Skip to Content
MDPIMDPI
CIMBCurrent Issues in Molecular Biology
PDF
  • Article
  • Open Access

20 February 2026

IL-37 Ameliorates Chronic Endometritis by Attenuating Epithelial—Mesenchymal Transition and Promoting M2 Macrophage Polarization

,
,
,
,
and
School of Medical Technology and Translational Medicine, Hunan Normal University, Tongzipo Road, Changsha 410013, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Curr. Issues Mol. Biol.2026, 48(2), 227;https://doi.org/10.3390/cimb48020227
This article belongs to the Special Issue Molecular Mechanisms and Innovative Therapeutic Approaches in Inflammatory Diseases, Pioneering Precision Medicine Solutions, 2nd Edition
Version Notes
Order Reprints

Abstract

Interleukin-37 (IL-37) is an anti-inflammatory cytokine with an undefined role in chronic endometritis (CE). This study aims to explore its therapeutic mechanism in CE, focusing on epithelial-mesenchymal transition (EMT) and macrophage polarization. A CE model was induced in Sprague-Dawley rats using lipopolysaccharide (LPS), followed by intervention with TAT-fused recombinant IL-37. Histological damage and fibrosis were evaluated through H&E and Masson staining. Immunofluorescence staining was performed to assess the expression of IL-37 and EMT markers (E-cadherin and vimentin) and macrophage phenotypes (M1: CD86+; M2: CD206+). In vitro, transwell, qPCR, Western blot, and flow cytometry analyses were performed to determine the effects of IL-37 on EMT and macrophage polarization. The activity of the STAT6 and Smad3 pathways was evaluated using Western blotting, dual-luciferase assays, and immunofluorescence staining. The results revealed that IL-37 accumulated in the injured uterus, alleviating inflammation, tissue damage, and collagen deposition. IL-37 reduced epithelial migration and reversed abnormal EMT by upregulating E-cadherin expression and downregulating vimentin expression. It also suppressed M1 macrophage infiltration and promoted M2 polarization. Mechanistically, IL-37 coactivated the STAT6 and Smad3 pathways, thereby increasing their phosphorylation and nuclear translocation and elevating ARG1 expression. In conclusion, IL-37 mitigates CE by suppressing EMT and promoting M2 macrophage polarization via coordinated STAT6/Smad3 activation, highlighting its therapeutic potential for CE.

1. Introduction

Chronic endometritis (CE), a persistent inflammatory condition of the endometrium characterized by stromal plasma cell infiltration, edema, and aberrant glandular architecture, significantly contributes to infertility, recurrent implantation failure, and miscarriage [1,2]. Endometrial epithelial and stromal cells recognize pathogen-associated molecular patterns (PAMPs) or damage-associated molecular patterns (DAMPs) and activate the Toll-like receptor signaling pathway, thereby initiating NF-κB and MAPK cascade reactions. This activation promotes the sustained release of inflammatory cytokines and chemokines, perpetuating immune cell infiltration [3,4]. The resulting chronic inflammatory milieu disrupts glandular function and endometrial receptivity, leading to progressive tissue fibrosis characterized by excessive collagen deposition, endometrial sclerosis, and loss of plasticity [5,6]. Current management strategies, predominantly antibiotic-based strategies, face significant challenges, including microbial resistance, disease recurrence, and the inability to reverse established fibrosis, thereby underscoring the urgent need for novel therapeutic strategies that simultaneously target inflammation and fibrotic remodeling [7,8,9].
Interleukin-37 (IL-37) is a multifunctional cytokine with potent immunosuppressive activity within the IL-1 family. Intracellular IL-37 binds to Smad3 and is translocated to the nucleus, leading to the upregulation of PTPN expression. This upregulation inhibits the activation of key proinflammatory signaling pathways, including ERK, p38, JNK, PI3K, and NF-κB [10,11,12,13,14]. Extracellularly, IL-37 binds to the IL-18Rα/IL-1R8 complex, which activates inhibitory signaling axes—such as STAT3/6 and PTEN/FOXO/AMPK—and in turn blocks fibrosis-related pathways, including MAPK, NF-κB, and mTOR pathways [10,15,16,17,18]. Existing studies have confirmed the definitive anti-inflammatory and antifibrotic potential of IL-37 across multiple organ systems. In pulmonary fibrosis models, IL-37 significantly alleviates bleomycin-induced pulmonary inflammatory infiltration and collagen deposition [19]. In models of diabetic nephropathy, IL-37 mitigates fatty acid oxidation dysfunction and renal fibrosis by upregulating CPT1A [20]. Furthermore, in diabetic cardiomyopathy, IL-37 improves mitochondrial damage and inhibits myocardial fibrosis by maintaining the function of the SIRT1–AMPK–PGC1α axis [21].
IL-37 not only alleviates inflammation and reverses fibrosis but also regulates macrophage polarization. Studies have shown that in diseases such as hepatitis, liver fibrosis, and periodontitis, IL-37 inhibits M1 polarization and promotes M2 polarization, thereby helping to modulate the immune balance [16,22,23,24]. In addition, in atherosclerosis, IL-37 suppresses macrophage ferroptosis through the NRF2 pathway [25]. Finally, in tumor immunity, it enhances macrophage phagocytic capacity via the IL-18Rα/SIGIRR-STAT3 axis [26]. Collectively, these effects provide a critical foundation for the role of IL-37 in mitigating tissue damage.
The evidence presented indicates that IL-37 plays a pivotal role in regulating immunity and inhibiting fibrosis; however, its specific functions and therapeutic potential in CE remain unclear. In this study, we demonstrated that IL-37 exerts a protective effect on endometrial repair by inhibiting EMT and reprogramming macrophages toward M2 polarization, potentially coactivating the STAT6 and Smad3 signaling pathways. These findings may provide novel experimental evidence and strategies for the treatment of CE.

2. Materials and Methods

2.1. Expression and Purification of Recombinant IL-37 Protein

The pET22b-TAT-IL37d plasmid was kindly provided by Shandong University, and was used for expressing the fusion protein of the TAT transmembrane peptide and human IL-37d (TAT-IL-37d), thereby enabling efficient intracellular delivery of exogenous IL-37d [27]. For protein expression, the plasmid was introduced into E. coli BL21(DE3), a T7 expression host compatible with the pET22b vector. Cultures were grown from glycerol stocks in LB medium supplemented with ampicillin. After the log phase was reached, protein expression was induced with IPTG at 16 °C. Cells were lysed by ultrasonication, and the supernatant was purified through Ni-NTA affinity chromatography. After dialysis, endotoxin removal, and testing, the samples were confirmed to meet the required standards. The protein concentration was measured using a BCA assay, and protein purity was assessed through SDS-PAGE. Finally, the protein was filter-sterilized, aliquoted, and stored at −80 °C. All protein batches used for cell and animal experiments were quantitatively tested using the Limulus Amebocyte Lysate (LAL) method, and the concentration used was significantly lower than the permissible limit for routine cell experiments (typically 0.1 EU/mL).

