Next Article in Journal
Regulatory Mechanisms Underlying Stem Strength and Toughness in Dicotyledonous Plants: Implications for Soybean Breeding
Next Article in Special Issue
Expression and Promoter Methylation of the Genes Encoding the Mitochondrial and Cytosolic Forms of Fumarase in Sunflower (Helianthus annuus L.) Leaves Depending on Light Regime and Salinity
Previous Article in Journal
Oral and Intranasal Administration of Polydeoxyribonucleotide Isolated from Porphyra sp. Ameliorates Acute Lung Injury via Suppressing Proinflammatory Cytokine Production in Mice
Previous Article in Special Issue
Genome-Wide Identification of RTE Gene Family Members in Sweet Potato and Their Expression Patterns Under Salt and Drought Stress
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
CIMB
Volume 48
Issue 2
10.3390/cimb48020188
cimb-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Trichoderma hamatum Biostimulant Modulates Physiology and Gene Expression to Enhance Lettuce Salt Tolerance

by
Xinxin Zhan
1,2,†,
Cuihong Hao
2,†,
Jing Liu
2,
Qingbin Wang
2,
Mingjing Yang
2,
Ruxin Li
2,
Lihong Chen
2 and
Dayong Cui
2,*
1
Key Laboratory of Biological Resources and Ecology of Pamirs Plateau in Xinjiang Uygur Autonomous Region, College of Life and Geographic Sciences, Kashi University, Kashi 844000, China
2
Shandong Engineering Research Center of Rose Breeding Technology and Germplasm Innovation, School of Life Sciences, Qilu Normal University, Jinan 250200, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Curr. Issues Mol. Biol. 2026, 48(2), 188; https://doi.org/10.3390/cimb48020188
Submission received: 31 December 2025 / Revised: 27 January 2026 / Accepted: 5 February 2026 / Published: 6 February 2026
(This article belongs to the Special Issue Abiotic Stress in Plants)
Browse Figures
Review Reports Versions Notes

Abstract

Soil salinity is a major constraint on global agricultural productivity. This study evaluated the efficacy of a cell-free extract from Trichoderma hamatum (designated BEYF) in enhancing salt stress tolerance in lettuce (Lactuca sativa). Lettuce plants under normal and salt-stressed conditions exposed to 200 mM NaCl were treated with either water or YF (the working solution of BEYF) at concentrations of 0.05, 0.10, and 0.25 mg/L. Compared to the control, YF application significantly improved plant growth under salt stress, as indicated by increased plant height, biomass, leaf area, and other agronomic traits. Physiologically, YF mitigated oxidative membrane damage, as indicated by reduced electrolyte leakage and malondialdehyde (MDA) content, while promoting the accumulation of the osmoprotectant proline. Histochemical staining further confirmed that YF effectively suppressed hydrogen peroxide (H2O2) accumulation and preserved cell viability under salt stress. At the molecular level, YF significantly up-regulated the expression of key stress-responsive genes, including those involved in abscisic acid biosynthesis (NCED1, NCED2), signaling (WRKY58), and proline synthesis (P5CSs). Collectively, our findings demonstrate that BEYF enhances lettuce salt tolerance through integrated physiological, cellular, and transcriptional adaptations, supporting its potential as a sustainable biostimulant for improving crop cultivation in saline soils.

1. Introduction

Soil salinization constitutes a widespread and intensifying abiotic constraint in global agroecosystems, imposing substantial limitations on crop productivity and threatening agricultural sustainability [1,2,3,4]. Consequently, the development of effective mitigation strategies against salinity stress is critical for safeguarding food security.
Lettuce (Lactuca sativa) is a nutritionally and economically important leafy vegetable whose pronounced sensitivity to salinity renders it a valuable model system for dissecting mechanisms of plant salt tolerance [5,6]. Under saline conditions, plants undergo profound physiological dysregulation, characterized principally by osmotic imbalance and oxidative stress [7,8]. This adaptive response is marked by the accumulation of compatible osmolytes, such as proline, and a concomitant burst of reactive oxygen species (ROS). Notably, malondialdehyde (MDA), a terminal product of lipid peroxidation, is widely utilized as a robust biomarker for assessing oxidative damage to cellular membranes [9,10,11].
In the search for sustainable solutions, next-generation biostimulants derived from cell-free microbial extracts have gained prominence [12]. Compared to live microbial inoculants, such extracts offer potential benefits including physicochemical stability, extended shelf life, production reproducibility, and compositional uniformity. Critically, their bioactivity is independent of microbial viability, rhizosphere colonization, and the establishment of plant-microbe symbiosis under field conditions. This independence may mitigate the performance inconsistency often observed with living formulations, which can be affected by varying environmental factors and host plant genotypes. Consequently, it supports more reliable product standardization and scalable agricultural use [13,14]. Moreover, these extracts are enriched with defined microbial metabolites that can directly interface with plant cellular systems, allowing for targeted modulation of specific stress-responsive signaling cascades [15,16]. This makes them a promising and distinct class of agro-inputs for targeted stress mitigation.
Fungi of the genus Trichoderma are well established as agents of plant growth promotion and biological control [17,18]. While fermentation broths or crude metabolites from species such as Trichoderma harzianum have demonstrated potential in mitigating abiotic stress [19], the efficacy and mechanism of a cell-free extract specifically derived from Trichoderma hamatum (BEYF) against salt stress remain unexplored. This presents a clear distinction from studies on other Trichoderma preparations and underscores a unique niche for BEYF. Current literature on T. hamatum is predominantly devoted to its antagonistic activity against soil-borne pathogens such as Phytophthora capsici [20]. Although existing studies have shown that certain biostimulants can alleviate salt stress in lettuce by regulating ion homeostasis and oxidative stress [21], the systematic physiological and molecular response mechanisms under salt stress for cell-free extracts from Trichoderma species, especially those derived from T. hamatum, remain poorly understood. Compared to traditional Trichoderma inoculants that rely on live colonization, the cell-free extract (BEYF) used in this study offers an intervention strategy with potentially more defined composition and greater application stability.
Thus, a significant knowledge gap persists regarding the capacity of a defined T. hamatum cell-free extract to enhance salt tolerance in lettuce, and regarding the integrated physiological, cellular, and transcriptional mechanisms that may underlie such an effect. To address this gap, a cell-free active extract (BEYF) was prepared from T. hamatum. Its efficacy was evaluated through a systematic assessment of growth phenotypes, key physiological stress markers, and the expression profiles of core stress-responsive genes in lettuce under saline conditions. This study identified the optimal application concentration of BEYF and delineated its potential mechanistic pathways in conferring salt tolerance. The results provide a theoretical and practical foundation for developing novel, efficient, microbe-derived extract-based biostimulants to improve crop resilience in saline environments.

2. Materials and Methods

2.1. Plant Material, Biostimulant, and Growth Conditions

The experiment was conducted in an artificial climate room provided by Prowisdom (Shandong) Microbial Technology Co., Ltd. (Jinan, Shandong, China). The plant material used in this study was Lactuca sativa L. (Italian lettuce cultivar), and seeds were purchased from Shandong Shouhe Seed Industry Co., Ltd. (Shouguang, Weifang, Shandong, China). The T. hamatum extract (BEYF) was provided by the same company.

2.1.1. Preparation of Crude Extract from T. hamatum

The wild-type strain of T. hamatum was cultivated in 200 mL of potato dextrose broth (PDB) medium, inoculated with 1% (v/v, 2 mL per 200 mL of medium) of a pre-culture. The culture was incubated at 25 °C with agitation at 100 rpm for 5 days. The mycelial biomass was harvested by centrifugation at 8000× g for 5 min, washed twice with deionized water, and then resuspended in an appropriate volume of deionized water. To ensure efficient cell disruption while preserving the integrity of heat-sensitive metabolites, an ultrasonic homogenizer (manufactured by Scientz Biotechnology Co., Ltd., Ningbo, China) operated at 100 W was used. The homogenization process was conducted for a total duration of 5 h, with the sample container maintained in an ice-water bath throughout the procedure to dissipate heat and keep the sample temperature below 10 °C. The homogenizer was operated in pulsed mode (5 s on, 10 s off) to further minimize thermal degradation. The resulting homogenate was centrifuged at 6000× g for 5 min at 4 °C to pellet cellular debris. The supernatant was collected and defined as the crude extract (BEYF).

2.1.2. Quantification and Dilution of the Extract

The concentration of the crude extract (BEYF) was determined via a dry-weight assay. A 1 mL aliquot of the crude extract was concentrated to dryness using a vacuum centrifugal concentrator (Eppendorf AG, Hamburg, Germany). The mass of the dried solid was then measured, and the concentration of BEYF was calculated to be 4.2 g/L, which represented the mean value derived from three independent preparation batches. To ensure experimental consistency and minimize inter-batch variability, all experiments in this study were conducted using a single batch of extract. For each newly prepared batch, the dry-weight concentration was reassessed and, if necessary, adjusted to 4.2 g/L by dilution or concentration, thereby standardizing the stock concentration across batches. For experimental applications, this standardized stock solution was diluted with deionized water to achieve the desired working concentrations (0.05, 0.10, and 0.25 mg/L). The final diluted preparation was designated as YF (the working solution of BEYF for plant treatments).

