Next Article in Journal
Epigenetic Mechanisms in Apis melifera: From Development to Environmental Adaptation
Previous Article in Journal
A Novel Hypoxia-Immune Signature for Gastric Cancer Prognosis and Immunotherapy: Insights from Bulk and Single-Cell RNA-Seq
Previous Article in Special Issue
Integrating Artificial Intelligence in Next-Generation Sequencing: Advances, Challenges, and Future Directions
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
CIMB
Volume 47
Issue 7
10.3390/cimb47070553
cimb-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Assembly and Comparative Analysis of Complete Mitochondrial Genome Sequence of Endangered Medicinal Plant Trichopus zeylanicus

by
Biju Vadakkemukadiyil Chellappan
1,*,
P. R. Shidhi
2,
Anu Sasi
3,
Rashid Ismael Hag Ibrahim
1 and
Hamad Abu Zahra
1
1
Department of Biological Sciences, College of Science, King Faisal University, P.O. Box 420, Al-Ahsa 31982, Saudi Arabia
2
Department of Zoology, University of Kerala, Kariyavattom Campus, Thiruvananthapuram 695581, Kerala, India
3
Department of Computational Biology and Bioinformatics, University of Kerala, Kariyavattom Campus, Thiruvananthapuram 695581, Kerala, India
*
Author to whom correspondence should be addressed.
Curr. Issues Mol. Biol. 2025, 47(7), 553; https://doi.org/10.3390/cimb47070553
Submission received: 13 June 2025 / Revised: 8 July 2025 / Accepted: 10 July 2025 / Published: 16 July 2025
(This article belongs to the Special Issue Technological Advances Around Next-Generation Sequencing Application)
Browse Figures
Versions Notes

Abstract

Plant mitochondrial genomes exhibit extensive size variability and structural complexity. Here, we report the complete mitochondrial genome of Trichopus zeylanicus, an endemic medicinal plant from the Western Ghats. The mitochondrial genome was assembled using a combination of Illumina short-read and PacBio long-read sequencing technologies, followed by extensive annotation and comparative analysis. The circular mitogenome spans 709,127 bp with a GC content of 46%, encoding 32 protein-coding genes, 17 tRNAs, and three rRNAs. Comparative analysis with other monocot mitochondrial genomes revealed conserved gene clusters but also significant lineage-specific rearrangements. Despite genome size similarities, T. zeylanicus displayed marked divergence in gene order, suggesting that genome size does not necessarily correlate with structural conservation. The genome contains 6.7% chloroplast-derived sequences and 324 predicted RNA-editing sites, predominantly in the first and second codon positions. Phylogenetic analysis based on mitochondrial genes placed T. zeylanicus as a distinct lineage within Dioscoreales, supporting its evolutionary uniqueness. This work provides the first mitogenomic resource for Dioscoreales and advances our understanding of mitochondrial diversity and evolution in monocots.

Graphical Abstract

1. Introduction

Plant mitochondrial genomes exhibit remarkable diversity and complexity compared to their animal counterparts [1]. Their sizes vary significantly from 66 kb to 11,000 kb and can exist in circular, linear, or multichromosomal structures [2,3,4]. Despite their size, they contain relatively few genes, with most of the DNA consisting of introns, repeats, and non-coding regions [5]. This complexity is further amplified by their dynamic nature, which includes frequent structural rearrangements, intragenomic recombination facilitated by large repeats, and the incorporation of foreign DNA through horizontal gene transfer from nuclear and chloroplast genomes [4,5]. These features make plant mitochondrial genomes highly unique and integral to understanding plant evolution [6,7].
Plant mitochondria rely on post-transcriptional RNA editing to ensure the proper functioning of mitochondrial genes. RNA editing in plant mitochondria converts specific cytidines to uridines in mRNA, with occasional reverse conversions [8]. This process affects nearly all mRNAs and can significantly alter the encoded proteins [9]. The recognition of RNA-editing sites predominantly relies on the 5’ flanking RNA sequence rather than its secondary structure [10]. The editing process is crucial for producing functional proteins and may be required for proper RNA processing, including trans splicing [11]. RNA editing has implications for cytoplasmic male sterility, a significant characteristic in plant breeding [12]. The identification of RNA-editing sites is made possible through genome sequencing, which allows for comparisons between the DNA template and the resulting RNA transcripts, allowing the identification of precise nucleotide modifications. Understanding RNA editing in plant mitochondria not only sheds light on the regulation of mitochondrial gene expression but also on the evolution of this unique mechanism across plant species.
Trichopus zeylanicus, a medicinal plant endemic to the Western Ghats of India and Sri Lanka, is garnering increasing interest among researchers [13]. T. zeylanicus, commonly referred to as “Arogyapacha”, is renowned for its anti-fatigue properties among indigenous populations. In addition to its anti-fatigue effects, this plant exhibits a diverse array of pharmacological properties, including antimicrobial, antioxidant, aphrodisiac, antistress, immunomodulatory, anti-inflammatory, anti-tumor, anti-ulcer, hepatoprotective, anti-hyperlipidemic, and anti-diabetic activities [14,15,16,17,18,19,20]. Despite its pharmacological importance, T. zeylanicus is currently classified under the order Dioscoreales and family Dioscoreaceae according to the Angiosperm Phylogeny Group IV system [21]. However, its familial position has been debated, as it has repeatedly been reassigned [22,23,24]. Recently, the nuclear and chloroplast genomes of T. zeylanicus were released, which paved the way for studying the secondary metabolic biosynthesis pathways in this medicinal plant [25,26]. Nevertheless, the characteristics of its mitochondrial genome remain largely unexplored, potentially containing critical insights into its evolutionary adaptation and phylogenetic placement within the plant kingdom.
This study presents the first report and comprehensive analysis of the mitochondrial genome of T. zeylanicus. The entire genome was annotated to enable us to analyze its genomic composition, gene content, repetitive sequences, chloroplast genome fragment migration, and RNA-editing sites, and a phylogenetic study with closely related species was conducted. This will serve as a significant resource for future research on mitogenomes within the order Dioscoreales, as it is the first thoroughly described mitogenome in this order.