2.2. Cell Culture

NRK-52e, HEK-293T, and RAW 264.7 cells were all purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). All cells were cultured in high-glucose DMEM (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin (Gibco) and maintained at 37 °C in an incubator under 5% CO2.

2.3. Establishment and Management of Animal Models

All animal protocols were approved by the Biomedical Research Ethics Committee of Hunan Normal University (permit number: 2025674; approval date: 1 September 2025). This study strictly adhered to the Animal Research ARRIVE reporting guidelines.
Eight-week-old female Sprague-Dawley rats (n = 35) were housed in an SPF-grade facility and randomly divided into four groups: control (n = 8), LPS (n = 9), 1 μg of IL-37 (n = 9), and 2 μg of IL-37 (n = 9). The sample size was determined based on previous similar studies and our preliminary experiments to ensure adequate statistical power. The two IL-37 doses were selected based on the established effective range reported in rat models of inflammatory diseases [28,29,30].
CE was induced by uterine curettage combined with LPS suture embedding. The control group underwent laparotomy and exposure of the uterine cornua only, without curettage or embedding. After the suture was removed, the treatment groups received intraperitoneal injections of IL-37 every 3 days. The control and LPS groups were administered the same volume of saline. The rats were euthanized at the third estrous cycle after model establishment. Uterine tissues were then collected for examination.

2.4. Hematoxylin and Eosin (HE) Staining

The paraffin sections were deparaffinized, hydrated, stained with hematoxylin for 5 to 8 min and rinsed in running water. They were then counterstained with eosin for 1 to 3 min, dehydrated in a graded ethanol series, cleared in xylene, and mounted with neutral balsam. The sections were then observed under a microscope, and the images were analyzed using ImageJ (version 1.54f) software.

2.5. Masson Staining

Following dewaxing and hydration, the paraffin sections were stained with Weigert’s iron hematoxylin for 5–10 min, differentiated with acid ethanol, and subsequently blued. They were then immersed in Lichun red and acid eosin for 5–10 min and treated with phosphomolybdic acid for 5 min. Without washing in water, the sections were counterstained with aniline blue for 5 min, rinsed with a weak acid solution, dehydrated in a graded ethanol series, cleared with xylene, and mounted with neutral gum. The samples were examined microscopically, photographed, and analyzed using ImageJ software.

2.6. Immunofluorescence Staining

After being embedded in OCT, frozen tissue sections were prepared, fixed, permeabilized, and blocked. The sections were then incubated overnight at 4 °C with primary antibodies against the following proteins: IL-37 (Abcam, Cambridge, UK), E-cadherin (Cell Signaling Technology [CST], Danvers, MA, USA), vimentin (ABclonal, Woburn, MA, USA), CD86 (Proteintech, Rosemont, IL, USA), CD206 (Proteintech), Smad3 (CST), and STAT6 (Proteintech). The following day, the sections were incubated with fluorescent secondary antibodies at room temperature in the dark for 1 h, and then stained with DAPI. The sections were imaged through microscopy and analyzed using ImageJ.

2.7. Transwell Assay

Transwell chambers were placed in a 24-well plate. A cell suspension in serum-free medium was added to the upper chamber, and complete medium supplemented with 10% fetal bovine serum was added to the lower chamber as a chemotactic agent. The plates were incubated at 37 °C under 5% CO2 for 24 h. After incubation, the medium was removed from the upper chamber, and nonmigrated cells were wiped from the upper surface with a cotton swab. The migrated cells on the lower surface were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and analyzed using ImageJ.

2.8. Western Blot

Total protein was extracted using RIPA lysis buffer. Equal amounts of protein were separated by 10% SDS-PAGE and transferred to PVDF membranes. After being blocked with 5% nonfat milk, the membranes were incubated overnight at 4 °C with primary antibodies against E-cadherin (CST), vimentin (ABclonal), STAT6 (Proteintech), p-STAT6 (CST), Smad3 (CST), p-Smad3 (CST), Arg1 (CST), and β-actin (CST). The next day, the membranes were incubated with the secondary antibody for 1 h at room temperature. Chemiluminescence was detected, and images were captured using a Tanon system, followed by grayscale analysis using ImageJ.

2.9. Real-Time Quantitative PCR (RT-qPCR)

Total RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA). The concentration and purity were measured, and cDNA was subsequently synthesized with a reverse transcription kit (Takara Bio, Kusatsu, Japan). qPCR was performed with a TAKARA kit on a Bio-Rad instrument using the following conditions: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The primer sequences used for qPCR are listed in Appendix A Table A1. β-actin or GAPDH served as internal controls, and relative gene expression was determined by the 2−ΔΔCt method.

2.10. Flow Cytometry

RAW 264.7 cells from each group were collected and incubated with Fc blocking reagent (BD Biosciences, Franklin Lakes, NJ, USA) on ice for 15 min to prevent nonspecific binding. Afterward, the cells were fixed, permeabilized and incubated with an APC-conjugated anti-CD206 antibody (BioLegend, San Diego, CA, USA) in the dark at room temperature for 30 min. The cells were subsequently washed twice with precooled PBS and detected using a BD flow cytometer.

2.11. Dual-Luciferase Reporter Gene Assay

HEK-293T cells were cotransfected with the pLenti-Smad-minP-Luc reporter plasmid and the pRL-TK internal reference plasmid using Lipo8000TM transfection reagent (Beyotime, Shanghai, China). After 24 h, the cells were treated with 10, 100, or 1000 ng/mL Il-37 for an additional 24 h. The cells were then lysed, and luciferase activity was measured using a dual-luciferase reporter assay kit (Beyotime). Smad pathway transcriptional activity is expressed as the ratio of firefly luciferase activity to Renilla luciferase activity.

2.12. Statistical Analysis

All the data were derived from at least three independent experiments and are expressed as the mean ± standard deviation. Statistical analysis was performed using GraphPad Prism 8.0 software. Unpaired t tests were employed for comparisons between two groups, one-way ANOVA for multigroup comparisons, and Tukey’s post hoc test for pairwise comparisons between groups. A p value < 0.05 was considered to indicate statistical significance.