2.1.3. Untargeted Metabolomic Profiling of BEYF

Untargeted liquid chromatography-mass spectrometry (LC-MS) was used to characterize the chemical composition of the T. hamatum extract (BEYF). Approximately 100 µL of each sample was extracted with 900 µL of methanol:acetonitrile:water (2:2:1, v/v/v), followed by ultrasonication for 10 min and subsequent centrifugation. The supernatant was dried, then reconstituted in methanol, and filtered prior to analysis. Chromatographic separation was performed on a Thermo Scientific Hypersil GOLD aQ column (2.1 × 100 mm, 1.8 µm) using a gradient of water and acetonitrile (both containing 0.1% acetic acid) at a flow rate of 0.3 mL/min. High-resolution mass spectrometry was conducted on a Q Exactive Orbitrap mass spectrometer (Thermo Fisher Scientific, Bremen, Germany) in both positive (spray voltage 3.8 kV) and negative (spray voltage 3.3 kV) ionization modes, with scanning performed in Full MS/dd-MS2 mode over a mass range of *m/z* 80 to 1200. Raw data were processed using Compound Discoverer 3.3, which included steps for feature extraction, noise filtering, normalization, and log-transformation. Metabolites were identified by matching spectral data against online databases (e.g., KEGG, HMDB) and an in-house spectral library.

2.2. Experimental Design and Treatments

The 200 mM NaCl concentration was selected to represent a severe but physiologically relevant salt stress level for lettuce, a crop recognized for its salt sensitivity. Agronomic and physiological studies indicate that NaCl concentrations exceeding 100 mM cause marked growth suppression in lettuce. This stress leads to distinct symptoms, including ion toxicity, osmotic imbalance, and oxidative damage. Thus, the 200 mM threshold provides a clearly defined stress window suitable for evaluating the efficacy of biostimulant interventions, while aligning with concentrations commonly used in controlled-environment screening assays [22,23].
Mature and uniform lettuce seeds were selected and first soaked in warm water (25–30 °C) for 7–8 h. They were then placed on two layers of sterile moist filter paper in Petri dishes (approximately 30 seeds per dish) and germinated in darkness at 20 °C. Germinated seeds were sown in a 72-cell seedling tray filled with a 3:1 (v/v) mixture of field soil and seedling substrate. Each cell was sown with a single seed and covered with 0.5 cm of the same substrate mixture. Plants were maintained under controlled environmental conditions with a 14/10 h light/dark cycle, day/night temperatures of 20/15 °C, and a light intensity of 12,000 lx. They were watered every other day until the three-leaf stage, when seedlings were transplanted into perforated cultivation troughs (400 mm × 220 mm × 120 mm). After transplantation, the watering regimen was adjusted to once every 3 days, with a fixed volume of 400 mL applied per pot on each occasion.
The experiment was arranged in a randomized complete block design (RCBD) with five replicates (blocks) to minimize spatial variability within the growth environment. A total of ten treatment groups were established, with each treatment randomly assigned within each block (Table 1). Starting one week after transplanting, each group was irrigated every seven days with an equal volume of the respective treatment solution. Brown algal oligosaccharides (AOS) at 15.00 mg/L, a recognized biostimulant known to enhance salt tolerance through mechanisms such as cell wall protection and antioxidant enhancement, were used as a positive control [24,25]. At maturity, agronomic traits, physiological parameters, and gene expression levels were evaluated.

2.3. Measurements of Parameters

2.3.1. Plant Height, Stem Diameter, and Canopy Width

In each treatment, four healthy plants with consistent growth were selected for the measurement of morphological parameters. The specific methods were as follows:
Plant height: Measured from the soil surface to the apical meristem using a ruler. Each plant was measured four times, and the average value was calculated.
Stem diameter: After gently washing the roots with tap water to remove soil, the stem diameter at the base of the lowest leaf was measured using a caliper. Each plant was measured twice, and the average value was determined.
Canopy width: Viewed from above, the projection distance between the farthest leaf tips was measured in two perpendicular directions with the apical meristem as the center, using a ruler. The average of the two measurements was taken as the canopy width.

2.3.2. Number of Roots, Number of Leaves, and Leaf Area

Roots number: Primary lateral roots longer than 1 cm were defined as effective roots. The number of such roots per plant was recorded.
Leaf number: Healthy leaves originating from the stem base and with a length of at least 2.5 cm were counted as effective leaves. The total number of leaves per plant, excluding cotyledons, was recorded.
Leaf area: After harvest, all fully expanded leaves were laid flat on a black background. A standard ruler was placed beside the leaves, and the image was scanned. Leaf area was measured using ImageJ software (version 1.54c; Wayne Rasband, National Institutes of Health, Bethesda, MD, USA; http://imagej.org), and total leaf area per plant was calculated [26].

2.3.3. Biomass Measurement

The whole plant was gently excavated. Surface moisture was removed with absorbent paper. The aboveground part, underground part, and total plant were separately weighed using a precision electronic balance (Lichens Technology Co., Ltd., Shanghai, China).

2.3.4. Measurement of Relative Electrical Conductivity, Malondialdehyde (MDA), and Proline Content

Relative electrical conductivity: Fresh leaves (0.10 g) were immersed in 10 mL of distilled water and shaken at 25 °C and 100 rpm for 8 h. The conductivity was measured with a conductivity meter and recorded as L1. The samples were then boiled for 20 min, cooled to room temperature, and the conductivity was measured again as (L2). The relative electrical conductivity was calculated as L1/L2 × 100% [27].
Malondialdehyde (MDA) content: MDA content was determined using the thiobarbituric acid (TBA) method [28]. Fresh lettuce leaves (0.10 g) were deveined, homogenized in 1 mL of extraction solution in an ice-cooled mortar, and centrifuged at 8000× g for 10 min at 4 °C. The MDA content in the supernatant was quantified with a commercial MDA assay kit (Iseshu Biotechnology Co., Ltd., Lianyungang, China). Three biological replicates were performed per treatment.
Proline content: Proline content was assayed following a procedure similar to that for MDA. After removing the veins from 0.10 g of fresh lettuce leaves, the tissue was homogenized in 1 mL of extraction buffer on ice. Following centrifugation at 8000× g for 10 min at 4 °C, the proline content in the supernatant was determined using a proline assay kit (Iseshu Biotechnology Co., Ltd.). Each treatment was analyzed with three biological replicates.

2.3.5. Histochemical Staining for Oxidative Damage and Cell Viability

To assess oxidative damage and cell viability in response to salt stress and YF treatment, the following histochemical staining methods were employed:
DAB Staining for Hydrogen Peroxide (H2O2) Accumulation. The DAB staining solution was prepared with 1 mg/mL 3,3′-diaminobenzidine (DAB) and 0.1% Tween-20. The pH was adjusted to 3.8 using HCl. Treated leaves were incubated in the solution and gently shaken in the dark for 8 h. The stain was then discarded, and chlorophyll was removed by boiling the leaves in decolorizing solution (anhydrous ethanol: glacial acetic acid: glycerol = 3:1:1 v/v) for 10 min. This was followed by incubation at room temperature in a fresh solution for 1 h. Leaves were then photographed to visualize H2O2 accumulation [29,30].
Trypan blue Staining for Cell Viability. Lettuce leaves treated with YF for 12 h were immersed in trypan blue staining solution (20% phenol, 20% glycerol, 20% lactic acid, 0.02% w/v trypan blue) and boiled for 5 min in a water bath. The dye solution was then discarded. Leaves were decolorized by gentle shaking in a 2.5 g/mL chloral hydrate solution until they became transparent, replacing the decolorizing solution 1–2 times during the process [31].

2.3.6. Gene Expression Analysis Using qRT-PCR

The third functional leaf was collected from both salt-stressed and control lettuce plants. Total RNA was extracted from 0.10 g of fresh leaf tissue flash-frozen in liquid nitrogen using the RNAprep Pure Plant Total RNA Extraction Kit (Tiangen Biotech, Beijing, China). cDNA was then synthesized from the extracted RNA using the Evo M-MLV Reverse Transcription Premix Kit (Accurate Biology Co., Ltd., Changsha, Hunan, China). Quantitative reverse transcription PCR (qRT-PCR) was performed to measure the expression levels of stress-related genes and key genes involved in proline synthesis. The primer sequences for the lettuce reference gene [32], stress-related genes NCED1 [33], NCED2 [33], WRKY58 [34], and proline synthesis genes P5CS1, P5CS2, and P5CS4 [35,36] are listed in Table 2. All primers were synthesized by Sangon Biotech (Shanghai, China).
The qRT-PCR reactions were carried out using the SYBR Green Pro Taq HS Premixed qPCR Kit (Tiangen Biotech) on a CFX Duet Real-Time PCR system (Bio-Rad Laboratories, Hercules, CA, USA). The thermal cycling conditions followed the manufacturer’s protocol. Three biological replicates per treatment were analyzed, each with three technical replicates [37]. Gene expression levels were calculated using the 2(−ΔΔCt) method [38,39]. Differences were assessed for statistical significance using IBM SPSS Statistics 26.0.

2.4. Data Processing and Statistical Methods

Data processing was conducted using Microsoft Excel (Version 2021). Statistical analysis of multiple sample groups was performed with IBM SPSS Statistics 26.0 software (p < 0.05). GraphPad Prism 9.0 was used for further data analysis and visualization, and Adobe Photoshop 2024 was employed for the final Figure layout. Results are presented as mean ± standard error.

3. Results and Analysis

3.1. Chemical Composition of BEYF as Revealed by Untargeted Metabolomics

To identify the effective components in the crude fungal extract (BEYF), non-targeted metabolomics profiling was performed, which identified a total of 1454 metabolites. The identified metabolites spanned a broad spectrum of chemical classes, including amino acids, organic acids, nucleotides, lipids, and specialized signaling molecules, collectively forming a complex chemical matrix. This diverse composition underpins BEYF’s multifunctional biostimulant properties, supporting its potential roles in plant growth regulation, stress adaptation, and metabolic modulation.

