p53 Protein Stability Plays a Crucial Role in NaB-Mediated Apoptosis in Colorectal Cancer Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. MTT Assay and Cell Proliferation Assay
2.3. Colony-Forming Assay
2.4. RNA Isolation, RT-PCR, and Quantitative RT-PCR (qPCR)
2.5. Western Blotting
2.6. Immune Fluorescence (IF) Staining
2.7. Cycloheximide (CHX) Treatment
2.8. Annexin V-FITC Apoptosis Detection by Flow Cytometry
2.9. Immunoprecipitation (IP)
2.10. Statistical Analysis
3. Results
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sawicki, T.; Ruszkowska, M.; Danielewicz, A.; Niedźwiedzka, E.; Arłukowicz, T.; Przybyłowicz, K.E. A review of colorectal cancer in terms of epidemiology, risk factors, development, symptoms and diagnosis. Cancers 2021, 13, 2025. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rogler, G. Chronic ulcerative colitis and colorectal cancer. Cancer Lett. 2014, 345, 235–241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giovannucci, E. An updated review of the epidemiological evidence that cigarette smoking increases risk of colorectal cancer. Cancer Epidemiol. Biomark. Prev. 2001, 10, 725–731. [Google Scholar]
- Johnson, C.M.; Wei, C.; Ensor, J.E.; Smolenski, D.J.; Amos, C.I.; Levin, B.; Berry, D.A. Meta-analyses of colorectal cancer risk factors. Cancer Causes Control 2013, 24, 1207–1222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arnold, M.; Sierra, M.S.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global patterns and trends in colorectal cancer incidence and mortality. Gut 2017, 66, 683–691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bardou, M.; Barkun, A.N.; Martel, M. Obesity and colorectal cancer. Gut 2013, 62, 933–947. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Larsson, S.C.; Orsini, N.; Wolk, A. Diabetes mellitus and risk of colorectal cancer: A meta-analysis. J. Natl. Cancer Inst. 2005, 97, 1679–1687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takayama, T.; Miyanishi, K.; Hayashi, T.; Sato, Y.; Niitsu, Y. Colorectal cancer: Genetics of development and metastasis. J. Gastroenterol. 2006, 41, 185–192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iacopetta, B. TP53 mutation in colorectal cancer. Hum. Mutat. 2003, 21, 271–276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ham, S.W.; Jeon, H.Y.; Jin, X.; Kim, E.J.; Kim, J.K.; Shin, Y.J.; Lee, Y.; Kim, S.H.; Lee, S.Y.; Seo, S.; et al. TP53 gain-of-function mutation promotes inflammation in glioblastoma. Cell Death Differ. 2019, 26, 409–425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Zhang, Y.; Li, X.; Yi, S.; Xu, J. Gain-of-function mutations: An emerging advantage for cancer biology. Trends Biochem. Sci. 2019, 44, 659–674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, X.; Yun, C.; Pang, Y.; Qiao, J. The impact of the gut microbiota on the reproductive and metabolic endocrine system. Gut Microbes 2021, 13, 1894070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carding, S.; Verbeke, K.; Vipond, D.T.; Corfe, B.M.; Owen, L.J. Dysbiosis of the gut microbiota in disease. Microb. Ecol. Health Dis. 2015, 26, 26191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fröhlich, E.E.; Farzi, A.; Mayerhofer, R.; Reichmann, F.; Jačan, A.; Wagner, B.; Zinser, E.; Bordag, N.; Magnes, C.; Fröhlich, E.; et al. Cognitive impairment by antibiotic-induced gut dysbiosis: Analysis of gut microbiota-brain communication. Brain Behav. Immun. 2016, 56, 140–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, Q.; Gao, R.; Zhang, Y.; Pan, D.; Zhu, Y.; Zhang, X.; Yang, R.; Jiang, R.; Xu, Y.; Qin, H. Dysbiosis signatures of gut microbiota in coronary artery disease. Physiol. Genom. 