3. Results

3.1. Exogenous IL-37 Protein Ameliorates LPS-Induced Rat Chronic Endometritis

To evaluate the therapeutic potential of IL-37 for CE, we successfully expressed and purified the recombinant IL-37 protein, which was injected intraperitoneally into the rats to treat CE. Immunofluorescence analysis of uterine tissues revealed that, compared with the control group, the LPS-induced model group showed no significant change in IL-37 expression. By contrast, the IL-37 (1 μg and 2 μg) groups exhibited a marked increase in IL-37-specific fluorescence signals, which were primarily localized at the cell periphery (Figure 1A,B). These findings indicate that the exogenous IL-37 protein can be effectively taken up by rat uterine cells.
Figure 1. Enrichment of IL-37 in the uterine tissue of a CE model and its role in improving pathological damage and fibrosis. (A) Representative images of uterine tissues from each group. (Upper row) Immunofluorescence staining: shows the localization of IL-37 (red) in the tissue, with cell nuclei counterstained with DAPI (blue). (Middle row) Gross morphology: displays the accumulation of fluid in the uterine cavity and tissue edema; (Lower row) Histological staining: H&E staining shows inflammation and structure, while Masson’s trichrome staining highlights collagen fibers (blue). Scale bars: H&E and Masson staining, 600 μm; Immunofluorescence, 80 μm. (B–E) Quantitative statistical analysis. (B) The number of IL-37 positive cells observed in each high-power field (400X). (C) Percentage of endometrial area relative to the total cross-sectional area of the uterus. (D) Total number of endometrial glands counted in each section. (E) Percentage of Masson staining positive area (collagen fibers) relative to the total tissue area. All data are presented as mean ± standard deviation; * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Gross morphological observation revealed that, compared with the control group, the LPS group exhibited significant pathological changes in the uterus, including intrauterine fluid accumulation, tissue edema, and thinning of the uterine wall with increased transparency. However, following intervention with IL-37 (1 μg and 2 μg), these pathological manifestations were markedly alleviated, as evidenced by reduced intrauterine fluid and the restoration of normal uterine morphology (Figure 1A).
H&E staining results (Figure 1A,C,D) revealed that the LPS group exhibited a damaged endometrial structure, along with extensive inflammatory cell infiltration and stromal edema. IL-37 treatment significantly attenuated inflammatory infiltration and edema, promoting the repair of the endometrial structure, which was reflected by the restoration of the endometrial area ratio and glandular number. Furthermore, Masson staining (Figure 1A,E) revealed that the LPS group exhibited significantly increased collagen fiber deposition, whereas the IL-37 intervention effectively reduced the area of collagen deposition and reversed the fibrotic process.
Therefore, we concluded that exogenous IL-37 can be effectively delivered to injured uteri and can have therapeutic effects, including anti-inflammatory effects, tissue repair promotion, and antifibrotic activity.

3.2. IL-37 Inhibits the EMT Process In Vitro and In Vivo

On the basis of previous findings that IL-37 can reverse endometrial fibrosis, we hypothesized that its effects may be associated with the inhibition of the EMT process. To evaluate the occurrence of EMT and the effects of IL-37 treatment at the tissue level, we conducted immunofluorescence staining of rat uterine tissues. The results (Figure 2) indicated that, compared with the control group, the LPS group exhibited significantly downregulated expression of the epithelial marker E-cadherin and significantly upregulated expression of the mesenchymal marker vimentin in uterine tissues. Following IL-37 treatment, the fluorescence intensity of E-cadherin was effectively restored, whereas the expression of vimentin was significantly inhibited.
Figure 2. Effects of IL-37 on the expression of EMT markers in the uterine tissues of a CE model in rats. (A) (Left) Representative immunofluorescence staining images of the epithelial marker E-cadherin (red) in the uterine tissues of each group; (Right) Quantitative analysis of the average fluorescence intensity of E-cadherin. (B) (Left) Representative immunofluorescence staining images of the mesenchymal marker Vimentin (green) in the uterine tissues of each group; (Right) Quantitative analysis of the average fluorescence intensity of Vimentin. Scale bar: 500 μm; magnification, ×40. Nuclei were counterstained with DAPI (blue). All data are presented as mean ± standard deviation; ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Moreover, we conducted in vitro validation using LPS-stimulated rat renal tubular epithelial cells. Transwell migration assays demonstrated that IL-37 treatment effectively inhibited the LPS-induced increase in cell migration capacity (Figure 3A,B). Western blot and RT-qPCR results confirmed that IL-37 treatment reversed the dysregulated expression of key EMT markers induced by LPS. Specifically, IL-37 restored the expression of the epithelial marker E-cadherin and decreased the expression of several mesenchymal markers, including vimentin and N-cadherin (Figure 3C,D). These findings provide a critical mechanistic basis for the role of IL-37 in ameliorating endometrial fibrosis.
Figure 3. IL-37 inhibits LPS-induced EMT in renal tubular epithelial cells in vitro (NRK-52e cell line). (A) Representative images of cell migration ability assessed by transwell assays (stained with crystal violet). (B) Quantitative statistics of the number of migrating cells in the transwell experiments. (C) Relative mRNA expression levels of EMT-related markers (E-cadherin, N-cadherin, Vimentin, β-catenin) detected by RT-qPCR. (D) Expression bands of EMT-related proteins (E-cadherin, Vimentin) detected by Western blot; (E) Quantitative analysis of the grayscale values of the corresponding protein bands. Scale bar: 100 μm. All data are presented as mean ± standard deviation; * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

3.3. IL-37 Inhibits M1 and Promotes M2 Polarization

To elucidate the regulatory role of IL-37 in the immune microenvironment of CE, we systematically evaluated its effects on macrophage polarization. First, immunofluorescence staining of uterine tissue revealed that LPS induced a proinflammatory environment characterized by the expansion of CD86+ M1 macrophages and the contraction of CD206+ M2 macrophages. The administered IL-37 dose-dependently restored this ratio, as it suppressed CD86+ fluorescence while amplifying CD206+ signals, with maximal restoration achieved at 2 µg of IL-37 (Figure 4).
Figure 4. IL-37 regulates the polarization of macrophages in the uterine tissue of a CE model. (A) (Left) Representative immunofluorescence staining images of M1 macrophage marker CD86 (green) in the uterine tissues of each group; (Right) Quantitative analysis of the average fluorescence intensity of CD86. (B) (Left) Representative immunofluorescence staining images of M2 macrophage marker CD206 (red) in the uterine tissues of each group; (Right) Quantitative analysis of the average fluorescence intensity of CD206. Scale bar: 80 μm; magnification, ×400. Nuclei were counterstained with DAPI (blue). All data are presented as mean ± standard deviation; * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Next, we assessed the effect of IL-37 on macrophage polarization in RAW264.7 cells. In LPS-driven M1 cultures, IL-37 decreased the transcription of IL-6, iNOS, and IL-1β and inhibited the expression of the master M1 transcription factor STAT3 (Figure 5A). Conversely, under IL-4-driven M2 conditions, IL-37 combined with IL-4 to increase the expression of TGF-β, CD206, and Arg1 while increasing the expression of STAT6 mRNA (Figure 5B). Flow cytometric quantification confirmed that the combination of IL-37 and IL-4 synergistically increased the CD206+ subpopulation in a concentration-dependent manner (Figure 5C). Collectively, these data establish that IL-37 suppresses the proinflammatory M1 phenotype while promoting the reparative M2 phenotype, thereby reprogramming the endometrial immune niche toward a reparative phenotype in CE.
Figure 5. IL-37 regulates macrophage polarization and related signaling pathways in vitro (RAW 264.7 cells). (A) In the M1 polarization model, the relative mRNA expression levels of M1 macrophage-related marker genes (IL-6, iNOS, IL-1β) and signaling molecules (STAT3) were assessed by RT-qPCR. (B) In the M2 polarization model, the relative mRNA expression levels of M2 macrophage-related marker genes (TGF-β, CD206, Arg1) and signaling molecules (STAT6) were also evaluated by RT-qPCR. (C) (Left) Representative histogram of CD206 protein expression in macrophages detected by flow cytometry; (Right) Quantitative statistical graph of the percentage of CD206-positive cells. All data are presented as mean ± standard deviation; * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