3.2. Effects of YF on Lettuce Growth Under Normal and Salt Stress Conditions

We first evaluated YF effects on lettuce growth under normal and salt stress conditions (Figure 1 and Figure 2). Under normal conditions, all YF concentrations significantly increased plant height compared to the control (Figure 1A). Under normal (non-stressed) conditions, all YF concentrations significantly increased plant height compared to the Control (Figure 1A). The greatest promotion was observed at 0.25 mg/L YF (YF-3), where plant height reached 10.98 cm (an 18.3% increase over the Control; see absolute values in Supplementary Table S1). Similarly, YF treatments also enhanced canopy width across all tested concentrations (Figure 2A), with the most pronounced effect at 0.10 mg/L YF (YF-2), reaching 21.33 cm (a 16.7% increase).
In contrast, stem diameter exhibited a concentration-dependent response (Figure 1C). While 0.10 mg/L YF (YF-2) slightly increased stem diameter to 15.68 mm (a 4.4% increase), the lowest concentration of YF (0.05 mg/L, YF-1) significantly reduced stem diameter to 12.98 mm, representing a 13.6% decrease compared to the control (15.02 mm). This reduction at low YF dosage may reflect an early resource-allocation shift or a mild hormetic stress response, wherein limited biostimulant exposure transiently redirects assimilates toward root development or metabolic priming before promoting radial growth at higher concentrations or under prolonged treatment.
Under salt stress (200 mM NaCl), lettuce growth was markedly suppressed. Plant height, canopy width, and stem diameter decreased by 16.9%, 12.33%, and 25.1%, respectively, compared to non-stressed plants (Figure 1B,D and Figure 2B; see absolute values in Supplementary Table S1).
Application of YF effectively alleviated this inhibition. The 0.05 mg/L YF (YF-1) treatment (YF-1+NaCl) resulted in the most consistent recovery across parameters, significantly increasing plant height and canopy width by 4.9% and 16.4%, respectively, relative to the salt-stressed control (NaCl). Stem diameter under this treatment also showed a 13.5% increase compared to the NaCl control (Figure 1D).

3.3. Effects of YF on Root and Leaf Development

We next examined YF effects on root and leaf development (Figure 3 and Figure 4). Under normal conditions, 0.05 mg/L YF (YF-1) significantly increased the number of roots by approximately 21% compared to the water control (from 59.33 to 71.75 roots per plant, see Supplementary Table S1) and enhanced total leaf area (Figure 3A,C). However, no significant effect was observed on leaf number across all tested YF concentrations under non-stressed conditions (Figure 4).
Salt stress severely suppressed root and leaf development, with root number, leaf number, and total leaf area decreasing by 41.8%, 17.3%, and 33.8%, respectively (Figure 3B,D and Figure 4B; Supplementary Table S1). YF application effectively alleviated this inhibition in a concentration-dependent manner. Root number recovery was most pronounced under 0.10–0.25 mg/L YF treatments, reaching 47.25 and 42.00 roots per plant, respectively, compared to 34.50 roots in the NaCl-only control (Figure 3B). Total leaf area increased significantly under 0.05–0.10 mg/L YF, with values of 845.44 and 776.93 mm2, respectively (Figure 3D). Leaf number was significantly enhanced by all YF concentrations, with the highest value (28.50 leaves) observed under 0.10 mg/L YF (Figure 4B).

3.4. YF Promotes Biomass Accumulation

To quantify the growth-promoting effects, we measured the fresh weight of different plant parts (Figure 5). Under normal conditions, YF application significantly increased biomass in a concentration-dependent manner (Figure 5A,C,E). Compared to the water control (48.88 g aboveground, 15.13 g belowground, 64.00 g total), the 0.10 mg/L YF treatment (YF-2) showed the most pronounced effect, increasing aboveground, belowground, and total fresh weight by 47.1% (to 71.88 g), 83.4% (to 27.75 g), and 55.7% (to 99.63 g), respectively (see Supplementary Table S2 for absolute values). The greater proportional increase in belowground biomass indicates that YF particularly promotes root system development under optimal growth conditions.
Under salt stress (200 mM NaCl), biomass accumulation was severely inhibited. The salt-stressed control (CK-NaCl) exhibited reductions of 47.1%, 45.5%, and 46.7% in aboveground, belowground, and total fresh weight, respectively, compared to the non-stressed water control (Figure 5B,D,F; Supplementary Table S2). YF treatments effectively mitigated this salt-induced biomass loss. The 0.10 mg/L YF treatment again demonstrated the highest efficacy, increasing the aboveground, belowground, and total fresh weight by 63.3%, 92.4%, and 70.3%, respectively, compared to the CK-NaCl group (Figure 5B,D,F; Supplementary Table S2).

3.5. YF Improves Physiological Stress Indicators

We then analyzed key physiological indicators to elucidate the mechanisms underlying the growth improvement mediated by YF (Figure 6). Under normal conditions, application of YF (0.05–0.25 mg/L) significantly reduced the relative electrical conductivity of leaves compared to the water control (CK-H2O: 47.80%), indicating enhanced membrane integrity (Figure 6A). Treatments with 0.10 and 0.25 mg/L YF significantly decreased MDA content to 15.69 and 16.81 nmol/g FW, respectively (CK-H2O: 23.69 nmol/g FW), reflecting a reduction in oxidative membrane damage (Figure 6C) [9]. Notably, under non-stress conditions, 0.10 mg/L YF also significantly reduced the proline content to 29.65 µg/g FW, representing a 21.5% decrease from the water control (37.78 µg/g FW) (Figure 6E). This decrease in basal proline levels implies that YF enhances overall plant vigor and reduces background metabolic stress under optimal growth conditions.
Salt stress (200 mM NaCl) induced typical physiological stress responses, increasing leaf relative electrical conductivity, MDA, and proline content by 39.7% (to 66.79%), 15.4% (to 27.35 nmol/g FW), and 12.4% (to 42.45 µg/g FW), respectively, compared to the non-stressed control (Figure 6B,D,F; see Supplementary Table S3 for absolute values). YF application effectively counteracted these stress-induced changes. Specifically, 0.05 mg/L YF (YF-1+NaCl) reduced relative electrical conductivity by 49.2% (to 33.94%). The 0.10 mg/L YF treatment (YF-2+NaCl) was particularly effective, reducing MDA content by 40.7% (to 16.21 nmol/g FW) and, most strikingly, inducing a dramatic accumulation of proline to 285.14 μg/g FW. This level represents a 6.7-fold increase compared to the salt-stressed control (CK-NaCl) and underscores a potent YF-mediated activation of osmotic adjustment under stress.

3.6. YF Reduces Oxidative Damage and Enhances Cell Viability Under Salt Stress

To further validate the protective effects of YF against salt-induced oxidative stress and membrane damage, we performed histochemical staining on leaves collected at the end of the 35-day treatment period. Cell viability was assessed using trypan blue staining, and hydrogen peroxide accumulation was visualized with 3,3′-diaminobenzidine staining.

3.6.1. DAB Staining Reveals Reduced H2O2 Accumulation

Under non-saline conditions, all treatment groups exhibited minimal 3,3′-diaminobenzidine (DAB) staining, indicating basal levels of hydrogen peroxide (H2O2) accumulation (Figure 7A, upper panel). Quantitative analysis of DAB staining intensity using ImageJ showed no significant differences among YF-treated groups under normal conditions, with relative optical densities ranging from 1.17 to 1.34 (Figure 7B). In contrast, salt stress (200 mM NaCl) induced pronounced brown polymerization products in control (CK) leaves, reflecting significant H2O2 accumulation (Figure 7A, lower panel). The optical density in the NaCl-stressed control group increased to approximately 3.52-fold of the average value under non-stressed conditions, confirming substantial oxidative stress (Figure 7B). YF application markedly attenuated this oxidative burst in a concentration-dependent manner. Leaves treated with 0.10 mg/L YF (YF-2) under salt stress showed the most substantial reduction in DAB staining intensity.

3.6.2. Trypan Blue Staining Demonstrates Enhanced Cell Viability

Trypan blue staining, which selectively stains dead or severely damaged cells, provided complementary evidence for YF-mediated protection (Figure 7C). Under normal growth conditions, leaves from all groups showed negligible blue staining (Figure 7C, upper panel). Quantitative analysis confirmed this observation, with similar optical density values across all treatments under normal conditions (ranging from 1.55 to 1.62, Figure 7D). Salt stress, however, induced extensive trypan blue uptake in control leaves, indicating widespread cell death (Figure 7C, lower panel). The optical density in salt-stressed control leaves increased by approximately 2.1-fold compared to the average value under normal conditions, indicating severe cell damage (Figure 7D). YF treatments effectively reduced the extent of blue staining, with 0.10 mg/L YF (YF-2) conferring the most pronounced protection. Quantitatively, YF treatments at 0.05, 0.10, and 0.25 mg/L reduced the optical density under salt stress, representing a reduction to 1.5, 1.4, and 1.7-fold of the normal average, respectively, demonstrating significant preservation of cell viability (Figure 7D).