2. Materials and Methods

2.1. Plant Collection and Genomic DNA Extraction

Specimens of T. zeylanicus were collected from the Agastya Hills region in Trivandrum, Kerala, India, and used in this study. The specimens (Voucher KUBH5870) were deposited in the Herbarium of the Department of Botany, University of Kerala, India. Genomic DNA was extracted from young leaf tissues following the CTAB protocol as described by Healey et al. (2014) [27].

2.2. Library Preparation, Sequencing, and Mitochondrial Genome Assembly

Approximately 1 µg of purified genomic DNA was fragmented to an average size of 300 bp using a Covaris S220 Focused-ultrasonicator (Covaris, Woburn, MA, USA). DNA libraries were constructed using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions. An Illumina HiSeq 2500 (2 × 100 bp paired-end mode; Illumina, San Diego, CA, USA) was utilized for sequencing. For long-read sequencing, about 30 µg of DNA was fragmented using a Covaris g-TUBE (Covaris, Woburn, MA, USA) and processed into single-molecule real-time (SMRT) bell templates ranging from 15 to 50 kb following Pacific Biosciences’ guidelines (Pacific Biosciences, Menlo Park, CA, USA). The PacBio Sequel platform, employing the P6-C4 chemistry across five SMRT cells, generated the long-read data.
Raw Illumina sequencing reads were pre-processed using AdapterRemoval v2 to excise residual adapter sequences, trim low-quality bases (Phred score < 20), and remove reads shorter than 50 bp [28]. PacBio polymerase reads were quality-filtered using the SMRT Analysis suite by excluding reads with an average accuracy below Q20 (corresponding to a predicted error rate > 1%), discarding polymerase reads shorter than 100 bp and subreads less than 500 bp. Because sequencing was performed on total leaf-derived DNA, both Illumina and PacBio reads were initially mapped against the nuclear and chloroplast genomes of T. zeylanicus to eliminate non-mitochondrial sequences [25,26]. The resulting mitochondrial-enriched short reads were retained for mitochondrial genome assembly. Before assembly, PacBio reads were error-corrected with high-quality Illumina reads using Proovread v2.12 [29]. Corrected long reads were subsequently assembled into a single contiguous sequence using Canu v1.8 [30]. The completeness and coverage depth of the final assembly were assessed by aligning all Illumina reads with Bowtie and PacBio reads using Blasr v5.3..

2.3. Mitochondrial Genome Annotation

Protein-coding genes (PCGs), ribosomal RNA (rRNA), and transfer RNA (tRNA) genes were annotated utilizing the GEseq webserver [31]. Gene coordinates, including start and end positions, were manually validated, and refined through BLAST v2.16.0+ searches against reference mitochondrial genomes. A circular mitochondrial genome map was generated using the OrganellarGenomeDRAW (OGDRAW) software v1.3.1 [32]. The whole mitochondrial genome data of T. zeylanicus has been submitted to GenBank with the accession number OR830326. An assessment of nucleotide composition skewness was performed utilizing the following equations: AT skew, determined as (A − T)/(A + T), and GC skew, determined as (G − C)/(G + C) [33].

2.4. Identification of Repetitive Elements

Palindromic, forward, reverse, and complementary repeats were identified using REPuter v2.74 [34]. The minimum repeat size examined in the present study was 20 base pairs (bp). The detection of simple sequence repeats (SSRs) was executed using the MISA software v2.1 [35].

2.5. Identification of RNA Editing Sites

The identification of RNA-editing sites in the protein-coding genes of the T. zeylanicus mitochondrial genome was performed with PREPACT 3.0 [36], employing a cut-off value of E = 0.00001 to ensure high precision in the predictions.

2.6. Chloroplast and Mitochondrial Genome Migration

To identify interorganellar gene transfers from the chloroplast genome to the mitochondrial genome, the mitochondrial genome was mapped against the chloroplast genome using the BLASTN tool with default parameters. The gene transfer segments between the organelle genomes were visualized using the Circos package v0.69-3 [37].

2.7. Phylogenetic Analysis

A phylogenetic tree was constructed to determine the evolutionary placement of T. zeylanicus, utilizing six mitochondrial genes from 19 species. The GenBank accession numbers for all the genes used are listed in Supplementary Table S7. Phylogenetic analysis was performed using the maximum likelihood (ML) method, implemented in PhyML v3.0, with 1000 bootstrap replicates to assess statistical support for the tree topology [38,39].

3. Results and Discussion

3.1. The Structure, Organization, and Composition of the T. zeylanicus Mitogenome

This study presents the first complete mitochondrial genome of T. zeylanicus, a medicinally important and phylogenetically unique member of the order Dioscoreales (Pushpangadan P., 1988 [13]; Caddick et al., 2002 [40]). The mitochondrial genome of T. zeylanicus spans 709,127 bp in size with a GC content of 46% (Figure 1). The nucleotide composition is as follows: adenine (A) 27.19%, thymine (T) 26.82%, cytosine (C) 22.92%, and guanine (G) 23.06% This results in positive AT skew (0.006941) and GC skew (0.002986), indicating a mild predominance of adenine and guanine (Figure 1 and Figure S1). The comparative analysis indicates that the mitochondrial genome size of T. zeylanicus is within the expected range for angiosperms, larger than that of Asparagus officinalis (492,062 bp) but smaller than that of Phoenix dactylifera (715,001 bp). Its GC content aligns closely with that of related species, including Cocos nucifera (45.5%), A. officinalis (45.9%), and Pandanus odorifer (45.7%) (Table 1) [41,42].
Table 1. Comparative analysis of mitochondrial genome features across selected plant species related to Trichopus zeylanicus.
Table 1. Comparative analysis of mitochondrial genome features across selected plant species related to Trichopus zeylanicus.
SpeciesGenBank Accession NumberGenome Size (bp)GC Content (%)Repetitive Sequence %Chloroplast-Derived Sequences (%)GenesRNA-Editing Sites in PCGs *
PCGs *tRNAsrRNAs
Trichopus zeylanicusOR830326709,12745.90.696.73217324324
Cocos nuciferaNC_031696.1678,65345.517.265.077223734734
Phoenix dactyliferaNC_016740.1715,00145.11.610.33830491491
Asparagus officinalisNC_053642.1492,06245.95.74.113617810810
Pandanus odoriferNC_080521.1330,96245.71.35.2326325325
* Protein-coding genes.