3.4. IL-37 Promotes M2 Macrophage Polarization via Coordinated STAT6/Smad3 Activation

To determine whether IL-37 reprograms macrophage function by modulating the STAT6 and Smad3 signaling pathways, we conducted a systematic investigation of its effects on an IL-4-induced M2 polarization model. Western blot analysis revealed that treatment with IL-4 alone elevated the levels of phosphorylated STAT6 (p-STAT6) and IL-37 at concentrations ranging from 10 to 1000 ng/mL, dose-dependently increased the level of p-STAT6 and independently triggered robust phosphorylation of Smad3 (p-Smad3). Consequently, the ratios of p-STAT6 to total STAT6 and p-Smad3 to total Smad3 significantly increased, indicating synergistic potentiation of STAT6 and de novo activation of Smad3 (Figure 6A,B).
Figure 6. IL-37 regulates the activation, transcriptional activity, and nuclear translocation of the STAT6/Smad3 signaling pathway in macrophages. (A) Western blot analysis was performed to detect the protein expression bands of STAT6, phosphorylated STAT6 (p-STAT6), Smad3, phosphorylated Smad3 (p-Smad3), and arginase 1 (ARG1) in macrophages from different groups (RAW 264.7 cells). (B) A quantitative analysis graph of the grayscale values corresponding to the protein bands. (C) Dual luciferase reporter gene assays were conducted to investigate the effect of IL-37 on the transcriptional activity of the Smad pathway (HEK-293T cells). Data are expressed as the ratio of luciferase activity (firefly luciferase/Renilla luciferase). (D) (Left) Representative immunofluorescence images showing subcellular localization of STAT6 (green) and Smad3 (red) in RAW 264.7 cells after IL-37 treatment at 0 min, 30 min, and 1 h, with nuclei stained with DAPI (blue). Scale bar: 25 μm. (Right) Quantitative statistical results of the nuclear-to-cytoplasmic ratio of STAT6 and Smad3 at each time point. All data are expressed as mean ± standard deviation; * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Moreover, the results obtained with a Smad-responsive luciferase reporter (pLenti-Smad-minP-Luc) demonstrated that IL-37 increased luciferase activity in a concentration-dependent manner, indicating the amplification of Smad-mediated transcription (Figure 6C). To further visualize the changes in cell dynamics during this process, we performed immunofluorescence staining analysis and quantitatively evaluated the nuclear-translocation of STAT6 and Smad3, as shown in Figure 6D. At 0 min of IL-37 treatment, STAT6 and Smad3 signals were predominantly localized in the cytoplasm. After 30 min of treatment, the nuclear-to-cytoplasmic ratio of both proteins was significantly increased compared to 0 min. At 1 h of treatment, the nuclear-to-cytoplasmic ratio further increased, showing a significant difference compared to 30 min. This time-dependent nuclear accumulation confirms IL-37’s effective induction of nuclear translocation for these two key transcription factors.
In summary, IL-37 functions as a dual coactivator: it amplifies IL-4-triggered STAT6 signaling while independently activating the Smad3 cascade, thereby enforcing alternative M2 macrophage activation.