3.7. YF Activates Stress-Related Gene Expression

To investigate molecular mechanisms underlying YF’s effects, we analyzed the expression of key genes involved in abscisic acid (ABA) biosynthesis (NCED1, NCED2) and stress-responsive transcription factor WRKY58 (Figure 8). Under normal conditions, YF application modulated the expression of these genes in a concentration-specific manner. While NCED1 expression was not significantly altered, 0.10 mg/L YF (YF-2) significantly increased NCED2 expression approximately 2.9-fold compared to the water control. Furthermore, both 0.05 and 0.10 mg/L YF induced WRKY58 expression by approximately 10.5- and 14.0-fold, respectively (Figure 8A,C,E).
Co-application of YF under salt stress further amplified this response synergistically (Figure 8B,D,F). Compared to the salt-stressed control, NCED1 expression was induced by YF treatment under salt stress. 0.10 mg/L YF (YF-2+NaCl) increased NCED2 expression approximately 3.9-fold (Figure 8B,D). Most strikingly, the same treatment triggered an extraordinary induction of WRKY58 expression—approximately 66.3-fold higher than the CK-NaCl control (Figure 8F). The magnitude of this induction aligns with reported patterns where severe stresses can elicit extremely strong upregulation of specific WRKY transcription factors, which act as master regulators of plant stress responses [40].

3.8. YF Induces Proline Biosynthesis Gene Expression

Given the dramatic upregulation of the stress-responsive transcription factor WRKY58 by YF under salt stress (Figure 8F) and the established role of WRKY factors in regulating osmotic adjustment pathways, we hypothesized that YF might enhance proline biosynthesis at the transcriptional level. We therefore analyzed the expression of key genes encoding Δ1-pyrroline-5-carboxylate synthase (P5CS1, P5CS2, and P5CS4), the rate-limiting enzymes in proline biosynthesis (Figure 9).
Under normal, non-stress conditions, YF application did not induce significant changes in P5CS expression, except for P5CS2 (Figure 9A,C,E). Specifically, P5CS2 expression was increased approximately 2.0-fold by 0.05 mg/L YF (YF-1). These alterations were consistent with a low baseline level of proline observed under optimal growth conditions (Figure 6E).
In contrast, under salt stress, YF co-application triggered a more pronounced and synergistic induction of P5CSs genes (Figure 9B,D,F). Compared to the salt-stressed control (CK-NaCl, expression set to 1), YF treatments significantly upregulated these genes in a concentration-dependent manner. The 0.05 mg/L YF treatment was particularly effective, inducing P5CS4 expression by approximately 2.3-fold. Similarly, both 0.05 and 0.10 mg/L YF significantly increased the expression of P5CS1 and P5CS2. This transcriptional activation of the proline biosynthetic machinery provides a direct molecular explanation for the massive, YF-dependent accumulation of proline under salt stress, which reached 285.14 µg/g FW with the 0.10 mg/L treatment (Figure 6F).

4. Discussion

Soil salinization poses a significant threat to global agricultural productivity, which drives the need for ecological strategies to enhance crop resilience [21]. In this context, microbial-derived biostimulants have emerged as a promising tool to enhance crop resilience [41,42]. This study demonstrates that the diluted extract (YF, prepared from BEYF) improves salt tolerance in lettuce through a series of integrated adaptations. These encompass morphological, physiological, cellular, and transcriptional levels. Our results support the established paradigm that effective biostimulants prime multiple defense pathways [43]. For instance, YF mitigated key physiological stress markers, including membrane lipid peroxidation (MDA) and hydrogen peroxide (H2O2) accumulation, while promoting proline biosynthesis. This aligns with recent findings on a plant-derived biostimulant that alleviates salt stress in lettuce by reducing oxidative damage and ion toxicity [21]. However, our study provides an additional layer of mechanistic insight. We show that YF treatment is linked to the significant upregulation of core stress-signaling components. These include ABA biosynthesis genes (NCED1, NCED2), the transcription factor WRKY58, and proline synthesis genes (P5CS1, P5CS2, P5CS4). This suggests that YF may enhance salt tolerance not only by alleviating downstream stress symptoms but also by proactively modulating upstream regulatory networks. This latter mechanistic insight is less commonly elucidated in comparable biostimulant studies.
The observed growth promotion and physiological protection align with the established paradigm of effective biostimulant action. Under salt stress, YF application alleviated growth inhibition across multiple parameters. These included plant height, biomass, and root development. Concurrently, key physiological stress indicators were ameliorated. Reductions in electrolyte leakage and MDA content indicated enhanced membrane integrity and mitigated oxidative damage. Additionally, a significant accumulation of proline indicated an enhanced osmotic adjustment capacity. This coordinated improvement across growth and physiology is a hallmark of successful biostimulants, which typically function by priming multiple, interconnected defense pathways rather than targeting a single stress response mechanism [44,45,46]. The histochemical evidence further substantiates this integrated protective effect. It shows that YF treatment is associated with reduced hydrogen peroxide accumulation and preserved cell viability under salt stress.
YF’s effects showed a concentration-dependent nature, suggesting a complex interaction with plant physiology [44]. This included a growth-inhibitory response at low concentration under non-stress conditions. This biphasic dose–response pattern is characteristic of a hormetic phenomenon [47,48,49]. In such patterns, low doses can induce a stimulatory or adaptive response. This response is absent or reversed at higher doses. Hormesis is increasingly recognized in plant-biostimulant interactions [48,49]. Here, mild stress induced by certain compounds can upregulate defense pathways. This upregulation leads to enhanced tolerance to subsequent, more severe stresses. The reduction in stem diameter, coupled with increased root growth at the lowest YF concentration, may reflect such resource reallocation or mild stress priming. This concept is supported by studies on various bioactive compounds [50].
At the molecular level, YF treatment was associated with distinct changes in the expression of specific stress-related genes. Under salt stress, co-application of YF was linked to increased transcript levels of ABA biosynthesis genes (NCED1, NCED2). It also led to a particularly pronounced increase in the expression of the transcription factor WRKY58 [40,51]. This pattern of gene expression coincides with the induction of proline biosynthesis genes (P5CS1, P5CS2, P5CS4) and the subsequent proline accumulation [52]. It is important to note that while the synchronous improvements in gene expression, phenotype, and physiology are significantly correlated, this association alone does not establish a causal relationship. It should be noted that this study primarily provides clues for the activation of the ABA signaling pathway at the transcriptional level, but did not directly measure changes in endogenous ABA hormone content in the plants. Therefore, whether YF treatment indeed leads to ABA accumulation and its dynamic processes still requires further verification through experiments such as hormone quantification analysis. The underlying mechanisms require further elucidation through subsequent experiments. Nevertheless, the high degree of coordination across these multi-level responses strongly suggests that YF may reprogram the plant’s stress response network, thereby triggering systemic adaptation rather than merely alleviating symptoms. This inference lays the logical groundwork for the subsequent discussion on YF’s “signal intervention” mechanism from a metabolomic perspective.
The non-targeted metabolomics analysis in this study provides a compositional basis for understanding this reprogramming. It also helps explain the transition from a “symbiotic interaction” to a “signal intervention” paradigm. The BEYF extract is enriched with metabolites that possess potential signaling functions. These include phytohormone analogs, amino acid derivatives, oxidized lipids, alkaloids, and nucleotide metabolites. Collectively, these components constitute a complex chemical signal library [53]. This library can directly interact with plant cells, which bypasses the need for live microbial colonization. For instance, the identified jasmonic acid, salicylic acid derivatives, and compounds related to abscisic acid and auxin are known endogenous plant signaling molecules or their structural analogs [54,55,56]. These compounds are capable of directly regulating defense responses, growth, and stress adaptation [57,58].
Furthermore, various oxidized lipids, such as hydroxy and epoxy fatty acids and small peptides, are often recognized as damage-associated or microbe-associated molecular patterns (DAMPs/MAMPs). These can trigger early immune signaling [59,60]. The presence of these components indicates that BEYF likely functions not through physical colonization or nutrient competition. Instead, it works by delivering a preformed cocktail of signaling chemicals. This cocktail directly intervenes in the plant’s signal perception and transduction networks. This mechanism is particularly relevant in complex field environments. In such environments, microbial community composition is dynamic, whereas stable metabolite signals could offer more consistent biostimulant efficacy. Therefore, the chemical profile of BEYF supports its role as a “signal intervention” agent. This highlights the centrality of metabolite-mediated chemical dialog in plant-microbe interactions. It provides a material basis and a conceptual blueprint for developing the next generation of synthetic biostimulants. These future biostimulants would be based on well-defined signal molecules with controlled composition and stable potency. This represents a move in agricultural inputs from a paradigm of “living microbes” to one of “living chemical signals”.
This study demonstrates that multifaceted improvements in plant growth, physiology, and gene expression. These improvements underscore the potential of cell-free microbial extracts as a distinct and effective class of biostimulants. This research employed a defined extract from T. hamatum (BEYF). In doing so, it departs from studies that utilize whole microbial inoculants [61,62]. The approach offers insights into a more direct and potentially standardized mode of action, one that does not rely on microbial colonization.
The general ability of Trichoderma species to enhance plant stress tolerance is well-documented in reviews [63]. However, our work provides specific, integrated physiological and transcriptional evidence for the efficacy of a cell-free preparation from T. hamatum. The biostimulant potential of this species, particularly under salt stress, has been less explored compared to, for instance, T. harzianum [64,65]. Furthermore, our findings align with the broad functional framework of biostimulants. This framework suggests they can operate through diverse pathways to improve crop performance [66].
While the results under controlled conditions are promising, translating BEYF into a reliable agricultural tool requires addressing several critical gaps. First, the specific bioactive compounds responsible for the observed effects within the complex BEYF mixture remain unidentified. Their isolation and characterization are essential. This step is crucial for understanding the mode of action, ensuring product consistency, and meeting regulatory standards. Second, the efficacy and stability of BEYF must be rigorously validated under field conditions. In field settings, factors such as soil heterogeneity, climate variability, and crop management practices can significantly influence biostimulant performance. Large-scale agronomic trials in naturally saline soils are indispensable. These trials are needed to assess the practical utility and economic viability of BEYF. Finally, the potential for synergy or interaction with other agricultural inputs warrants investigation. Examples include fertilizers and other biostimulants. Such research is necessary to develop integrated crop management strategies for saline environments.