3.2. Gene Features of the Mitochondrial Genome of T. zeylanicus

The mitochondrial genome of T. zeylanicus contains a total of 52 annotated genes, comprising 32 protein-coding genes (PCGs), 17 transfer RNAs (tRNAs), and three ribosomal RNAs (rRNAs) (Table 2 and Table S1). The distribution and classification of these genes align well with the typical architecture of angiosperm mitogenomes, where a conserved core of respiratory and ribosomal genes is maintained despite frequent rearrangements and size variation [43,44].
Table 2. Genes present in the mitochondrial genome of Trichopus zeylanicus.
Table 2. Genes present in the mitochondrial genome of Trichopus zeylanicus.
Group of GenesGene Names
Complex I (NADH dehydrogenase)nad1, nad2(2), nad3, nad4(3), nad4l, nad5, nad6, nad9
Complex III (ubiquinol cytochrome c reductase)cob2|cob
Complex IV (cytochrome c oxidase)cox1, cox2(2)
Complex V (ATP synthase)atp1, atp4, atp6, atp8, atp9
Cytochrome c biogenesisccmB, ccmc, ccmfc(5)
Ribosomal proteins (SSU)rps2(1), rps3, rps4, rps7, rps10, rps12, rps13, rps14, rps19
Ribosomal proteins (LSU)rpl2, rpl5, rpl16
Transport membrane proteinmttB(1)
Ribosomal RNAsrrn26, rrn5, rrn18
Transfer RNAstrnA-UGC(2), trnC-GCA, trnH-GUG, trnM-CAU, trnN-GUU, trnQ-UUA(1), trnQ-UUG, trnR-UCU(1), trnS-GCU, trnS-GGA, trnS-UGA(1), trnW-CCA, trnY-GUA
The number of introns in each gene is indicated in brackets.
The 32 PCGs were grouped into nine major functional categories: NADH dehydrogenase complex (Complex I) including nad1, nad2, nad3, nad4, nad4L, nad5, nad6, and nad9; cytochrome c oxidase (Complex IV) with cox1 and cox2; ATP synthase (Complex V) with atp1, atp4, atp6, atp8, and atp9; ubiquinol cytochrome c reductase (Complex III) represented by cob; and cytochrome c biogenesis, including ccmB, ccmC, and ccmFc. In addition, nine small-subunit ribosomal protein genes (rps2, rps3, rps4, rps7, rps10, rps12, rps13, rps14, and rps19) and three large-subunit ribosomal protein genes (rpl2, rpl5, rpl16) were identified, along with one transport membrane protein gene (mttB). Collectively, these genes represent the conserved backbone necessary for mitochondrial bioenergetics, translation, and gene expression (Table 2).
The total length of the protein-coding region is 38,310 bp, accounting for 5.4% of the mitochondrial genome (Table S1). The nucleotide composition within coding sequences shows a moderate AT-rich bias, with 27.54% adenine, 30.50% thymine, 20.68% cytosine, and 21.28% guanine, resulting in an overall AT content of 58.04%. Among the PCGs, 19 genes exhibited a negative AT skew, while 21 showed a positive GC skew, indicating strand-specific compositional asymmetry, a feature commonly observed in plant mitogenomes [33].
Thirteen unique transfer RNAs (tRNAs) were identified inside the mitochondrial genome, of which four of these tRNAs (trnM-CAU, trnN-GUU, trnA-UGC, and trnY-GUA) existed in duplicate (Table 2). Four transfer RNAs were identified to have introns, of which trnA-UGC possessed two introns, and the other three transfer RNAs (trnS-UGA, trnQ-UUA, and trnR-UCU) possessed one intron (Table S1). The total length of the transfer RNA (tRNA) was established to be 2536 base pairs (bp), constituting 0.35% of the mitochondrial genome (Table S1). Three ribosomal RNAs (rrn26, rrn5, rrn18) were found in the genome, with a total length of 1154 base pairs (bp), constituting 0.16% of the genome. When compared with closely related monocot mitogenomes, T. zeylanicus displays both shared and unique features (Table 1). Its PCG and tRNA gene counts (32 and 17, respectively) match those of P. odorifer and are slightly lower than those of P. dactylifera (38 PCGs, 30 tRNAs) and C. nucifera (72 PCGs, 23 tRNAs) [41,42,45]. This suggests either gene loss or relocation to the nuclear genome over evolutionary time. The variation in gene content and structure, particularly the number of introns and duplicated tRNAs, highlights lineage-specific evolution among monocots. Notably, T. zeylanicus (Dioscoreaceae) differs from other families such as Pandanaceae (P. odorifer) and Arecaceae (P. dactylifera), which display distinct intron patterns and tRNA repertoires, emphasizing the evolutionary divergence within these lineages.