4. Discussion

The endometrium is a cyclically reprogrammed mucosal surface whose capacity for scarless restoration underpins fertility. When this process is disrupted, CE and intrauterine adhesion (IUA) occur, resulting in the transformation of a transient inflammatory insult into a self-amplifying fibrotic circuit [31,32,33]. This study systematically elucidates, for the first time, the dual protective role of IL-37 in promoting endometrial injury repair: it directly inhibits EMT to preserve epithelial integrity and reprograms macrophage polarization to enhance the repair microenvironment through coordinated activation of the STAT6/Smad3 axis. These two mechanistic pathways collectively provide robust experimental evidence supporting the role of IL-37 as a potential novel therapeutic target for CE.
IL-37, a member of the interleukin-1 family, exhibits extensive anti-inflammatory and immunoregulatory properties [34]. These characteristics confer protective effects in various disease models, including cardiovascular diseases, autoimmune disorders, and tumors [35,36,37,38]. In recent years, the role of IL-37 in diseases of the female reproductive system has garnered increasing attention. For instance, in endometriosis (EMS), recombinant human IL-37 can inhibit the growth of ectopic lesions by suppressing STAT3 phosphorylation in dendritic cells and modulating the Th1/Th2 balance [39]. In endometrial cancer, IL-37b targets the Rac1/NF-κB signaling pathway to reduce the expression of matrix metalloproteinase 2 (MMP2), effectively suppressing cancer cell migration and invasion [40]. Furthermore, endometrial regenerative cells that secrete IL-37 can significantly downregulate the expression of proinflammatory factors such as TNF-α, IL-1β, and IL-6 and upregulate the expression of IL-10, thereby exerting therapeutic effects in chronic transplant vasculopathy [41]. Our study is the first to demonstrate that exogenous IL-37 alleviates endometritis by inhibiting EMT and promoting M2 polarization. These findings collectively reveal the crucial regulatory role of IL-37 in both inflammatory and tumor-related pathological processes within the female reproductive system.
EMT is a pivotal event in the fibrotic process of various organs and is characterized by the downregulation of the expression of epithelial markers, such as E-cadherin, and the upregulation of the expression of stromal markers, including N-cadherin and vimentin [42]. Maintaining epithelial cell homeostasis is crucial for preventing fibrosis [43], and inhibiting EMT serves as a common mechanism underlying the protective effects of IL-37 in several fibrotic diseases. In hepatic fibrosis, the intracellular form of IL-37 directly interacts with Smad3, thereby suppressing TGF-β signaling and hepatic stellate cell activation [16]. In asthma models, IL-37 alleviates airway EMT by modulating the ERK1/2 and STAT3 pathways [44]. Furthermore, in diabetic cardiomyopathy, IL-37 exerts antifibrotic effects by inhibiting the JAK2-STAT3 axis [45]. In CE, microbial-associated molecular patterns, such as LPS, drive the release of proinflammatory factors, including TNF-α and IL-6, as well as profibrotic factors, such as TGF-β, through the activation of the TLR4/NF-κB signaling axis [46,47,48]. IL-37 has been shown to effectively suppresses the activation of the NF-κB pathway [34], which may inhibit this upstream inflammatory signaling and downregulate the regulatory network that drives EMT. Our study confirms that IL-37 can reverse EMT in CE. In vivo, IL-37 restored the epithelial phenotype of the damaged endometrium. In vitro, it inhibited the LPS-induced migration of renal tubular epithelial cells while simultaneously reversing the abnormal expression of EMT markers. These findings indicate that IL-37 can prevent the initiation of fibrosis at its source by directly stabilizing epithelial cells, laying the foundation for tissue regeneration.
As pivotal regulatory cells within the immune microenvironment of CE, macrophages directly influence the processes of endometrial tissue damage and repair through their polarization states [49,50,51,52]. Studies have demonstrated that modulating macrophage polarization can serve as an effective therapeutic strategy for CE. For instance, glycyrrhizic acid can alleviate endometrial hyperplasia and inflammation in CE mice by inhibiting HMGB1-mediated macrophage pyroptosis [51]. Adipose-derived stem cell exosomes suppress M1 polarization by regulating the SIRT2/NLRP3 axis, thereby mitigating endometritis [53]. Additionally, recombinant humanized type III collagen (rhCol III) has been shown both in vitro and in rat CE models to promote macrophage polarization toward the M2 phenotype by inhibiting the NF-κB/YAP pathway, consequently improving inflammation and facilitating the restoration of the immune microenvironment [6].
Although IL-37 has been established as a crucial immunoregulatory factor in various inflammatory models, its specific molecular mechanism in regulating macrophage polarization in chronic inflammation remains unclear. This study is the first to demonstrate that IL-37 can induce ‘functional reprogramming’ of macrophages in chronic inflammation models. The results indicate that under M1 polarization conditions, IL-37 significantly suppresses the expression of proinflammatory genes such as IL-6, iNOS, and IL-1β. Conversely, under M2 polarization conditions, IL-37 not only further upregulates the expression of classic M2 markers, including TGF-β, Arg1, and CD206, but also increases the proportion of CD206+ M2 cells. In-depth mechanistic studies revealed that IL-37 treatment significantly increased the phosphorylation levels of STAT6 and Smad3, thereby activating the downstream Smad signaling pathway to promote the expression of the repair-related protein ARG1.
Notably, classical M2 macrophages typically activate the Smad pathway through TGF-β secretion, promoting EMT and fibrosis [54,55]. However, this study found that IL-37 significantly upregulated p-Smad3 levels and promoted its nuclear translocation, while simultaneously inhibiting EMT and fibrosis. This may initially seem contradictory; however, studies on tumor cells indicate that, unlike the TGF-β/Smad3 signaling pathway, IL-37 can directly bind to Smad3 intracellularly. This interaction inhibits the formation and nuclear translocation of the Smad2/3/4 complex, thereby attenuating the transcriptional activity of the canonical Smad pathway [56]. Additionally, the functional output of Smad3 is phospho-site-dependent. C-terminal phosphorylation (pSmad3C) primarily mediates growth inhibition and differentiation regulation, while linker region phosphorylation (pSmad3L) strongly drives extracellular matrix deposition and fibrotic transcriptional programs [16]. IL-37 achieves “functional remodeling” of the Smad3 signalling by specifically inhibiting the pSmad3L/c-Myc signalling axis while preserving or redirecting the pSmad3C pathway. This mechanism has been preliminarily validated in liver fibrosis models [24]. Therefore, we propose that IL-37 does not simply activate Smad3 but may instead reshape its phosphor–isomer balance and transcriptional output, enabling it to synergise with STAT6 to guide anti-inflammatory repair programs represented by ARG1, rather than the classical fibrotic gene programs. However, the exact regulatory mechanisms require further investigation.
This study presents several limitations. First, while the NRK-52e renal tubular epithelial cell line serves as a classical model for elucidating EMT mechanisms, it does not fully replicate the distinct tissue microenvironment associated with endometritis. Future research should aim to validate these findings using human endometrial epithelial cell lines or primary cells to enhance the disease-specific relevance of this mechanism. Additionally, the in vitro macrophage polarisation experiment employed the mouse RAW 264.7 cell line, which differs from the rat model used in in vivo studies. Although the core signalling pathways are highly conserved across species, and this cell line offers the advantage of a mature experimental system, further validation using primary rat or bone marrow-derived macrophages is required to more accurately reflect the immunomodulatory mechanisms of IL-37 in CE models. Furthermore, the Smad reporter gene experiment utilized HEK-293T cells, primarily due to their high transfection efficiency and robust stability of the reporter system. Therefore, these findings serve as preliminary mechanistic evidence which requires further validation in disease-associated target cells for future studies.
In summary, this study proposes an integrated mechanistic model of the role of IL-37 in promoting endometrial repair. In the CE-damaged microenvironment, IL-37 operates through dual synergistic pathways. On the one hand, it directly inhibits EMT to stabilize epithelial architecture; on the other hand, it reprograms macrophages by coordinately activating and remodeling the functional output of the STAT6/Smad3 axis, thereby shaping an efficient and safe pro-repair immune microenvironment. These two pathways mutually reinforce each other to collectively drive high-quality tissue regeneration. Although the precise mechanism through which IL-37 coordinately activates STAT6 and Smad3 remains to be elucidated further, this study provides a solid theoretical foundation and experimental basis for the development of novel therapies targeting IL-37 or its downstream signaling nodes for the treatment of CE and related endometrial fibrotic diseases.

5. Conclusions

Our results demonstrated that IL-37 accumulated in injured uterine tissue and significantly ameliorated inflammatory infiltration, tissue destruction, and collagen deposition. Treatment with IL-37 attenuated epithelial cell migration and reversed abnormal EMT by upregulating E-cadherin expression and downregulating vimentin expression. Furthermore, IL-37 inhibited M1 macrophage infiltration and promoted a shift toward the M2 phenotype. Mechanistic studies revealed that IL-37 coactivated the STAT6 and Smad3 signaling pathways, increasing their phosphorylation and nuclear translocation, which subsequently boosted ARG1 expression. These findings indicate that IL-37 ameliorates CE by attenuating EMT and promoting M2 macrophage polarization through coordinated activation of the STAT6/Smad3 axis, underscoring its potential as a therapeutic agent for CE.

Author Contributions

Z.W. and J.T. performed the experiments; R.Z. and X.L. analyzed the data; Z.W., X.Z. and H.Z. wrote the manuscript; X.Z. and H.Z. obtained the funding. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by grants from the Hunan Provincial Health Commission Project (grant number 202102071747, 202202084830) and the Hunan Province College Students Research Learning and Innovative Experiment Project (grant number S202510542429).

Institutional Review Board Statement

All animal protocols were approved by the Biomedical Research Ethics Committee of Hunan Normal University (permit number: 2025674; approval date: 1 September 2025).