5. Conclusions

This study demonstrates that application of the diluted cell-free extract from T. hamatum (YF, derived from BEYF) enhances salt tolerance in lettuce through a coordinated multi-level response. The beneficial effects include mitigation of salt-induced growth suppression, reduction in oxidative membrane damage, and accumulation of the osmoprotectant proline. Furthermore, YF treatment reduced oxidative stress and improved cellular integrity, while also modulating the expression of key stress-related genes. Together, these integrated adaptations underline the potential of BEYF as a promising biostimulant for improving crop resilience under saline conditions.
Collectively, these findings add to the growing evidence for microbial extracts as biostimulants, showing their potential to enhance plant resilience to abiotic stress. The promising results from this controlled-environment study highlight YF as a candidate for further development. However, its transition from a laboratory observation to an agricultural product depends on future research focused on identifying the active constituents within BEYF and demonstrating consistent efficacy of YF in field trials. Such steps are crucial for evaluating the true potential of BEYF as a sustainable component of salinity management strategies.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cimb48020188/s1.

Author Contributions

X.Z.: Conceptualization, Investigation, Data curation, Formal analysis, Visualization, Writing—original draft. C.H.: Methodology, Validation, Investigation, Data curation. J.L.: Resources, Software, Visualization. Q.W.: Investigation, Data curation. M.Y.: Validation, Formal analysis. R.L.: Investigation. L.C.: Supervision. D.C.: Supervision, Project administration, Funding acquisition, Writing—review & editing. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Natural Science Foundation of China (32370363), the Natural Science Foundation of Shandong Province (ZR2025MS288), and the Jinan Municipal Strategy Project for City-University Integrated Development (JNSX2024060).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Acknowledgments