3.3. Repetitive Sequence Analysis

The mitochondrial genome of T. zeylanicus exhibits a moderate abundance of repetitive DNA elements, which play a crucial role in genome structural dynamics and evolution. In total, 36 simple sequence repeats (SSRs) were identified, comprising 25 mononucleotide, 8 dinucleotide, and 3 trinucleotide repeats (Figure 2A,B, Table S2). The mononucleotide repeats were predominantly composed of A/T motifs, a common feature in plant mitogenomes that reflects the AT-rich nature of non-coding regions [5,46]. The length of the repetitive sequences varied from 9 to 14 base pairs. T. zeylanicus contained the lowest number of SSRs, whereas C. nucifera had the highest (Figure 2A). This variation may correlate with genome plasticity and the extent of repeat-mediated recombination across species (Figure 2A, Table S2). In addition to SSRs, 79 long repeat sequences were identified in the T. zeylanicus mitogenome (Table S3). These included 39 forward repeats and 40 palindromic repeats, while no reverse or complementary repeats were detected. The length of these repeats ranged from 106 to 1162 bp and collectively accounted for 0.52% of the mitochondrial genome. This repeat content is lower than that found in C. nucifera (which has the highest number of long repeats, including repeats up to 19,212 bp) and also lower than in A. officinalis, which contains long repeats up to 12,348 bp. This suggests that T. zeylanicus possesses a relatively compact repeat architecture, which may partially explain the observed level of genome rearrangement and structural divergence [6,47].
Tandem repeats, also known as satellite DNA, were additionally detected using specialized algorithms. A total of 18 perfect tandem repeats were identified, with lengths ranging from 14 to 27 bp, and repeat copy numbers between 2 and 3 (Table 3). These repeats accounted for only 0.11% of the mitogenome, further supporting the compact repeat landscape in T. zeylanicus. Among the analyzed species, C. nucifera again showed the highest number of tandem repeats (92), while A. officinalis had the lowest (13). The relatively low number of tandem and long repeats in T. zeylanicus may indicate reduced repeat-mediated recombination compared to more structurally dynamic mitogenomes, although it still exhibits sufficient repeat content to support limited intramolecular recombination and rearrangement events [5].
Despite having fewer repetitive elements than many other monocot species, T. zeylanicus displays clear signs of genomic rearrangement, as evidenced by its disrupted gene order compared to more structurally stable mitogenomes like P. dactylifera (Figure S2). This paradox, low repeat content but high rearrangement, suggests that even modest levels of repeats, particularly palindromic and forward repeats, may be sufficient to mediate genome isomerization and contribute to structural novelty [6]. In addition to repeat-mediated recombination, other factors may drive structural rearrangements in plant mitogenomes, including the activity of mobile genetic elements (e.g., transposons), double-strand break repair via non-homologous end joining (NHEJ), and homologous recombination via small dispersed repeats [47,48,49]. Moreover, oxidative stress and DNA damage in metabolically active tissues such as leaves may trigger genome instability [8]. These mechanisms, in conjunction with even modest repeat content, may explain the high structural plasticity observed in T. zeylanicus.

3.4. RNA-Editing Site Prediction

RNA editing is essential for gene expression in the mitochondrial and chloroplast genomes of all angiosperms. A total of 324 RNA-editing sites were predicted across 29 protein-coding genes (PCGs) in the mitochondrial genome of T. zeylanicus, using the PREPACT 3.0 platform with stringent criteria (E-value < 1 × 10−5) (Figure 3, Table S4). All predicted editing events involved C-to-U conversions, a canonical editing type in angiosperm mitochondria [50,51]. The distribution of editing sites revealed a positional bias, with 33% (107 sites) located in the first codon position and 67% (217 sites) in the second position. Notably, no RNA-editing events were observed in the third codon position, which is consistent with prior findings in other plant mitochondrial genomes, where editing typically targets sites that result in amino acid changes, rather than silent mutations [51]. Among the PCGs, ccmC had the highest number of editing sites (33), followed closely by ccmB (31) and nad5 (19), reflecting the intensive post-transcriptional regulation of genes involved in cytochrome c biogenesis and Complex I assembly, both of which are critical for mitochondrial respiration and energy production (Figure 3). In contrast, genes like nad2 contained only a single editing site, and nad4L, rps2, and rps7 showed no predicted RNA editing, indicating gene-specific variation in editing dependency. Such variation has also been observed in other plant species and may reflect evolutionary constraints on protein function or structural stability (Mower 2020 [43]). Amino acid conversions resulting from RNA-editing events showed a clear preference for hydrophilic-to-hydrophobic substitutions. Specifically, 182 editing events (56.17%) changed hydrophilic amino acids to hydrophobic ones, whereas 32 events (9.87%) occurred in the opposite direction. Additionally, 88 editing events (27.16%) maintained hydrophobic residues, and 41 (12.6%) preserved hydrophilic residues, indicating that many edits may function to fine-tune protein polarity and membrane affinity (Table S4). A single editing event produced a premature stop codon in the atp9 gene, suggesting a potential mechanism for gene regulation or pseudogene evolution (Table S4). These observations align with established knowledge that RNA editing in plant mitochondria not only restores conserved amino acids but can also affect protein hydrophobicity and functional domains [50,52]. The total number of editing sites in T. zeylanicus (324) is moderate when compared to other monocots such as C. nucifera (734 sites), A. officinalis (810), and P. dactylifera (491). This suggests either a reduced dependence on RNA editing or potentially greater genomic coding accuracy at the DNA level in T. zeylanicus. It may also reflect evolutionary streamlining in editing machinery or the selective retention of edited sites critical for mitochondrial function [43,44].