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

Appendix A

Table A1. Sequences of primers used for quantitative real-time PCR.
Table A1. Sequences of primers used for quantitative real-time PCR.
Primer NameForward Primer Sequence (5′ →3′)
CD206-1AAATGGCTTCCTGGAGAGCC
CD206-2ACCCTCCGGTACTACAGCAT
TGF-β-1CTTTGTACAACAGCACCCGC
TGF-β-2CATAGATGGCGTTGTTGCGG
IL-10-1CAGAGAAGCATGGCCCAGAA
IL-10-2GCTCCACTGCCTTGCTCTTA
IL-6-1GCCTTCTTGGGACTGATGCT
IL-6-2AGCCTCCGACTTGTGAAGTG
Arg-1-1ACATTGGCTTGCGAGACGTA
Arg-1-2ATCACCTTGCCAATCCCCAG
TNF-α-1ATGGCCTCCCTCTCATCAGT
TNF-α-2AAGGTACAACCCATCGGCTG
IL-1β-1GGGCTGCTTCCAAACCTTTG
IL-1β-2AAGACACAGGTAGCTGCCAC
iNOS-1CTATGGCCGCTTTGATGTGC
iNOS-2TTGGGATGCTCCATGGTCAC
β-actin-1TACTGCTCTGGCTCCTAGCA
β-actin-2CGGACTCATCGTACTCCTGC
β-catenin-1AGGACAAGCCACAGGACTACAAG
β-catenin-2GATCAGCAGTCTCATTCCAAGCC
N-cadherin-1GAGGAGCCGATGAAGGAACC
N-cadherin-2TGCTTGGCGAGTTGTCTAGG
Vimentin-1AGGATGTTGACAATGCTTCTCTGG
Vimentin-2ATCTCTTCATCGTGCAGCTTCTTC
E-cadherin-1GACAACGCTCCCATCTTCAACC
E-cadherin-2GGGCATCATCATCAGTCACCTTG
stat3-1GGGCTTCTCCTTCTGGGTCTG
stat3-2CCGCTCCTTGCTGATGAAACC
stat6-1TGTGGTGGCTGAGCGAGTG
stat6-2TGGGCGAGGAACAGGAAGTG
GADPH-1AACTCCCATTCTTCCACCTTTGATG
GADPH-2CTGTTGCTGTAGCCATATTCATTGTC