We are grateful to Prowisdom (Shandong) Microbial Technology Co., Ltd. for providing the T. hamatum extract (BEYF) and access to their artificial climate room facilities for this study. We acknowledge the technical assistance and support from our colleagues at the School of Life Sciences, Qilu Normal University, and the College of Life and Geographic Sciences, Kashi University.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Liu, H.T.; Tang, X.; Zhang, N.; Li, S.G.; Si, H.J. Role of bZIP transcription factors in plant salt stress. Int. J. Mol. Sci. 2023, 24, 7893. [Google Scholar] [CrossRef] [PubMed]
  2. Shokri, N.; Hassani, A.; Sahimi, M. Multi-scale soil salinization dynamics from global to pore scale: A review. Rev. Geophys. 2024, 62, e2023RG000804. [Google Scholar] [CrossRef]
  3. Li, S.; Jiang, Y.; Xie, H.X.; Wang, K.W.; Yang, K.B.; Cao, Q.; Xue, H. FvWRKY75 positively regulates FvCRK5 to enhance salt stress tolerance. Plants 2025, 14, 1804. [Google Scholar] [CrossRef]
  4. Nidhi; Iqbal, N.; Khan, N.A. Synergistic effects of phytohormones and membrane transporters in plant salt stress mitigation. Plant Physiol. Biochem. 2025, 221, 109685. [Google Scholar] [CrossRef] [PubMed]
  5. Abdalla, M.A.; Li, F.; Wenzel-Storjohann, A.; Sulieman, S.; Tasdemir, D.; Mühling, K.H. Comparative metabolite profile, biological activity and overall quality of three lettuce (Lactuca sativa L., Asteraceae) cultivars in response to sulfur nutrition. Pharmaceutics 2021, 13, 713. [Google Scholar] [CrossRef]
  6. Barghi, A.; Etemadzadeh, S.S. Role of Bacillus subtilis W1L in mitigating oxidative and osmotic stress in lettuce under drought and salt conditions. Plant Pathol. J. 2025, 41, 709–722. [Google Scholar] [CrossRef] [PubMed]
  7. Hasanuzzaman, M.; Fujita, M. Plant responses and tolerance to salt stress: Physiological and molecular interventions 2.0. Int. J. Mol. Sci. 2023, 24, 15740. [Google Scholar] [CrossRef]
  8. Zhou, H.P.; Shi, H.F.; Yang, Y.Q.; Feng, X.X.; Chen, X.; Xiao, F.; Lin, H.H.; Guo, Y. Insights into plant salt stress signaling and tolerance. J. Genet. Genom. 2024, 51, 16–34. [Google Scholar] [CrossRef]
  9. Per, T.S.; Khan, N.A.; Reddy, P.S.; Masood, A.; Hasanuzzaman, M.; Khan, M.I.R.; Anjum, N.A. Approaches in modulating proline metabolism in plants for salt and drought stress tolerance: Phytohormones, mineral nutrients and transgenics. Plant Physiol. Biochem. 2017, 115, 126–140. [Google Scholar] [CrossRef]
  10. Moukhtari, A.E.; Cabassa-Hourton, C.; Farissi, M.; Savouré, A. How does proline treatment promote salt stress tolerance during crop plant development? Front. Plant Sci. 2020, 11, 1127. [Google Scholar]
  11. Thambiliyagodage, C.; Jayanetti, M.; Mendis, A.; Ekanayake, G.; Liyanaarachchi, H.; Vigneswaran, S. Recent advances in chitosan-based applications—A review. Materials 2023, 16, 2073. [Google Scholar] [CrossRef]
  12. Choulot, M.; Jabbour, C.; Burlot, A.-S.; Jing, L.; Welna, M.; Szymczycha-Madeja, A.; Le Guillard, C.; Michalak, I.; Bourgougnon, N. Application of enzyme-assisted extraction on the brown seaweed Fucus vesiculosus Linnaeus (Ochrophyta, Fucaceae) to produce extracts for a sustainable agriculture. J. Appl. Phycol. 2025, 37, 1325–1340. [Google Scholar] [CrossRef]
  13. Zawada, J.F.; Yin, G.; Steiner, A.R.; Yang, J.; Naresh, A.; Roy, S.M.; Gold, D.S.; Heinsohn, H.G.; Murray, C.J. Microscale to manufacturing scale-up of cell-free cytokine production--a new approach for shortening protein production development timelines. Biotechnol. Bioeng. 2011, 108, 1570–1578. [Google Scholar] [CrossRef]
  14. Consentino, B.B.; Mancuso, F.; Vultaggio, L.; Bellitto, P.; Ntatsi, G.; Cannata, C.; La Placa, G.G.; Mauro, R.P.; La Bella, S.; Sabatino, L. Selenium biofortification and an Ecklonia maxima-based seaweed extract jointly compose curly endive drought stress tolerance in a soilless system. Plants 2026, 15, 170. [Google Scholar] [CrossRef]
  15. Kocira, S.; Szparaga, A.; Hara, P.; Treder, K.; Findura, P.; Bartoš, P.; Filip, M. Biochemical and economical effect of application biostimulants containing seaweed extracts and amino acids as an element of agroecological management of bean cultivation. Sci. Rep. 2020, 10, 17759. [Google Scholar] [CrossRef]
  16. Domingo, G.; Marsoni, M.; Álvarez-Viñas, M.; Torres, M.D.; Domínguez, H.; Vannini, C. The role of protein-rich extracts from Chondrus crispus as biostimulant and in enhancing tolerance to drought stress in tomato plants. Plants 2023, 12, 845. [Google Scholar] [CrossRef]
  17. Abdenaceur, R.; Farida, B.-T.; Mourad, D.; Rima, H.; Zahia, O.; Fatma, S.-H. Effective biofertilizer Trichoderma spp. isolates with enzymatic activity and metabolites enhancing plant growth. Int. Microbiol. 2022, 25, 817–829. [Google Scholar] [CrossRef] [PubMed]
  18. Sun, W.L.; Shahrajabian, M.H.; Guan, L.J. The biocontrol and growth-promoting potential of Penicillium spp. and Trichoderma spp. in sustainable agriculture. Plants 2025, 14, 2007. [Google Scholar] [CrossRef]
  19. Jassim, N.S.; Alhamd, A.D.; Ati, M.A.-Z. Evaluation efficiency of salinity tolerant Trichoderma harzianum for alleviation of salinity stress in date palm (Phoenix dactylifera L.). J. Degrad. Min. Lands Manag. 2025, 12, 7327–7336. [Google Scholar] [CrossRef]
  20. Khan, J.; Ooka, J.J.; Miller, S.A.; Madden, L.V.; Hoitink, H.A.J. Systemic resistance induced by Trichoderma hamatum 382 in cucumber against phytophthora crown rot and leaf blight. Plant Dis. 2004, 88, 280–286. [Google Scholar] [CrossRef] [PubMed]
  21. Zuzunaga-Rosas, J.; Calone, R.; Mircea, D.M.; Shakya, R.; Ibáñez-Asensio, S.; Boscaiu, M.; Fita, A.; Moreno-Ramón, H.; Vicente, O. Mitigation of salt stress in lettuce by a biostimulant that protects the root absorption zone and improves biochemical responses. Front. Plant Sci. 2024, 15, 1341714. [Google Scholar] [CrossRef]
  22. Szymańska, S.; Lis, M.I.; Piernik, A.; Hrynkiewicz, K. Pseudomonas stutzeri and Kushneria marisflavi alleviate salinity stress-associated damages in barley, lettuce, and sunflower. Front. Microbiol. 2022, 13, 788893. [Google Scholar] [CrossRef] [PubMed]
  23. Fedeli, R.; Celletti, S.; Loppi, S. Wood distillate promotes the tolerance of lettuce in extreme salt stress conditions. Plants 2024, 13, 1335. [Google Scholar] [CrossRef]
  24. Zou, P.; Lu, X.L.; Zhao, H.T.; Yuan, Y.; Meng, L.; Zhang, C.S.; Li, Y.Q. Polysaccharides derived from the brown algae Lessonia nigrescens enhance salt stress tolerance to wheat seedlings by enhancing the antioxidant system and modulating intracellular ion concentration. Front. Plant Sci. 2019, 10, 48. [Google Scholar] [CrossRef] [PubMed]
  25. Du, Y.W.; Liu, L.; Feng, N.J.; Zheng, D.F.; Liu, M.L.; Zhou, H.; Deng, P.; Wang, Y.X.; Zhao, H.M. Combined transcriptomic and metabolomic analysis of alginate oligosaccharides alleviating salt stress in rice seedlings. BMC Plant Biol. 2023, 23, 455. [Google Scholar] [CrossRef]
  26. Martin, T.N.; Fipke, G.M.; Minussi Winck, J.E.; Márchese, J.A. ImageJ software as an alternative method for estimating leaf area in oats. Acta Agron. 2020, 69, 162–169. [Google Scholar] [CrossRef]
  27. Cao, K.; Yu, J.; Xu, D.; Ai, K.; Bao, E.; Zou, Z. Exposure to lower red to far-red light ratios improve tomato tolerance to salt stress. BMC Plant Biol. 2018, 18, 92. [Google Scholar] [CrossRef]
  28. Wang, M.L.; Hao, J.; Chen, X.H.; Zhang, X.C. SlMYB102 expression enhances low-temperature stress resistance in tomato plants. PeerJ 2020, 8, e10059. [Google Scholar] [CrossRef]
  29. Rajput, N.A.; Zhang, M.; Ru, Y.; Liu, T.; Xu, J.; Liu, L.; Mafurah, J.J.; Dou, D. Phytophthora sojae effector PsCRN70 suppresses plant defenses in Nicotiana benthamiana. PLoS ONE 2014, 9, e98114. [Google Scholar] [CrossRef]
  30. Li, M.; Guo, P.; Nan, N.; Ma, A.; Liu, W.; Wang, T.J.; Yun, D.J.; Xu, Z.Y. Plasma membrane-localized H+-ATPase OsAHA3 functions in saline-alkaline stress tolerance in rice. Plant Cell Rep. 2023, 43, 9. [Google Scholar] [CrossRef] [PubMed]
  31. Wang, D.M.; Liang, X.X.; Bao, Y.Z.; Yang, S.X.; Zhang, X.; Yu, H.; Zhang, Q.; Xu, G.Y.; Feng, X.Z.; Dou, D.L. A malectin-like receptor kinase regulates cell death and pattern-triggered immunity in soybean. EMBO Rep. 2020, 21, e50442. [Google Scholar] [CrossRef]
  32. Xiang, D.J.; Man, L.L.; Zhang, C.L.; Liu, P.; Li, Z.G.; Zheng, G.C. A new Em-like protein from Lactuca sativa, LsEm1, enhances drought and salt stress tolerance in Escherichia coli and rice. Protoplasma 2018, 255, 1089–1106. [Google Scholar] [CrossRef]
  33. Sawada, Y.; Aoki, M.; Nakaminami, K.; Mitsuhashi, W.; Tatematsu, K.; Kushiro, T.; Koshiba, T.; Kamiya, Y.; Inoue, Y.; Nambara, E.; et al. Phytochrome- and gibberellin-mediated regulation of abscisic acid metabolism during germination of photoblastic lettuce seeds. Plant Physiol. 2008, 146, 1386–1396. [Google Scholar] [CrossRef]
  34. Du, P.; Wu, Q.L.; Liu, Y.H.; Cao, X.; Yi, W.Y.; Jiao, T.K.; Hu, M.Q.; Huang, Y. WRKY transcription factor family in lettuce plant (Lactuca sativa): Genome-wide characterization, chromosome location, phylogeny structures, and expression patterns. PeerJ 2022, 10, e14136. [Google Scholar] [CrossRef] [PubMed]
  35. Mattioli, R.; Falasca, G.; Sabatini, S.; Altamura, M.M.; Costantino, P.; Trovato, M. The proline biosynthetic genes P5CS1 and P5CS2 play overlapping roles in Arabidopsis flower transition but not in embryo development. Physiol. Plant. 2009, 137, 72–85. [Google Scholar] [CrossRef] [PubMed]
  36. Singh, A.; Sharma, M.K.; Sengar, R.S. Osmolytes: Proline metabolism in plants as sensors of abiotic stress. J. Appl. Nat. Sci. 2017, 9, 2079–2092. [Google Scholar] [CrossRef]
  37. Abdelkhalek, A.; Al-Askar, A.A.; Arishi, A.A.; Behiry, S.I. Trichoderma hamatum strain Th23 promotes tomato growth and induces systemic resistance against tobacco mosaic virus. J. Fungi 2022, 8, 228. [Google Scholar] [CrossRef] [PubMed]
  38. Cheng, R.; Zhao, Z.X.; Tang, Y.; Gu, Y.; Chen, G.D.; Sun, Y.D.; Wang, X.Z. Genome-wide survey of KT/HAK/KUP genes in the genus Citrullus and analysis of their involvement in K+-deficiency and drought stress responses in between C. lanatus and C. amarus. BMC Genom. 2024, 25, 836. [Google Scholar] [CrossRef]