3.5. Codon Usage Analysis

In the mitochondrial genome of T. zeylanicus, most protein-coding genes (PCGs) begin with the start codon AUG and end with the stop codon UAA, UAG, or UGA. Our analysis of codon usage indicates that AUG (Methionine), CAA (Glutamine), GAC (Aspartic acid), and GGA (Glycine) have the highest frequency among codons, whereas TGC (Cysteine), TAT (Tyrosine), and CAG (Glutamine) are noted for their lowest frequency in the protein-coding genes (PCGs) of the mitogenome (Figure 4, Table S5). The assessment of codon usage bias entailed the computation of relative synonymous codon usage (RSCU). The RSCU analysis showed that all codons were represented in the protein-coding genes. The mitogenome of T. zeylanicus comprises 8238 codons, allocated among 32 unique protein-coding genes (PCGs). RSCU values over 1 indicate a significant codon use bias, whereas RSCU values below 1 imply a diminished codon usage bias in the protein-coding genes of the mitogenome (Figure 4, Table S5). The RSCU values of 29 codons in the protein-coding genes (PCGs) exceeded 1. Notably, the codon CGA (Arginine) in the atp9 gene exhibited the highest RSCU value of 6.0, reflecting extreme codon usage bias (Figure 4, Table S5). Furthermore, the RSCU values for nearly all codons containing an A/T in the third codon position are above 1.0. In contrast, the RSCU values for nearly all codons with a third codon position of C/G are  ≤  1.0 (Figure 4, Table S5). This occurrence suggests the significant prevalence of A/T in the third codon position in the mitogenome of T. zeylanicus, closely resembling findings in the mitogenomes of other terrestrial plants [53,54].

3.6. Analysis of Genes Under Selective Pressure

To investigate the evolutionary constraints acting on mitochondrial protein-coding genes (PCGs) of T. zeylanicus, the Ka/Ks (non-synonymous/synonymous substitution rate) ratios were calculated for 24 shared mitochondrial genes across four related monocot species: A. officinalis, P. dactylifera, C. nucifera, and P. odorifer. This analysis revealed that the majority of PCGs in T. zeylanicus are subject to strong purifying selection (Ka/Ks < 1), reflecting evolutionary pressure to maintain protein function and structural integrity in mitochondrial processes, particularly oxidative phosphorylation and ribosomal assembly [43,44]. Several genes showed low Ka/Ks values, indicative of evolutionary conservation. These include cox1 (Ka/Ks = 0.16), atp6 (Ka/Ks = 0.27), and rps14 (Ka/Ks = 0.18) (Figure 5). cox1 encodes a subunit of cytochrome c oxidase (Complex IV), a central component of the electron transport chain. Its high conservation is typical of plant mitochondria, where cox1 is often used in phylogenetics due to its slow rate of evolution [55]. Similarly, atp6, a component of the ATP synthase complex, and rps14, a small-subunit ribosomal protein, also exhibit evolutionary stability, consistent with their essential roles in mitochondrial energy metabolism and translation, respectively. In contrast, three genes, nad1 (Ka/Ks = 1.20), nad3 (Ka/Ks = 1.49), and ccmB (Ka/Ks = 1.76), exhibited Ka/Ks ratios greater than 1.0, suggesting that they are evolving under positive selection (Figure 5). These genes may be undergoing adaptive evolution in response to selective pressures unique to T. zeylanicus, possibly linked to its ecological niche, altitude-specific respiration demands, or metabolic adaptations. nad1 and nad3 are part of Complex I (NADH dehydrogenase), and changes in these genes may affect mitochondrial respiration efficiency. Complex I is known for its structural plasticity and functional variability across plant lineages, particularly in stress-prone or energetically demanding environments [56]. ccmB, involved in cytochrome c maturation, showed the highest Ka/Ks value (1.76), pointing to significant evolutionary pressure. This suggests potential functional innovation or regulatory adaptation in cytochrome biogenesis, which is critical for efficient electron transport and reactive oxygen species management. These findings are consistent with broader trends observed in plant mitochondrial evolution, where the majority of PCGs are conserved but a subset show signs of accelerated evolution, often driven by environmental adaptation, subfunctionalization, or host–symbiont coevolution [57]. In T. zeylanicus, the presence of positively selected genes may reflect mitochondrial adaptations related to its medicinal properties, ecological specialization in the Western Ghats, or stress-resistance traits.

3.7. Chloroplast-Derived Mitochondrial Genome Sequences

Genome exchange between mitochondria and chloroplasts is prevalent in plants. Approximately 5–10% of various species of the mitochondrial genome can identify homologous sequences in their corresponding chloroplast genome [58]. Homologous sections of the mitochondrial and chloroplast genomes of T. zeylanicus were identified by BlASTN (ncbi-blast-2.2.30+) analysis. Consequently, 80 pieces of 47,982 bp were detected migrating from the chloroplast to the mitochondrial genome of T. zeylanicus, representing 6.7% and 31.2% of the entire mitochondrial genome and chloroplast genome, respectively (Figure 6, Table S6). Additionally, nine annotated gene segments were transferred, comprising rps12 (26%) and the complete sequences of eight tRNAs: trnA-UGC, trnS-GGA, trnH-GUG, trnW-CCA, trnM-CAU, trnR-UCU, trnQ-UUG, and trnN-GUU (Table S6). These observations suggest that several tRNA genes are amenable to transfer, exhibiting reduced sequence conservation during gene migration in T. zeylanicus.