References

  1. Singh, N.; Sethi, A. Endometritis—Diagnosis, treatment and its impact on fertility—A scoping review. JBRA Assist Reprod. 2022, 26, 538–546. [Google Scholar] [CrossRef] [PubMed]
  2. Ticconi, C.; Inversetti, A.; Marraffa, S.; Campagnolo, L.; Arthur, J.; Zambella, E.; Di Simone, N. Chronic endometritis and recurrent reproductive failure: A systematic review and meta-analysis. Front Immunol. 2024, 15, 1427454. [Google Scholar] [CrossRef] [PubMed]
  3. Feng, H.; Li, C.; Chen, J.; Li, Z.; Ye, X.; Hou, L.; Wang, C.; Hou, C.; Liu, W. Astilbin from Smilax china L. remarkably inhibits LPS-induced endometritis in rats via blocking positive feedback between TLR4 and IL-6R signalling pathways in a PPAR-γ-dependent manner. J. Ethnopharmacol. 2025, 348, 119861. [Google Scholar] [CrossRef] [PubMed]
  4. Yang, X.; Zhang, S.; Liu, B.; Mao, W.; Gong, P.; Guo, L.; Wu, J.; Zhao, Y.; Wang, Y.; Hasi, S.; et al. Dual roles of the TLR2/TLR4/NLRP3-H-PGDS-PGD2 axis in regulating the inflammatory response in Escherichia coli-infected bovine bone marrow-derived macrophages and endometrial tissue. Theriogenology 2025, 239, 117374. [Google Scholar] [CrossRef]
  5. Matsuno, Y.; Imakawa, K. Biological aging and uterine fibrosis in cattle: Reproductive trade-offs from enhanced productivity. Cells 2025, 14, 955. [Google Scholar] [CrossRef]
  6. You, S.; Zhu, Y.; Li, H.; He, F.; Liu, S.; Yang, X.; Wang, L.; Zeng, H.; Dai, J.; Hu, L. Recombinant humanized collagen remodels endometrial immune microenvironment of chronic endometritis through macrophage immunomodulation. Regen. Biomater. 2023, 10, rbad033. [Google Scholar] [CrossRef]
  7. Di Gennaro, F.; Guido, G.; Frallonardo, L.; Pennazzi, L.; Bevilacqua, M.; Locantore, P.; Vitagliano, A.; Saracino, A.; Cicinelli, E. Chronic endometritis and antimicrobial resistance: Towards a multidrug-resistant endometritis? An expert opinion. Microorganisms 2025, 13, 197. [Google Scholar] [CrossRef]
  8. Xiang, R.; Li, M.; Gu, Z.; Liu, H.; Zeng, H.; Peng, J. Chronic endometritis positively correlates with the aggravation of intrauterine adhesions but has limited effects on reproductive prognosis with antibiotic application. J. Int. Fed. Gynaecol. Obstet. 2023, 160, 986–992. [Google Scholar] [CrossRef]
  9. Yan, X.; Jiao, J.; Wang, X. The pathogenesis, diagnosis, and treatment of chronic endometritis: A comprehensive review. Front. Endocrinol. 2025, 16, 1603570. [Google Scholar] [CrossRef]
  10. Gu, M.; Jin, Y.; Gao, X.; Xia, W.; Xu, T.; Pan, S. Novel insights into IL-37: An anti-inflammatory cytokine with emerging roles in anti-cancer process. Front. Immunol. 2023, 14, 1278521. [Google Scholar] [CrossRef]
  11. Zeng, H.; Zhou, K.; Ye, Z. Biology of interleukin-37 and its role in autoimmune diseases (review). Exp. Ther. Med. 2022, 24, 495. [Google Scholar] [CrossRef]
  12. Zhao, T.; Jin, F.; Xiao, D.; Wang, H.; Huang, C.; Wang, X.; Gao, S.; Liu, J.; Yang, S.; Hao, J. IL-37/STAT3/HIF-1α negative feedback signaling drives gemcitabine resistance in pancreatic cancer. Theranostics 2020, 10, 4088–4100. [Google Scholar] [CrossRef]
  13. Li, X.; Yan, B.; Du, J.; Xu, S.; Liu, L.; Pan, C.; Kang, X.; Zhu, S. Recent advances in progresses and prospects of IL-37 in central nervous system diseases. Brain Sci. 2022, 12, 723. [Google Scholar] [CrossRef] [PubMed]
  14. Murphy-Schafer, A.R.; Paust, S. Divergent mast cell responses modulate antiviral immunity during influenza virus infection. Front. Cell. Infect. Microbiol. 2021, 11, 580679. [Google Scholar] [CrossRef] [PubMed]
  15. Rusiñol, L.; Puig, L. A narrative review of the IL-18 and IL-37 implications in the pathogenesis of atopic dermatitis and psoriasis: Prospective treatment targets. Int. J. Mol. Sci. 2024, 25, 8437. [Google Scholar] [CrossRef] [PubMed]
  16. Jiang, B.; Zhou, Y.; Liu, Y.; He, S.; Liao, B.; Peng, T.; Yao, L.; Qi, L. Research progress on the role and mechanism of IL-37 in liver diseases. Semin. Liver Dis. 2023, 43, 336–350. [Google Scholar] [CrossRef]
  17. Ueno-Shuto, K.; Kamei, S.; Hayashi, M.; Fukuyama, A.; Uchida, Y.; Tokutomi, N.; Suico, M.A.; Kai, H.; Shuto, T. A splice switch in SIGIRR causes a defect of IL-37-dependent anti-inflammatory activity in cystic fibrosis airway epithelial cells. Int. J. Mol. Sci. 2022, 23, 7748. [Google Scholar] [CrossRef]
  18. Wang, Q.; Zhang, G.; An, C.; Hambly, B.D.; Bao, S. The role of IL-37 in gastrointestinal diseases. Front. Immunol. 2024, 15, 1431495. [Google Scholar] [CrossRef]
  19. Li, Y.; Gao, Q.; Xu, K.; Peng, X.; Yuan, X.; Jiang, W.; Li, M. Interleukin-37 attenuates bleomycin-induced pulmonary inflammation and fibrosis in mice. Inflammation 2018, 41, 1772–1779. [Google Scholar] [CrossRef]
  20. Xiong, L.; He, T.; Liu, C.; Qin, S.; Xiao, T.; Xin, W.; Wang, Y.; Ran, L.; Zhang, B.; Zhao, J. IL-37 ameliorates renal fibrosis by restoring CPT1A-mediated fatty acid oxidation in diabetic kidney disease. Kidney Dis. 2023, 9, 104–117. [Google Scholar] [CrossRef]
  21. Huang, Q.; Chen, T.; Li, J.; Wang, Y.; Shi, H.; Yu, Y.; Ji, Q.; Shen, X.; Sun, T.; Shi, H.; et al. IL-37 ameliorates myocardial fibrosis by regulating mtDNA-enriched vesicle release in diabetic cardiomyopathy mice. J. Transl. Med. 2024, 22, 494. [Google Scholar] [CrossRef]
  22. Yang, L.; Tao, W.; Xie, C.; Chen, Q.; Zhao, Y.; Zhang, L.; Xiao, X.; Wang, S.; Zheng, X. Interleukin-37 ameliorates periodontitis development by inhibiting NLRP3 inflammasome activation and modulating M1/M2 macrophage polarization. J. Periodontal Res. 2024, 59, 128–139. [Google Scholar] [CrossRef] [PubMed]
  23. Trimarchi, M.; Lauritano, D.; Ronconi, G.; Caraffa, A.; Gallenga, C.E.; Frydas, I.; Kritas, S.K.; Calvisi, V.; Conti, P. Mast cell cytokines in acute and chronic gingival tissue inflammation: Role of IL-33 and IL-37. Int. J. Mol. Sci. 2022, 23, 13242. [Google Scholar] [CrossRef] [PubMed]
  24. Mountford, S.; Effenberger, M.; Noll-Puchta, H.; Griessmair, L.; Ringleb, A.; Haas, S.; Denk, G.; Reiter, F.P.; Mayr, D.; Dinarello, C.A.; et al. Modulation of liver inflammation and fibrosis by interleukin-37. Front. Immunol. 2021, 12, 603649. [Google Scholar] [CrossRef] [PubMed]
  25. Xu, J.; Han, X.; Xia, N.; Zhao, Q.; Cheng, Z. IL-37 suppresses macrophage ferroptosis to attenuate diabetic atherosclerosis via the NRF2 pathway. Exp. Ther. Med. 2023, 25, 289. [Google Scholar] [CrossRef]
  26. Feng, Y.; Feng, L.; Wang, B.; Zhang, T.; Cui, B. Therapeutic potential of IL-37 in cervical cancer: Suppression of tumour progression and enhancement of CD47-mediated macrophage phagocytosis. Mol. Carcinog. 2025, 64, 425–439. [Google Scholar] [CrossRef]
  27. Zhao, M.; Li, Y.; Guo, C.; Wang, L.; Chu, H.; Zhu, F.; Li, Y.; Wang, X.; Wang, Q.; Zhao, W.; et al. IL-37 isoform D downregulates pro-inflammatory cytokines expression in a Smad3-dependent manner. Cell Death Dis. 2018, 9, 582. [Google Scholar] [CrossRef]
  28. Ren, C.; Chen, J.; Che, Q.; Jia, Q.; Lu, H.; Qi, X.; Zhang, X.; Shu, Q. IL-37 alleviates TNF-α-induced pyroptosis of rheumatoid arthritis fibroblast-like synoviocytes by inhibiting the NF-κB/GSDMD signaling pathway. Immunobiology 2023, 228, 152382. [Google Scholar] [CrossRef]