  39. Liu, K.; Qin, Y.L.; Wu, L.; Yi, R.; Shi, X.H.; Yu, J.; Shi, X.H.; Dong, W.Z.; Jia, L.G.; Fan, M.S. Genome-wide identification, characterization and expression pattern analysis of HAK/KUP/KT potassium transporter gene family in potato. Front. Plant Sci. 2024, 15, 1487794. [Google Scholar] [CrossRef]
  40. Zhang, J.W.; Huang, D.Z.; Zhao, X.J.; Zhang, M.; Wang, Q.; Hou, X.Y.; Di, D.L.; Su, B.B.; Wang, S.K.; Sun, P. Drought-responsive WRKY transcription factor genes IgWRKY50 and IgWRKY32 from Iris germanica enhance drought resistance in transgenic Arabidopsis. Front. Plant Sci. 2022, 13, 983600. [Google Scholar] [CrossRef]
  41. Benito, P.; Celdrán, M.; Bellón, J.; Arbona, V.; González-Guzmán, M.; Porcel, R.; Yenush, L.; Mulet, J.M. The combination of a microbial and a non-microbial biostimulant increases yield in lettuce (Lactuca sativa) under salt stress conditions by up-regulating cytokinin biosynthesis. J. Integr. Plant Biol. 2024, 66, 2140–2157. [Google Scholar] [CrossRef]
  42. Saha, K.C.; Uddin, M.K.; Shaha, P.K.; Chowdhury, M.A.H.; Hassan, L.; Saha, B.K. Application of Trichoderma harzianum enhances salt tolerance and yield of Indian mustard through increasing antioxidant enzyme activity. Heliyon 2025, 11, e41114. [Google Scholar] [CrossRef]
  43. Ma, Y.; Freitas, H.; Dias, M.C. Strategies and prospects for biostimulants to alleviate abiotic stress in plants. Front. Plant Sci. 2022, 13, 1024243. [Google Scholar] [CrossRef] [PubMed]
  44. Makhaye, G. Physiological and Biochemical Effect of Biostimulants on Abelmoschus esculentus (L.) and Cleome gynandra (L.). Master’s Thesis, University of KwaZulu-Natal, Pietermaritzburg, South Africa, 2021. [Google Scholar]
  45. Mumtaz, M.Z.; Castellane, T.C.L.; Shahid, I.; Tamburini, E.; Bouizgarne, B. Editorial: Plant mineral microbe interactions. Front. Microbiol. 2025, 16, 1677458. [Google Scholar] [CrossRef]
  46. Moustakas, M.; Moustaka, J. Special issue: “Molecular Mechanisms of Plant Biostimulants”. Int. J. Mol. Sci. 2026, 27, 517. [Google Scholar] [CrossRef]
  47. Calabrese, E.J. Biphasic dose responses in biology, toxicology and medicine: Accounting for their generalizability and quantitative features. Environ. Pollut. 2013, 182, 452–460. [Google Scholar] [CrossRef] [PubMed]
  48. Vargas-Hernandez, M.; Macias-Bobadilla, I.; Guevara-Gonzalez, R.G.; Romero-Gomez, S.J.; Rico-Garcia, E.; Ocampo-Velazquez, R.V.; Alvarez-Arquieta, L.L.; Torres-Pacheco, I. Plant hormesis management with biostimulants of biotic origin in agriculture. Front. Plant Sci. 2017, 8, 1762. [Google Scholar] [CrossRef]
  49. Jodynis-Liebert, J.; Kujawska, M. Biphasic dose-response induced by phytochemicals: Experimental evidence. J. Clin. Med. 2020, 9, 718. [Google Scholar] [CrossRef]
  50. Li, Z.S.; Liu, J.; Kuang, M.; Zhang, C.J.; Ma, Q.F.; Huang, L.Y.; Wang, H.Y.; Fan, S.L.; Peng, J. Improvement of plant tolerance to drought stress by cotton tubby-like protein 30 through stomatal movement regulation. J. Adv. Res. 2022, 42, 55–67. [Google Scholar] [CrossRef] [PubMed]
  51. Ait-El-Mokhtar, M.; Meddich, A.; Baslam, M. Biostimulants for climate-smart and sustainable agriculture. Front. Sustain. Food Syst. 2024, 8, 1405177. [Google Scholar] [CrossRef]
  52. Qin, Y.X.; Tian, Y.C.; Liu, X.Z. A wheat salinity-induced WRKY transcription factor TaWRKY93 confers multiple abiotic stress tolerance in Arabidopsis thaliana. Biochem. Biophys. Res. Commun. 2015, 464, 428–433. [Google Scholar] [CrossRef]
  53. du Jardin, P.; Xu, L.; Geelen, D. Agricultural functions and action mechanisms of plant biostimulants (PBs)—An introduction. Chem. Biol. Plant Biostimul. 2020, 1–30. [Google Scholar] [CrossRef]
  54. Ronga, D.; Biazzi, E.; Parati, K.; Carminati, D.; Carminati, E.; Tava, A. Microalgal biostimulants and biofertilisers in crop productions. Agronomy 2019, 9, 192. [Google Scholar] [CrossRef]
  55. González-Morales, S.; Solís-Gaona, S.; Valdés-Caballero, M.V.; Juárez-Maldonado, A.; Loredo-Treviño, A.; Benavides-Mendoza, A. Transcriptomics of biostimulation of plants under abiotic stress. Front. Genet. 2021, 12, 583888. [Google Scholar] [CrossRef] [PubMed]
  56. Nawaz, F.; Majeed, S.; Farman, M.; Sheteiwy, M.S.; Al-Mamun, A.; Nawaz, M.; Neumann, G. Biostimulants as regulators of stress metabolites to enhance drought and salinity stress tolerance in plants. In Biostimulants for Crop Production and Sustainable Agriculture; CABI: Wallingford, UK, 2022; pp. 265–294. [Google Scholar]
  57. Ortíz-Castro, R.; Contreras-Cornejo, H.A.; Macías-Rodríguez, L.; López-Bucio, J. The role of microbial signals in plant growth and development. Plant Signal. Behav. 2009, 4, 701–712. [Google Scholar] [CrossRef]
  58. Delgado, C.; Mora-Poblete, F.; Ahmar, S.; Chen, J.-T.; Figueroa, C.R. Jasmonates and plant salt stress: Molecular players, physiological effects, and Improving tolerance by using genome-associated tools. Int. J. Mol. Sci. 2021, 22, 3082. [Google Scholar] [CrossRef] [PubMed]
  59. Boller, T.; Flury, P. Peptides as danger signals: MAMPs and DAMPs. In Plant Signaling Peptides; Springer: Berlin/Heidelberg, Germany, 2012; pp. 163–181. [Google Scholar]
  60. Choi, H.W.; Klessig, D.F. DAMPs, MAMPs, and NAMPs in plant innate immunity. BMC Plant Biol. 2016, 16, 232. [Google Scholar] [CrossRef]
  61. Maan, P.K.; Garcha, S. Production technology, properties, and quality management. In Biofertilizers; Woodhead Publishing: London, UK, 2021; pp. 31–43. [Google Scholar]
  62. Kejariwal, M. Microbial inoculants: Recent advances and applications. In Microbial Inoculants; Academic Press: Cambridge, MA, USA, 2025; pp. 1–21. [Google Scholar]
  63. Boorboori, M.R.; Zhang, H. The mechanisms of Trichoderma species to reduce drought and salinity stress in plants. Phyton 2023, 92, 2261–2281. [Google Scholar] [CrossRef]
  64. Abd El-Baki, G.K.; Mostafa, D. The potentiality of Trichoderma harzianum in alleviation the adverse effects of salinity in faba bean plants. Acta Biol. Hung 2014, 65, 451–468. [Google Scholar] [CrossRef]
  65. Gandhi, A.; Reichelt, M.; Goyal, D.; Vadassery, J.; Oelmüller, R. Trichoderma harzianum protects the Arabidopsis salt overly sensitive 1 mutant against salt stress. J. Plant Growth Regul. 2025, 44, 7019–7039. [Google Scholar] [CrossRef]
  66. Lu, Q.; Jin, L.F.; Tong, C.L.; Liu, F.; Huang, B.; Zhang, D.J. Research progress on the growth-promoting effect of plant biostimulants on crops. Phyton 2024, 93, 661–679. [Google Scholar] [CrossRef]
Cimb 48 00188 g001
Figure 1. Effect of YF on plant height and stem diameter of lettuce. (A) Plant height under no salt stress. (B) Plant height under salt stress (200 mM NaCl). (C) Stem diameter under no salt stress. (D) Stem diameter under salt stress. CK was the water control; YF-1: 0.05 mg/L YF; YF-2: 0.10 mg/L YF; YF-3: 0.25 mg/L YF; AOS: alginate oligosaccharides (15 mg/L, positive control). Data are presented as mean ± SE (n = 5). Different lowercase letters indicate significant differences among treatments within each panel (p < 0.05, one-way ANOVA). Absolute values are available in Supplementary Table S1.
Figure 1. Effect of YF on plant height and stem diameter of lettuce. (A) Plant height under no salt stress. (B) Plant height under salt stress (200 mM NaCl). (C) Stem diameter under no salt stress. (D) Stem diameter under salt stress. CK was the water control; YF-1: 0.05 mg/L YF; YF-2: 0.10 mg/L YF; YF-3: 0.25 mg/L YF; AOS: alginate oligosaccharides (15 mg/L, positive control). Data are presented as mean ± SE (n = 5). Different lowercase letters indicate significant differences among treatments within each panel (p < 0.05, one-way ANOVA). Absolute values are available in Supplementary Table S1.
Cimb 48 00188 g001
Cimb 48 00188 g002
Figure 2. Effect of YF on canopy width and phenotype of lettuce. (A) Canopy width under no salt stress. (B) Canopy width under salt stress. (C) Representative canopy phenotype images of lettuce plants after 35 days of treatment for the indicated treatments. Scale Bars = 5 cm. Treatment abbreviations are as defined in Figure 1. Data in (A,B) are presented as mean ± SE (n = 5). Different letters indicate significant differences (p < 0.05, one-way ANOVA). Absolute values are available in Supplementary Table S1.
Figure 2. Effect of YF on canopy width and phenotype of lettuce. (A) Canopy width under no salt stress. (B) Canopy width under salt stress. (C) Representative canopy phenotype images of lettuce plants after 35 days of treatment for the indicated treatments. Scale Bars = 5 cm. Treatment abbreviations are as defined in Figure 1. Data in (A,B) are presented as mean ± SE (n = 5). Different letters indicate significant differences (p < 0.05, one-way ANOVA). Absolute values are available in Supplementary Table S1.
Cimb 48 00188 g002
Cimb 48 00188 g003
Figure 3. Effects of YF on root number and total leaf area of lettuce. (A) Number of roots under no salt stress. (B) Number of roots under salt stress. (C) Total leaf area under no salt stress. (D) Total leaf area under salt stress. Treatment abbreviations are as defined in Figure 1. Values represent mean ± SE (n = 5). Different letters indicate significant differences (p < 0.05, one-way ANOVA). Absolute values are provided in Supplementary Table S1.
Figure 3. Effects of YF on root number and total leaf area of lettuce. (A) Number of roots under no salt stress. (B) Number of roots under salt stress. (C) Total leaf area under no salt stress. (D) Total leaf area under salt stress. Treatment abbreviations are as defined in Figure 1. Values represent mean ± SE (n = 5). Different letters indicate significant differences (p < 0.05, one-way ANOVA). Absolute values are provided in Supplementary Table S1.
Cimb 48 00188 g003
Cimb 48 00188 g004
Figure 4. Effects of YF on the leaf number of lettuce. (A) Number of leaves under no salt stress. (B) Number of leaves under salt stress. (C) Representative images of leaves after 35 days of treatment. Scale Bars = 5 cm. Treatment abbreviations are as defined in Figure 1. Values represent mean ± SE (n = 5). Different letters indicate significant differences (p < 0.05 one-way ANOVA). Absolute values are provided in Supplementary Table S1.
Figure 4. Effects of YF on the leaf number of lettuce. (A) Number of leaves under no salt stress. (B) Number of leaves under salt stress. (C) Representative images of leaves after 35 days of treatment. Scale Bars = 5 cm. Treatment abbreviations are as defined in Figure 1. Values represent mean ± SE (n = 5). Different letters indicate significant differences (p < 0.05 one-way ANOVA). Absolute values are provided in Supplementary Table S1.