3.8. Phylogenetic Analysis

The order Dioscoreales encompasses five families: Dioscoreaceae, Nartheciaceae, Taccaceae, Thismiaceae, and Burmanniaceae. T. zeylanicus is currently classified within the family Dioscoreaceae; however, its precise taxonomic position remains contentious [59]. To better understand its placement, we conducted a phylogenetic analysis using mitochondrial genome data. Given that a complete mitochondrial genome is unavailable for members of Dioscoreales (except for T. zeylanicus, which was sequenced in this study), we selected six mitochondrial genes—atp1, ccmFc, cox2, mttB, nad4, and rps12—for which sequences are available in most Dioscoreales members. Our analysis included three species from Burmanniaceae (B. capitata, B. itoana, and Haplothismia exannulata), two from Dioscoreaceae (D. membranacea and D. cayenensis subsp. rotundata), and one from Taccaceae (T. leontopetaloides), along with ten monocot species outside Dioscoreales (Figure 7, Table S7). Additionally, two dicot species (Arabidopsis thaliana and Brassica oleracea) were used as outgroups. Maximum likelihood (ML) phylogenetic analysis revealed that species within Dioscoreales (D. membranacea, D. rotundata, T. zeylanicus, H. exannulata, and T. leontopetaloides) formed a well-supported clade, distinct from other monocots. This finding reinforces the status of Dioscoreales as a distinct evolutionary lineage, highlighting its unique genetic and evolutionary characteristics among monocots (Figure 7). Within Dioscoreales, T. zeylanicus emerged as a separate subclade, showing a closer evolutionary relationship to T. leontopetaloides. This finding is consistent with our previous phylogenetic analyses based on both chloroplast and nuclear genomes, which also support the distinct placement and early divergence of T. zeylanicus within the order Dioscoreales. Notably, H. exannulata (Burmanniaceae) clustered with T. leontopetaloides (Taccaceae) rather than grouping with other Dioscoreaceae members, underscoring potential complexities in the evolutionary relationships within the order. Interestingly, this pattern aligns with the nuclear 18S rDNA phylogeny by Merckx et al. (2006), which placed the tribe Thismieae (including Haplothismia) as a sister to Taccaceae [60]. This suggests that the observed clustering may reflect a true evolutionary relationship and highlights the need for multilocus data to resolve deep nodes within Dioscoreales.

4. Conclusions

This study presents the first complete mitochondrial genome assembly and comprehensive analysis for T. zeylanicus, shedding light on its structural organization, gene content, repetitive elements, RNA editing, and interorganellar gene transfer. The mitogenome of T. zeylanicus demonstrates notable features, including moderate RNA editing, chloroplast-derived sequences, and a unique repertoire of repetitive elements, highlighting its evolutionary adaptation and complex mitogenomic architecture. Our phylogenetic analysis highlights its distinct placement within the order Dioscoreales, reinforcing its unique genetic lineage. As the first mitogenome characterized within this order, this research provides a valuable resource for advancing our understanding of mitochondrial genome evolution, functional genomics, and phylogenetics in angiosperms, particularly in Dioscoreales and related lineages.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cimb47070553/s1.

Author Contributions

Conceptualization, analysis, and writing the manuscript—B.V.C. Sequence retrieval mapping and assembly, and editing the manuscript—P.R.S., A.S., B.V.C., P.R.S., R.I.H.I. and H.A.Z. All authors have read and agreed to the published version of the manuscript.

Funding

The authors extend their appreciation to the Deanship of Scientific Research, Vice Presidency for Graduate Studies and Scientific Research, King Faisal University, Saudi Arabia, for funding this research work (Grant number: KFU252560).

Institutional Review Board Statement

Not applicabale.

Informed Consent Statement

Not applicabale.