  29. Kong, D.; Hu, Y.; Li, X.; Yu, D.; Li, H.; Zhao, Y.; Qin, Y.; Jin, W.; Zhang, B.; Wang, B.; et al. IL-37 gene modification enhances the protective effects of mesenchymal stromal cells on intestinal ischemia reperfusion injury. Stem Cells Int. 2020, 2020, 8883636. [Google Scholar] [CrossRef]
  30. Luo, P.; Feng, C.; Jiang, C.; Ren, X.; Gou, L.; Ji, P.; Xu, J. IL-37b alleviates inflammation in the temporomandibular joint cartilage via IL-1R8 pathway. Cell Prolif. 2019, 52, e12692. [Google Scholar] [CrossRef]
  31. Zhou, Z.; Wang, H.; Zhang, X.; Song, M.; Yao, S.; Jiang, P.; Liu, D.; Wang, Z.; Lv, H.; Li, R.; et al. Defective autophagy contributes to endometrial epithelial-mesenchymal transition in intrauterine adhesions. Autophagy 2022, 18, 2427–2442. [Google Scholar] [CrossRef] [PubMed]
  32. Hua, Q.; Zhang, Y.; Li, H.; Li, H.; Jin, R.; Li, L.; Xiang, Y.; Tian, M.; Wang, J.; Sun, L.; et al. Human umbilical cord blood-derived MSCs trans-differentiate into endometrial cells and regulate Th17/treg balance through NF-κB signaling in rabbit intrauterine adhesions endometrium. Stem Cell Res. Ther. 2022, 13, 301. [Google Scholar] [CrossRef] [PubMed]
  33. Li, J.; Pan, Y.; Yang, J.; Wang, J.; Jiang, Q.; Dou, H.; Hou, Y. Tumor necrosis factor-α-primed mesenchymal stem cell-derived exosomes promote M2 macrophage polarization via galectin-1 and modify intrauterine adhesion on a novel murine model. Front. Immunol. 2022, 13, 945234. [Google Scholar] [CrossRef] [PubMed]
  34. Su, Z.; Tao, X. Current understanding of IL-37 in human health and disease. Front. Immunol. 2021, 12, 696605. [Google Scholar] [CrossRef]
  35. Cao, J.; Liu, J.H.; Wise, S.G.; Fan, J.; Bao, S.; Zheng, G.S. The role of IL-36 and 37 in hepatocellular carcinoma. Front. Immunol. 2024, 15, 1281121. [Google Scholar] [CrossRef]
  36. McCurdy, S.; Yap, J.; Irei, J.; Lozano, J.; Boisvert, W.A. IL-37-a putative therapeutic agent in cardiovascular diseases. QJM Int. J. Med. 2022, 115, 719–725. [Google Scholar] [CrossRef]
  37. Dang, J.; He, Z.; Cui, X.; Fan, J.; Hambly, D.J.; Hambly, B.D.; Li, X.; Bao, S. The role of IL-37 and IL-38 in colorectal cancer. Front. Med. 2022, 9, 811025. [Google Scholar] [CrossRef]
  38. Mesjasz, A.; Trzeciak, M.; Gleń, J.; Jaskulak, M. Potential role of IL-37 in atopic dermatitis. Cells 2023, 12, 2766. [Google Scholar] [CrossRef]
  39. Li, L.; Liao, Z.; Ye, M.; Jiang, J. Recombinant human IL-37 inhibited endometriosis development in a mouse model through increasing Th1/Th2 ratio by inducing the maturation of dendritic cells. Reprod. Biol. Endocrinol. RB&E 2021, 19, 128. [Google Scholar] [CrossRef]
  40. Wang, X.; Wei, Z.; Tang, Z.; Xue, C.; Yu, H.; Zhang, D.; Li, Y.; Liu, Y.; Zhang, L.; Chen, G.; et al. IL-37bΔ1-45 suppresses the migration and invasion of endometrial cancer cells by targeting the Rac1/NF-κB/MMP2 signal pathway. Lab. Investig. 2021, 101, 760–774. [Google Scholar] [CrossRef]
  41. Qin, Y.; Shao, B.; Ren, S.H.; Ye, K.; Qin, H.; Wang, H.D.; Sun, C.; Zhu, Y.; Wang, Z.; Zhang, J.; et al. Interleukin-37 contributes to endometrial regenerative cell-mediated immunotherapeutic effect on chronic allograft vasculopathy. Cytotherapy 2024, 26, 299–310. [Google Scholar] [CrossRef] [PubMed]
  42. Debnath, P.; Huirem, R.S.; Dutta, P.; Palchaudhuri, S. Epithelial-mesenchymal transition and its transcription factors. Biosci. Rep. 2022, 42, BSR20211754. [Google Scholar] [CrossRef] [PubMed]
  43. Marquardt, R.M.; Grimm, S.A.; Wu, S.P.; Lais, P.F.; Li, S.Y.; Xu, X.; Smithberger, E.; Cunefare, D.; Ganta, C.; Olson, D.; et al. Serum response factor is essential for endometrial function and prevention of inflammatory fibrosis. Proc. Natl. Acad. Sci. USA 2025, 122, e2510060122. [Google Scholar] [CrossRef] [PubMed]
  44. Feng, K.N.; Meng, P.; Zou, X.L.; Zhang, M.; Li, H.K.; Yang, H.L.; Li, H.T.; Zhang, T.T. IL-37 protects against airway remodeling by reversing bronchial epithelial-mesenchymal transition via IL-24 signaling pathway in chronic asthma. Respir. Res. 2022, 23, 244. [Google Scholar] [CrossRef]
  45. Huang, Q.Y.; Li, J.; Chen, T.Q.; Wang, Y.M.; Shen, X.Y.; Shi, H.M.; Luo, X.P.; Jin, B.; You, Y.; Wu, B.W. Cardiac fibroblast-specific expression of IL-37 confers the protective effects on fibrosis in diabetic cardiomyopathy mice by regulating SOCS3-STAT3 axis. J. Geriatr. Cardiol. JGC. 2024, 21, 1060–1070. [Google Scholar] [CrossRef]
  46. Jiang, I.; Yong, P.J.; Allaire, C.; Bedaiwy, M.A. Intricate connections between the microbiota and endometriosis. Int. J. Mol. Sci. 2021, 22, 5644. [Google Scholar] [CrossRef]
  47. Zhang, M.; Xu, T.; Tong, D.; Li, S.; Yu, X.; Liu, B.; Jiang, L.; Liu, K. Research advances in endometriosis-related signaling pathways: A review. Biomed. Pharmacother. 2023, 164, 114909. [Google Scholar] [CrossRef]
  48. Yan, X.; Jiao, J.; Wang, X. Inflammatory mechanisms and therapeutic advances in chronic endometritis. Front. Immunol. 2025, 16, 1616217. [Google Scholar] [CrossRef]
  49. Wang, C.; Ma, C.; Gong, L.; Guo, Y.; Fu, K.; Zhang, Y.; Zhou, H.; Li, Y. Macrophage polarization and its role in liver disease. Front. Immunol. 2021, 12, 803037. [Google Scholar] [CrossRef]
  50. Vassiliou, E.; Farias-Pereira, R. Impact of lipid metabolism on macrophage polarization: Implications for inflammation and tumor immunity. Int. J. Mol. Sci. 2023, 24, 12032. [Google Scholar] [CrossRef]
  51. Yang, G.; Zhang, Q.; Tan, J.; Xiong, Y.; Liang, Y.; Yan, J.; Gu, F.; Xu, Y. HMGB1 induces macrophage pyroptosis in chronic endometritis. Int. Immunopharmacol. 2023, 123, 110706. [Google Scholar] [CrossRef]
  52. Chen, P.; Chen, P.; Guo, Y.; Fang, C.; Li, T. Interaction between chronic endometritis caused endometrial microbiota disorder and endometrial immune environment change in recurrent implantation failure. Front. Immunol. 2021, 12, 748447. [Google Scholar] [CrossRef]
  53. Wang, B.; Yu, R.; Zhang, Z.; Peng, Y.; Li, L. Exosomes secreted from adipose-derived stem cells inhibit M1 macrophage polarization ameliorate chronic endometritis by regulating SIRT2/NLRP3. Mol. Cell. Biochem. 2025, 480, 4781–4796. [Google Scholar] [CrossRef]
  54. Xie, Y.; Chen, Z.; Zhong, Q.; Zheng, Z.; Chen, Y.; Shangguan, W.; Zhang, Y.; Yang, J.; Zhu, D.; Xie, W. M2 macrophages secrete CXCL13 to promote renal cell carcinoma migration, invasion, and EMT. Cancer Cell Int. 2021, 21, 677. [Google Scholar] [CrossRef]
  55. Xiao, J.; Yang, Z.; Wang, S.; Liu, X.; Wang, Y.; Hu, Z.; Zeng, Z.; Wu, J. CD248-expressing cancer-associated fibroblasts induce epithelial–mesenchymal transition of non-small cell lung cancer via inducing M2-polarized macrophages. Sci. Rep. 2024, 14, 14343, Erratum in Sci. Rep. 2025, 15, 26097. [Google Scholar] [CrossRef]
  56. Liu, R.; Tang, C.; Shen, A.; Luo, H.; Wei, X.; Zheng, D.; Sun, C.; Li, Z.; Zhu, D.; Li, T.; et al. IL-37 suppresses hepatocellular carcinoma growth by converting pSmad3 signaling from JNK/pSmad3L/c-myc oncogenic signaling to pSmad3C/P21 tumor-suppressive signaling. Oncotarget 2016, 7, 85079–85096. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Journal Statistics
Multiple requests from the same IP address are counted as one view.
Low KIF26B Expression Reduces Paclitaxel Resistance and Predicts Good Prognosis in Ovarian Cancer
Previous
Admission Serum Inflammatory and Injury Biomarkers Are Associated with In-Hospital Mortality in Neurological Inpatients with Confirmed SARS-CoV-2 Infection: The Brain-COVID Cohort Study
Next