Cimb 48 00188 g004
Cimb 48 00188 g005
Figure 5. Effect of YF on the biomass accumulation of lettuce. (A) Aboveground fresh weight under no salt stress. (B) Aboveground fresh weight under salt stress. (C) Belowground fresh weight under no salt stress. (D) Belowground fresh weight under salt stress. (E) Total fresh weight under different no salt stress. (F) Total fresh weight under salt stress. Treatment abbreviations are as defined in Figure 1. Data are presented as mean ± SE (n = 5). Different letters indicate significant differences (p < 0.05, one-way ANOVA). Absolute values and corresponding percentage changes relative to controls are detailed in Supplementary Table S2.
Figure 5. Effect of YF on the biomass accumulation of lettuce. (A) Aboveground fresh weight under no salt stress. (B) Aboveground fresh weight under salt stress. (C) Belowground fresh weight under no salt stress. (D) Belowground fresh weight under salt stress. (E) Total fresh weight under different no salt stress. (F) Total fresh weight under salt stress. Treatment abbreviations are as defined in Figure 1. Data are presented as mean ± SE (n = 5). Different letters indicate significant differences (p < 0.05, one-way ANOVA). Absolute values and corresponding percentage changes relative to controls are detailed in Supplementary Table S2.
Cimb 48 00188 g005
Cimb 48 00188 g006
Figure 6. Effects of different concentrations of YF on physiological and biochemical indicators of lettuce. (A) Relative electrical conductivity (%) of leaves under no salt stress. (B) Relative electrical conductivity (%) under salt stress. (C) Malondialdehyde (MDA) content (nmol/g fresh weight) under no salt stress. (D) MDA content under salt stress. (E) Proline content (µg/g fresh weight) under no salt stress. (F) Proline content under salt stress. Treatment abbreviations are as defined in Figure 1. Data are presented as mean ± SE (n = 5). Different letters indicate significant differences (p < 0.05, one-way ANOVA). Absolute values and corresponding percentage changes relative to controls are detailed in Supplementary Table S3.
Figure 6. Effects of different concentrations of YF on physiological and biochemical indicators of lettuce. (A) Relative electrical conductivity (%) of leaves under no salt stress. (B) Relative electrical conductivity (%) under salt stress. (C) Malondialdehyde (MDA) content (nmol/g fresh weight) under no salt stress. (D) MDA content under salt stress. (E) Proline content (µg/g fresh weight) under no salt stress. (F) Proline content under salt stress. Treatment abbreviations are as defined in Figure 1. Data are presented as mean ± SE (n = 5). Different letters indicate significant differences (p < 0.05, one-way ANOVA). Absolute values and corresponding percentage changes relative to controls are detailed in Supplementary Table S3.
Cimb 48 00188 g006
Cimb 48 00188 g007
Figure 7. Histochemical staining and quantitative analysis of oxidative damage and cell viability in lettuce leaves after 35 days of YF treatment under normal and salt stress conditions. (A) DAB staining for hydrogen peroxide (H2O2) accumulation in lettuce leaves. Brown coloration indicates H2O2 accumulation. Upper panel: non-salt conditions; lower panel: salt stress (200 mM NaCl). (B) Quantitative analysis of DAB staining intensity shown as relative optical density. (C) Trypan blue staining for cell viability. Blue staining indicates dead cells. Layout as in (A). (D) Quantitative analysis of trypan blue staining intensity. Treatment abbreviations: CK: water control; YF-1: 0.05 mg/L YF; YF-2: 0.10 mg/L YF; YF-3: 0.25 mg/L YF. Data are presented as mean ± SE (n = 3). Different lowercase letters indicate statistically significant differences among treatments within the same NaCl condition (p < 0.05, one-way ANOVA with Tukey’s HSD test). Scale bars in (A,C) = 1 cm.
Figure 7. Histochemical staining and quantitative analysis of oxidative damage and cell viability in lettuce leaves after 35 days of YF treatment under normal and salt stress conditions. (A) DAB staining for hydrogen peroxide (H2O2) accumulation in lettuce leaves. Brown coloration indicates H2O2 accumulation. Upper panel: non-salt conditions; lower panel: salt stress (200 mM NaCl). (B) Quantitative analysis of DAB staining intensity shown as relative optical density. (C) Trypan blue staining for cell viability. Blue staining indicates dead cells. Layout as in (A). (D) Quantitative analysis of trypan blue staining intensity. Treatment abbreviations: CK: water control; YF-1: 0.05 mg/L YF; YF-2: 0.10 mg/L YF; YF-3: 0.25 mg/L YF. Data are presented as mean ± SE (n = 3). Different lowercase letters indicate statistically significant differences among treatments within the same NaCl condition (p < 0.05, one-way ANOVA with Tukey’s HSD test). Scale bars in (A,C) = 1 cm.
Cimb 48 00188 g007
Cimb 48 00188 g008
Figure 8. The Effect of YF on the Expression of Stress-Related Genes in Lettuce. (A) The relative expression level of NCED1 after YF treatment at different concentrations under non-salt stress conditions. (B) The expression level of NCED1 after YF treatment under salt stress. (C) The expression level of NCED2 after YF treatment under non-salt stress conditions. (D) The expression level of NCED2 after YF treatment under salt stress. (E) The expression level of WRKY58 after YF treatment under non-salt stress conditions. (F) The expression level of WRKY58 after YF treatment under salt stress. Treatment abbreviations are as defined in Figure 1. Data are presented as mean ± SE (n = 5). Different letters indicate significant differences (p < 0.05, one-way ANOVA).
Figure 8. The Effect of YF on the Expression of Stress-Related Genes in Lettuce. (A) The relative expression level of NCED1 after YF treatment at different concentrations under non-salt stress conditions. (B) The expression level of NCED1 after YF treatment under salt stress. (C) The expression level of NCED2 after YF treatment under non-salt stress conditions. (D) The expression level of NCED2 after YF treatment under salt stress. (E) The expression level of WRKY58 after YF treatment under non-salt stress conditions. (F) The expression level of WRKY58 after YF treatment under salt stress. Treatment abbreviations are as defined in Figure 1. Data are presented as mean ± SE (n = 5). Different letters indicate significant differences (p < 0.05, one-way ANOVA).
Cimb 48 00188 g008
Cimb 48 00188 g009
Figure 9. The Effect of YF Treatment on the Expression of Key Rate-Limiting Enzyme Genes Involved in Proline Synthesis in Lettuce. (A) The expression level of P5CS1 after YF treatment under non-salt stress conditions. (B) The expression level of P5CS1 after YF treatment under salt stress. (C) The expression level of P5CS2 after YF treatment under non-salt stress conditions. (D) The expression level of P5CS2 after YF treatment under salt stress. (E) The expression level of P5CS4 after YF treatment under non-salt stress conditions. (F) The expression level of P5CS4 after YF treatment under salt stress. Treatment abbreviations are as defined in Figure 1. Data are presented as mean ± SE (n = 5). Different letters indicate significant differences (p < 0.05, one-way ANOVA).
Figure 9. The Effect of YF Treatment on the Expression of Key Rate-Limiting Enzyme Genes Involved in Proline Synthesis in Lettuce. (A) The expression level of P5CS1 after YF treatment under non-salt stress conditions. (B) The expression level of P5CS1 after YF treatment under salt stress. (C) The expression level of P5CS2 after YF treatment under non-salt stress conditions. (D) The expression level of P5CS2 after YF treatment under salt stress. (E) The expression level of P5CS4 after YF treatment under non-salt stress conditions. (F) The expression level of P5CS4 after YF treatment under salt stress. Treatment abbreviations are as defined in Figure 1. Data are presented as mean ± SE (n = 5). Different letters indicate significant differences (p < 0.05, one-way ANOVA).
Cimb 48 00188 g009
Table 1. Treatments for the experiment.
Table 1. Treatments for the experiment.
Experimental GroupsBiostimulant Concentration (mg/L)NaCl Concentration (mM)Biological Replicates
CK-H2O-05
YF-10.0505
YF-20.1005
YF-30.2505
AOS15.0005
CK-NaCl-200 5
YF-1+NaCl0.05200 5
YF-2+NaCl0.102005
YF-3+NaCl0.252005
AOS+NaCl15.002005
Table 2. This Primer sequence for qRT-PCR.
Table 2. This Primer sequence for qRT-PCR.
Primer NamesPrimer Sequences (5′-3′)
Actin-FGCACCCTGTTCTTCTCAC
Actin-RTACGACCACTGGCATAGA
NCED1-FAAACCCTACAATCCGACTATTCG
NCED1-RGGCCGCAGCTCTTTGTAAG
NCED2-FCTTCAGTTTCCTAAACAGTCTGTTGGTA
NCED2-RTGCTTTCAATCCATCTTCAACG
WRKY58-FCATTACCATTACCATCGTCATCATC
WRKY58-RTCGTTACCATCGGAAGTGCTA
P5CS1-FCTGATGCACTGGAAGCAAATG
P5CS1-RAAGAGCCAACCGAGATACTAATG
P5CS2-FGCATCCAATGCGGCTTATTC
P5CS2-RGTACCCACACGTTCTCCATTTA
P5CS4-FTCACTCGAGAAGACGGAAGA
P5CS4-RGCACCTGATGAGACCAAGATAA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhan, X.; Hao, C.; Liu, J.; Wang, Q.; Yang, M.; Li, R.; Chen, L.; Cui, D. A Trichoderma hamatum Biostimulant Modulates Physiology and Gene Expression to Enhance Lettuce Salt Tolerance. Curr. Issues Mol. Biol. 2026, 48, 188. https://doi.org/10.3390/cimb48020188

AMA Style

Zhan X, Hao C, Liu J, Wang Q, Yang M, Li R, Chen L, Cui D. A Trichoderma hamatum Biostimulant Modulates Physiology and Gene Expression to Enhance Lettuce Salt Tolerance. Current Issues in Molecular Biology. 2026; 48(2):188. https://doi.org/10.3390/cimb48020188

Chicago/Turabian Style

Zhan, Xinxin, Cuihong Hao, Jing Liu, Qingbin Wang, Mingjing Yang, Ruxin Li, Lihong Chen, and Dayong Cui. 2026. "A Trichoderma hamatum Biostimulant Modulates Physiology and Gene Expression to Enhance Lettuce Salt Tolerance" Current Issues in Molecular Biology 48, no. 2: 188. https://doi.org/10.3390/cimb48020188

APA Style

Zhan, X., Hao, C., Liu, J., Wang, Q., Yang, M., Li, R., Chen, L., & Cui, D. (2026). A Trichoderma hamatum Biostimulant Modulates Physiology and Gene Expression to Enhance Lettuce Salt Tolerance. Current Issues in Molecular Biology, 48(2), 188. https://doi.org/10.3390/cimb48020188

Article Metrics

Back to TopTop