Data Availability Statement

The datasets analyzed in this study can be found in online repositories. The names of the repositories and accession numbers can be found in the article (Table 2 and Table S7). Additional data generated in this study can be found in the Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Nielsen, B.L. Plant mitochondrial DNA. Front. Biosci. 2017, 22, 4531. [Google Scholar] [CrossRef]
  2. Handa, H. Linear plasmids in plant mitochondria: Peaceful coexistences or malicious invasions? Mitochondrion 2008, 8, 15–25. [Google Scholar] [CrossRef]
  3. Mower, J.P.; Sloan, D.B.; Alverson, A.J. Plant Mitochondrial Genome Diversity: The Genomics Revolution. In Plant Genome Diversity; Springer: Vienna, Austria, 2012; Volume 1, pp. 123–144. [Google Scholar]
  4. Wu, Z.; Liao, X.; Zhang, X.; Tembrock, L.R.; Broz, A. Genomic architectural variation of plant mitochondria—A review of multichromosomal structuring. J. Syst. Evol. 2022, 60, 160–168. [Google Scholar] [CrossRef]
  5. Wynn, E.L.; Christensen, A.C. Repeats of Unusual Size in Plant Mitochondrial Genomes: Identification, Incidence and Evolution. G3 Genes|Genomes|Genet. 2019, 9, 549–559. [Google Scholar] [CrossRef]
  6. Cole, L.W.; Guo, W.; Mower, J.P.; Palmer, J.D. High and Variable Rates of Repeat-Mediated Mitochondrial Genome Rearrangement in a Genus of Plants. Mol. Biol. Evol. 2018, 35, 2773–2785. [Google Scholar] [CrossRef] [PubMed]
  7. Duminil, J. Mitochondrial Genome and Plant Taxonomy. Methods Mol. Biol. 2014, 1115, 121–140. [Google Scholar] [PubMed]
  8. Takenaka, M.; Verbitskiy, D.; van der Merwe, J.A.; Zehrmann, A.; Brennicke, A. The process of RNA editing in plant mitochondria. Mitochondrion 2008, 8, 35–46. [Google Scholar] [CrossRef]
  9. Hiesel, R.; Wissinger, B.; Schuster, W.; Brennicke, A. RNA Editing in Plant Mitochondria. Science 1989, 246, 1632–1634. [Google Scholar] [CrossRef]
  10. Mulligan, R.M. RNA editing site recognition in higher plant mitochondria. J. Hered. 1999, 90, 338–344. [Google Scholar] [CrossRef]
  11. Piazzi, M.; Bavelloni, A.; Salucci, S.; Faenza, I.; Blalock, W.L. Alternative Splicing, RNA Editing, and the Current Limits of Next Generation Sequencing. Genes 2023, 14, 1386. [Google Scholar] [CrossRef]
  12. Araya, A. RNA editing in plant mitochondria, cytoplasmic male sterility and plant breeding. Electron. J. Biotechnol. 1998, 1, 31–39. [Google Scholar] [CrossRef]
  13. Pushpangadan, P. ‘Arogyappacha’ (trichopus zeylanicus gaerin), the ‘ginseng’ of kani tribes of agashyar hills (kerala) for ever green healh and vitality. Anc. Sci. Life 1988, 8, 13–16. [Google Scholar] [PubMed]
  14. Manza, M.M.; Saj, O.P. Cytotoxic and Antimicrobial Studies on Arogyapacha or Kerala Ginseng Leaf Extracts. Int. J. Pharm. Chem. Biol. Sci. 2013, 3, 315–319. [Google Scholar]
  15. Pushpangadan, P.; Rajasekharan, S.; Subramaniam, A.; Latha, P.G.; Evans, D.A.; Raj, R.V. Further on the pharmacology of Trichopus zeylanicus. Anc. Sci. Life 1995, 14, 127–135. [Google Scholar]
  16. Chacko, S.; Sethuraman, M.G.; George, V.P.P. Phytochemical constituents of Trichopus zeylanicus ssp. travancoricus. J. Medicnal Aromat. Plant Sci. 2002, 24, 703–706. [Google Scholar]
  17. Subramoniam, A.; Madhavachandran, V.; Rajasekharan, S.; Pushpangadan, P. Aphrodisiac property of Trichopus zeylanicus extract in male mice. J. Ethnopharmacol. 1997, 57, 21–27. [Google Scholar] [CrossRef]
  18. Tharakan, B.; Dhanasekaran, M.; Brown-Borg, H.M.; Manyam, B.V. Trichopus zeylanicus combats fatigue without amphetamine-mimetic activity. Phytother. Res. 2006, 20, 165–168. [Google Scholar] [CrossRef]
  19. Avinash, K.; Pushpangadan, P.S.; Chopra, C.L. Adaptogenic activity of seeds of Trichopus zeylanicus gaertn, the ginseng of kerala. Anc. Sci. Life 1989, 8, 212–219. [Google Scholar]
  20. Tharakan, B.; Dhanasekaran, M.; Manyam, B.V. Antioxidant and DNA protecting properties of anti-fatigue herb Trichopus zeylanicus. Phytother. Res. 2005, 19, 669–673. [Google Scholar] [CrossRef]
  21. Chase, M.W.; Christenhusz, M.J.M.; Fay, M.F.; Byng, J.W.; Judd, W.S.; Soltis, D.E.; Mabberley, D.J.; Sennikov, A.N.; Soltis, P.S.; Stevens, P.F. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG IV. Bot. J. Linn. Soc. 2016, 181, 1–20. [Google Scholar]
  22. Lindley, J. Aristolochiaceae. In Edwards’s Botanical Register; James Ridgway & Sons: London, UK, 1832; p. 18. [Google Scholar]
  23. Thwaites, G.H.K. Enumeratio Plantarum Zeylaniae; Part 4; Dulau & Co.: London, UK, 1861. [Google Scholar]
  24. Brenan, J.P.M.; Hutchinson, J. The Families of Flowering PlantsFamilies of Flowering Plants. Kew Bull. 2007, 14, 477. [Google Scholar] [CrossRef]
  25. Chellappan, B.V.; Shidhi, P.R.; Vijayan, S.; Rajan, V.S.; Sasi, A.; Nair, A.S. High quality draft genome of arogyapacha (Trichopus zeylanicus), an important medicinal plant endemic to Western Ghats of India. G3 Genes Genomes Genet. 2019, 9, 2395–2404. [Google Scholar] [CrossRef]
  26. Biju, V.C.; Shidhi, P.R.; Vijayan, S.; Rajan, V.S.; Sasi, A.; Janardhanan, A.; Nair, A.S. The Complete Chloroplast Genome of Trichopus zeylanicus, and Phylogenetic Analysis with Dioscoreales. Plant Genome 2019, 12, 1–11. [Google Scholar] [CrossRef]
  27. Healey, A.; Furtado, A.; Cooper, T.; Henry, R.J. Protocol: A simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods 2014, 10, 21. [Google Scholar] [CrossRef] [PubMed]
  28. Schubert, M.; Lindgreen, S.; Orlando, L. AdapterRemoval v2: Rapid adapter trimming, identification, and read merging. BMC Res. Notes 2016, 9, 88. [Google Scholar] [CrossRef]