2018, 50, 893–903. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, W.T.; Kantilal, H.K.; Davamani, F. The mechanism of Bacteroides fragilis toxin contributes to colon cancer formation. Malays. J. Med. Sci. MJMS 2020, 27, 9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, D.; Jin, D.; Huang, S.; Wu, J.; Xu, M.; Liu, T.; Dong, W.; Liu, X.; Wang, S.; Zhong, W.; et al. Clostridium butyricum, a butyrate-producing probiotic, inhibits intestinal tumor development through modulating Wnt signaling and gut microbiota. Cancer Lett. 2020, 469, 456–467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Z.F.; Ai, L.Y.; Wang, J.L.; Ren, L.L.; Yu, Y.N.; Xu, J.; Chen, H.Y.; Yu, J.; Li, M.; Qin, W.X.; et al. Probiotics Clostridium butyricum and Bacillus subtilis ameliorate intestinal tumorigenesis. Future Microbiol. 2015, 10, 1433–1445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, J.; Li, Q.; Fu, X. Fusobacterium nucleatum contributes to the carcinogenesis of colorectal cancer by inducing inflammation and suppressing host immunity. Transl. Oncol. 2019, 12, 846–851. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hashemi Goradel, N.; Heidarzadeh, S.; Jahangiri, S.; Farhood, B.; Mortezaee, K.; Khanlarkhani, N.; Negahdari, B. Fusobacterium nucleatum and colorectal cancer: A mechanistic overview. J. Cell. Physiol. 2019, 234, 2337–2344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ullman, T.A.; Itzkowitz, S.H. Intestinal inflammation and cancer. Gastroenterology 2011, 140, 1807–1816. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mirzaei, R.; Afaghi, A.; Babakhani, S.; Sohrabi, M.R.; Hosseini-Fard, S.R.; Babolhavaeji, K.; Akbari, S.K.; Yousefimashouf, R.; Karampoor, S. Role of microbiota-derived short-chain fatty acids in cancer development and prevention. Biomed. Pharmacother. 2021, 139, 111619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, X.; Wu, Y.; He, L.; Wu, L.; Wang, X.; Liu, Z. Effects of the intestinal microbial metabolite butyrate on the development of colorectal cancer. J. Cancer 2018, 9, 2510. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aoyama, M.; Kotani, J.; Usami, M. Butyrate and propionate induced activated or non-activated neutrophil apoptosis via HDAC inhibitor activity but without activating GPR-41/GPR-43 pathways. Nutrition 2010, 26, 653–661. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rahman, M.M.; Kukita, A.; Kukita, T.; Shobuike, T.; Nakamura, T.; Kohashi, O. Two histone deacetylase inhibitors, trichostatin A and sodium butyrate, suppress differentiation into osteoclasts but not into macrophages. Blood J. Am. Soc. Hematol. 2003, 101, 3451–3459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kadosh, E.; Snir-Alkalay, I.; Venkatachalam, A.; May, S.; Lasry, A.; Elyada, E.; Zinger, A.; Shaham, M.; Vaalani, G.; Mernberger, M.; et al. The gut microbiome switches mutant p53 from tumour-suppressive to oncogenic. Nature 2020, 586, 133–138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, S.; Cheng, A.C.; Wang, M.S.; Peng, X. Detection of apoptosis induced by new type gosling viral enteritis virus in vitro through fluorescein annexin V-FITC/PI double labeling. World J. Gastroenterol. WJG 2008, 14, 2174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brown, A.J.; Goldsworthy, S.M.; Barnes, A.A.; Eilert, M.M.; Tcheang, L.; Daniels, D.; Muir, A.I.; Wigglesworth, M.J.; Kinghorn, I.; Fraser, N.J.; et al. The Orphan G protein-coupled receptors GPR41 and GPR43 are activated by propionate and other short chain carboxylic acids. J. Biol. Chem. 2003, 278, 11312–11319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le Poul, E.; Loison, C.; Struyf, S.; Springael, J.Y.; Lannoy, V.; Decobecq, M.E.; Brezillon, S.; Dupriez, V.; Vassart, G.; Van Damme, J.; et al. Functional characterization of human receptors for short chain fatty acids their role in polymorphonuclear cell activation. J. Biol. Chem. 2003, 278, 25481–25489. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bhutia, Y.D.; Ogura, J.; Sivaprakasam, S.; Ganapathy, V. Gut microbiome and colon cancer: Role of bacterial metabolites and their molecular targets in the host. Curr. Color. Cancer Rep. 2017, 13, 111–118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuo, L.J.; Yang, L.X. γ-H2AX-a novel biomarker for DNA double-strand breaks. In Vivo 2008, 22, 305–309. [Google Scholar] [PubMed]
- Lee, J.M.; Bernstein, A. Apoptosis, cancer and the p53 tumour suppressor gene. Cancer Metastasis Rev. 1995, 14, 149–161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soussi, T. The p53 tumor suppressor gene: From molecular biology to clinical investigation. Ann. New York Acad. Sci. 2000, 910, 121–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brooks, C.L.; Gu, W. Ubiquitination, phosphorylation and acetylation: The molecular basis for p53 regulation. Curr. Opin. Cell Biol. 2003, 15, 164–171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashcroft, M.; Kubbutat, M.H.; Vousden, K.H. Regulation of p53 function and stability by phosphorylation. Mol. Cell. Biol. 1999, 19, 1751–1758. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chuikov, S.; Kurash, J.K.; Wilson, J.R.; Xiao, B.; Justin, N.; Ivanov, G.S.; McKinney, K.; Tempst, P.; Prives, C.; Gamblin, S.J.; et al. Regulation of p53 activity through lysine methylation. Nature 2004, 432, 353–360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Swiatkowska, A.; Zydowicz, P.; Gorska, A.; Suchacka, J.; Dutkiewicz, M.; Ciesiołka, J. The role of structural elements of the 5′-terminal region of p53 mRNA in translation under stress conditions assayed by the antisense oligonucleotide approach. PLoS ONE 2015, 10, e0141676. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Machiels, K.; Joossens, M.; Sabino, J.; De Preter, V.; Arijs, I.; Eeckhaut, V.; Ballet, V.; Claes, K.; Van Immerseel, F.; Verbeke, K.; et al. A decrease of the butyrate-producing species Roseburia hominis and Faecalibacterium prausnitzii defines dysbiosis in patients with ulcerative colitis. Gut 2014, 63, 1275–1283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duncan, S.H.; Holtrop, G.; Lobley, G.E.; Calder, A.G.; Stewart, C.S.; Flint, H.J. Contribution of acetate to butyrate formation by human faecal bacteria. Br. J. Nutr. 2004, 91, 915–923. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kopečný, J.; Zorec, M.; Mrazek, J.; Kobayashi, Y.; Marinsěk-Logar, R. Butyrivibrio hungatei sp. nov. and Pseudobutyrivibrio xylanivorans sp. nov., butyrate-producing bacteria from the rumen. Int. J. Syst. Evol. Microbiol. 2003, 53, 201–209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duncan, S.H.; Hold, G.L.; Barcenilla, A.; Stewart, C.S.; Flint, H.J. Roseburia intestinalis sp. nov., a novel saccharolytic, butyrate-producing bacterium from human faeces. Int. J. Syst. Evol. Microbiol. 2002, 52, 1615–1620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, N.; Gurav, A.; Sivaprakasam, S.; Brady, E.; Padia, R.; Shi, H.; Thangaraju, M.; Prasad, P.D.; Manicassamy, S.; Munn, D.H.; et al. Activation of Gpr109a, receptor for niacin and the commensal metabolite butyrate, suppresses colonic inflammation and carcinogenesis. Immunity 2014, 40, 128–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Felizardo, R.J.; de Almeida, D.C.; Pereira, R.L.; Watanabe, I.K.; Doimo, N.T.; Ribeiro, W.R.; Cenedeze, M.A.; Hiyane, M.I.; Amano, M.T.; Braga, T.T.; et al. Gut microbial metabolite butyrate protects against proteinuric kidney disease through epigenetic-and GPR109a-mediated mechanisms. FASEB J. 2019, 33, 11894–11908. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ibrahim, J.N.; El-Hakim, S.; Semaan, J.; Ghosn, S.; El Ayoubi, H.; Elnar, A.A.; Tohme, N.; El Boustany, C. Sodium butyrate (NaB) and sodium propionate (NaP) reduce cyclin A2 expression, inducing cell cycle arrest and proliferation inhibition of different breast cancer subtypes, leading to apoptosis. Biomedicines 2024, 12, 1779. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thangaraju, M.; Cresci, G.A.; Liu, K.; Ananth, S.; Gnanaprakasam, J.P.; Browning, D.D.; Mellinger, J.D.; Smith, S.B.; Digby, G.J.; Lambert, N.A.; et al. GPR109A is a G-protein–coupled receptor for the bacterial fermentation product butyrate and functions as a tumor suppressor in colon. Cancer Res. 2009, 69, 2826–2832. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.; Zhao, K.N.; Vitetta, L. Effects of intestinal microbial–elaborated butyrate on oncogenic signaling pathways. Nutrients 2019, 11, 1026. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, C.; Huang, L.; Xiong, J.; Xie, L.; Ying, S.; Jia, Y.; Yao, Y.; Song, X.; Zeng, Z.; Yuan, J. Isoalantolactone inhibits pancreatic cancer proliferation by regulation of PI3K and Wnt signal pathway. PLoS ONE 2021, 16, e0247752. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Williams, A.B.; Schumacher, B. p53 in the DNA-damage-repair process. Cold Spring Harb. Perspect. Med. 2016, 6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marine, J.C.; Lozano, G. Mdm2-mediated ubiquitylation: p53 and beyond. Cell Death Differ. 2010, 17, 93–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lill, N.L.; Grossman, S.R.; Ginsberg, D.; DeCaprio, J.; Livingston, D.M. Binding and modulation of p53 by p300/CBP coactivators. Nature 1997, 387, 823–827. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Joseph, J.; Mudduluru, G.; Antony, S.; Vashistha, S.; Ajitkumar, P.; Somasundaram, K. Expression profiling of sodium butyrate (NaB)-treated cells: Identification of regulation of genes related to cytokine signaling and cancer metastasis by NaB. Oncogenomics 2004, 23, 6304–6315. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene Name | Forward | Reverse |
|---|---|---|
| GPR109a | ggacaactatgtgaggcgttgg | gggctggagaagtagtacacc |
| GPR43 | gtagctaacacaagtccagtcct | ctaggtgttgctttgaagcttgt |
| GPR41 | acctgctggccctggtg | ggtcaggttgagcaggagca |
| TP53 | gctctgactgtaccaccatcc | ctctcggaacatctagaagcg |
| CDKN1A | tgccgaagtcagttccttgt | cattagcgcatcacagtcgc |
| ACTB | caagagatggccacggctgct | tccttctgcatcctgtcggca |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, J.Y.; Kim, H. p53 Protein Stability Plays a Crucial Role in NaB-Mediated Apoptosis in Colorectal Cancer Cells. Curr. Issues Mol. Biol. 2025, 47, 579. https://doi.org/10.3390/cimb47080579
Lee JY, Kim H. p53 Protein Stability Plays a Crucial Role in NaB-Mediated Apoptosis in Colorectal Cancer Cells. Current Issues in Molecular Biology. 2025; 47(8):579. https://doi.org/10.3390/cimb47080579
Chicago/Turabian StyleLee, Jeong Yeon, and Hyunju Kim. 2025. "p53 Protein Stability Plays a Crucial Role in NaB-Mediated Apoptosis in Colorectal Cancer Cells" Current Issues in Molecular Biology 47, no. 8: 579. https://doi.org/10.3390/cimb47080579
APA StyleLee, J. Y., & Kim, H. (2025). p53 Protein Stability Plays a Crucial Role in NaB-Mediated Apoptosis in Colorectal Cancer Cells. Current Issues in Molecular Biology, 47(8), 579. https://doi.org/10.3390/cimb47080579
