Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein measurement with the folin phenol reagent. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar]
- Zubiría, M.G.; Gambaro, S.E.; Rey, M.A.; Carasi, P.; Serradell, M.L.Á.; Giovambattista, A. Deleterious metabolic effects of high fructose intake: The preventive effect of Lactobacillus kefiri administration. Nutrients 2017, 9, 470. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, M.; Satoh, N.; Suzuki, M.; Kume, H.; Homma, Y.; Seki, G.; Horita, S. Stimulatory effect of insulin on renal proximal tubule sodium transport is preserved in type 2 diabetes with nephropathy. Biochem. Biophys. Res. Commun. 2015, 461, 154–158. [Google Scholar] [CrossRef]
- Pandey, G.; Shankar, K.; Makhija, E.; Gaikwad, A.; Ecelbarger, C.; Mandhani, A.; Srivastava, A.; Tiwari, S. Reduced insulin receptor expression enhances proximal tubule gluconeogenesis. J. Cell. Biochem. 2017, 118, 276–285. [Google Scholar] [CrossRef]
- Pecoits-Filho, R.; Abensur, H.; Betônico, C.C.R.; MacHado, A.D.; Parente, E.B.; Queiroz, M.; Salles, J.E.N.; Titan, S.; Vencio, S. Interactions between kidney disease and diabetes: Dangerous liaisons. Diabetol. Metab. Syndr. 2016, 8, 50. [Google Scholar] [CrossRef] [PubMed]
- Nizar, J.M.; Shepard, B.D.; Vo, V.T.; Bhalla, V. Renal tubule insulin receptor modestly promotes elevated blood pressure and markedly stimulates glucose reabsorption. JCI Insight 2018, 3, 95107. [Google Scholar] [CrossRef] [PubMed]
- Barone, S.; Fussell, S.L.; Singh, A.K.; Lucas, F.; Xu, J.; Kim, C.; Wu, X.; Yu, Y.; Amial, H.; Seidler, U.; et al. Slc2a5 (Glut5) is essential for the absorption of fructose in the intestine and generation of fructose-induced hypertension. J. Biol. Chem. 2009, 284, 5056–5066. [Google Scholar] [CrossRef] [PubMed]
- Jang, C.; Hui, S.; Lu, W.; Cowan, A.J.; Morscher, R.J.; Lee, G.; Liu, W.; Tesz, G.J.; Birnbaum, M.J.; Rabinowitz, J.D. The small intestine converts dietary fructose into glucose and organic acids. Cell. Metab. 2018, 27, 351–361. [Google Scholar] [CrossRef] [PubMed]
- Goncalves, M.D.; Lu, C.; Tutnauer, J.; Hartman, T.E.; Hwang, S.K.; Murphy, C.J.; Pauli, C.; Morris, R.; Taylor, S.; Bosch, K.; et al. High-Fructose corn syrup enhances intestinal tumor growth in mice. Science 2019, 363, 1345–1349. [Google Scholar] [CrossRef]
- Lee, E.; Jung, S.R.; Lee, S.Y.; Lee, N.K.; Paik, H.D.; Lim, S.I. Lactobacillus plantarum strain ln4 attenuates diet-induced obesity, insulin resistance, and changes in hepatic mrna levels associated with glucose and lipid metabolism. Nutrients 2018, 10, 643. [Google Scholar] [CrossRef] [PubMed]
- Uchinaka, A.; Azuma, N.; Mizumoto, H.; Nakano, S.; Minamiya, M.; Yoneda, M.; Aoyama, K.; Komatsu, Y.; Yamada, Y.; Murohara, T.; et al. Anti-inflammatory effects of heat-killed Lactobacillus plantarum l-137 on cardiac and adipose tissue in rats with metabolic syndrome. Sci. Rep. 2018, 8, 8156. [Google Scholar] [CrossRef]
- Liu, W.C.; Yang, M.C.; Wu, Y.Y.; Chen, P.H.; Hsu, C.M.; Chen, L.W. Lactobacillus plantarum reverse diabetes-induced Fmo3 and ICAM expression in mice through enteric dysbiosis-related c-Jun NH2-terminal kinase pathways. PLoS ONE 2018, 13, e0196511. [Google Scholar] [CrossRef]
Gene | Forward Primer Sequence (5′→3′) | Reverse Primer Sequence (3′→5′) |
---|---|---|
ir | GTGCTGCTCATGTCCTTAGA | AATGGTCTGTGCTCTTCGTG |
irs-1 | GCCAATCTTCATCCAGTTGC | CATCGTGAAGAAGGCATAGG |
irs-2 | CTACCCACTGAGCCCAAGAG | CCAGGGATGAAGCAGGACTA |
akt | GAAGAAGAGCTCGCCTCCAT | GAAGGAGAAGGCCACAGGTC |
enos | TGCACCCTTCCGGGGATTCT | GGATCCCTGGAAAAGGCGGT |
nf-κb | GGGTCAGAGGCCAATAGAGA | CCTAGCTTTCTCTGAACTGCAAA |
il-6 | CCAGTTGCCTTCTTGGGACT | GCCATTGCACAACTCTTTTCTCA |
gapdh | TCCTTGGAGGCCATGTGGGCCAT | TGATGACATCAAGAAGGTGGTGAAG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Korkmaz, O.A.; Sumlu, E.; Koca, H.B.; Pektas, M.B.; Kocabas, A.; Sadi, G.; Akar, F. Effects of Lactobacillus Plantarum and Lactobacillus Helveticus on Renal Insulin Signaling, Inflammatory Markers, and Glucose Transporters in High-Fructose-Fed Rats. Medicina 2019, 55, 207. https://doi.org/10.3390/medicina55050207
Korkmaz OA, Sumlu E, Koca HB, Pektas MB, Kocabas A, Sadi G, Akar F. Effects of Lactobacillus Plantarum and Lactobacillus Helveticus on Renal Insulin Signaling, Inflammatory Markers, and Glucose Transporters in High-Fructose-Fed Rats. Medicina. 2019; 55(5):207. https://doi.org/10.3390/medicina55050207
Chicago/Turabian StyleKorkmaz, Omer A., Esra Sumlu, H. Bugra Koca, M. Bilgehan Pektas, Aytac Kocabas, Gokhan Sadi, and Fatma Akar. 2019. "Effects of Lactobacillus Plantarum and Lactobacillus Helveticus on Renal Insulin Signaling, Inflammatory Markers, and Glucose Transporters in High-Fructose-Fed Rats" Medicina 55, no. 5: 207. https://doi.org/10.3390/medicina55050207