  29. Hackl, T.; Hedrich, R.; Schultz, J.; Förster, F. Proovread: Large-scale high-accuracy PacBio correction through iterative short read consensus. Bioinformatics 2014, 30, 3004–3011. [Google Scholar] [CrossRef] [PubMed]
  30. Walenz, B.P.; Koren, S.; Bergman, N.H.; Phillippy, A.M.; Miller, J.R.; Berlin, K. Canu: Scalable and accurate long-read assembly via adaptive k-mer weighting and repeat separation. Genome Res. 2017, 27, 722–736. [Google Scholar]
  31. Tillich, M.; Lehwark, P.; Pellizzer, T.; Ulbricht-Jones, E.S.; Fischer, A.; Bock, R.; Greiner, S. GeSeq—Versatile and accurate annotation of organelle genomes. Nucleic Acids Res. 2017, 45, W6–W11. [Google Scholar] [CrossRef]
  32. Greiner, S.; Lehwark, P.; Bock, R. OrganellarGenomeDRAW (OGDRAW) version 1.3.1: Expanded toolkit for the graphical visualization of organellar genomes. Nucleic Acids Res. 2019, 47, W59–W64. [Google Scholar] [CrossRef]
  33. Arakawa, K.; Tomita, M. The GC Skew Index: A Measure of Genomic Compositional Asymmetry and the Degree of Replicational Selection. Evol. Bioinform. 2007, 3, 159–168. [Google Scholar] [CrossRef]
  34. Kurtz, S. REPuter: The manifold applications of repeat analysis on a genomic scale. Nucleic Acids Res. 2001, 29, 4633–4642. [Google Scholar] [CrossRef] [PubMed]
  35. Beier, S.; Thiel, T.; Münch, T.; Scholz, U.; Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef]
  36. Lenz, H.; Hein, A.; Knoop, V. Plant organelle RNA editing and its specificity factors: Enhancements of analyses and new database features in PREPACT 3.0. BMC Bioinform. 2018, 19, 255. [Google Scholar] [CrossRef] [PubMed]
  37. Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef]
  38. Jin, G.; Nakhleh, L.; Snir, S.; Tuller, T. Maximum likelihood of phylogenetic networks. Bioinformatics 2006, 22, 2604–2611. [Google Scholar] [CrossRef] [PubMed]
  39. Guindon, S.; Dufayard, J.F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef]
  40. Caddick, L.R.; Wilkin, P.; Rudall, P.J.; Hedderson, T.A.J.; Chase, M.W. Yams Reclassified: A Recircumscription of Dioscoreaceae and Dioscoreales. Taxon 2002, 51, 103–114. [Google Scholar] [CrossRef]
  41. Sheng, W.; Deng, J.; Wang, C.; Kuang, Q. The garden asparagus (Asparagus officinalis L.) mitochondrial genome revealed rich sequence variation throughout whole sequencing data. Front. Plant Sci. 2023, 14, 1140043. [Google Scholar] [CrossRef]
  42. Aljohi, H.A.; Liu, W.; Lin, Q.; Zhao, Y.; Zeng, J.; Alamer, A.; Alanazi, I.O.; Alawad, A.O.; Al-Sadi, A.M.; Hu, S.; et al. Complete Sequence and Analysis of Coconut Palm (Cocos nucifera) Mitochondrial Genome. PLoS ONE 2016, 11, e0163990. [Google Scholar] [CrossRef]
  43. Mower, J.P. Variation in protein gene and intron content among land plant mitogenomes. Mitochondrion 2020, 53, 203–213. [Google Scholar] [CrossRef]
  44. Sloan, D.B.; Wu, Z. History of Plastid DNA Insertions Reveals Weak Deletion and AT Mutation Biases in Angiosperm Mitochondrial Genomes. Genome Biol. Evol. 2014, 6, 3210–3221. [Google Scholar] [CrossRef]
  45. Fang, Y.; Wu, H.; Zhang, T.; Yang, M.; Yin, Y.; Pan, L.; Yu, X.; Zhang, X.; Hu, S.; Al-Mssallem, I.S.; et al. A Complete Sequence and Transcriptomic Analyses of Date Palm (Phoenix dactylifera L.) Mitochondrial Genome. PLoS ONE 2012, 7, e37164. [Google Scholar] [CrossRef]
  46. Sperisen, C.; Büchler, U.; Gugerli, F.; Mátyás, G.; Geburek, T.; Vendramin, G.G. Tandem repeats in plant mitochondrial genomes: Application to the analysis of population differentiation in the conifer Norway spruce. Mol. Ecol. 2001, 10, 257–263. [Google Scholar] [CrossRef] [PubMed]
  47. Wang, H.; Wu, Z.; Li, T.; Zhao, J. Highly active repeat-mediated recombination in the mitogenome of the aquatic grass Hygroryza aristata. BMC Plant Biol. 2024, 24, 644. [Google Scholar] [CrossRef]
  48. Davila, J.I.; Arrieta-Montiel, M.P.; Wamboldt, Y.; Cao, J.; Hagmann, J.; Shedge, V.; Xu, Y.-Z.; Weigel, D.; Mackenzie, S.A. Double-Strand Break Repair Processes Drive Evolution of the Mitochondrial Genome in Arabidopsis. BMC Biol. 2011, 9, 64. [Google Scholar] [CrossRef]
  49. Bendich, A.J.; Rogers, S.O. The Biological and Evolutionary Consequences of Competition between DNA Sequences That Benefit the Cell and DNA Sequences That Benefit Themselves. Nucleic Acids Res. 2025, 53, gkaf589. [Google Scholar] [CrossRef] [PubMed]
  50. Ichinose, M.; Sugita, M. RNA Editing and Its Molecular Mechanism in Plant Organelles. Genes 2016, 8, 5. [Google Scholar] [CrossRef]
  51. Maier, R.M.; Zeltz, P.; Kössel, H.; Bonnard, G.; Gualberto, J.M.; Grienenberger, J.M. RNA editing in plant mitochondria and chloroplasts. Plant Mol. Biol. 1996, 32, 343–365. [Google Scholar] [CrossRef]
  52. Hiesel, R.; Combettes, B.; Brennicke, A. Evidence for RNA editing in mitochondria of all major groups of land plants except the Bryophyta. Proc. Natl. Acad. Sci. USA 1994, 91, 629–633. [Google Scholar] [CrossRef] [PubMed]
  53. Zhou, M.; Li, X. Analysis of synonymous codon usage patterns in different plant mitochondrial genomes. Mol. Biol. Rep. 2009, 36, 2039–2046. [Google Scholar] [CrossRef] [PubMed]
  54. Xiao, Z.; Gu, Y.; Zhou, J.; Lu, M.; Wang, J.; Lu, K.; Zeng, Y.; Tan, X. De novo assembly of the complete mitochondrial genomes of two Camellia-oil tree species reveals their multibranch conformation and evolutionary relationships. Sci. Rep. 2025, 15, 2899. [Google Scholar] [CrossRef]
  55. Kubo, T.; Newton, K.J. Angiosperm mitochondrial genomes and mutations. Mitochondrion 2008, 8, 5–14. [Google Scholar] [CrossRef] [PubMed]
  56. Abrosimov, R.; Baeken, M.W.; Hauf, S.; Wittig, I.; Hajieva, P.; Perrone, C.E.; Moosmann, B. Mitochondrial complex I inhibition triggers NAD+-independent glucose oxidation via successive NADPH formation, “futile” fatty acid cycling, and FADH2 oxidation. Geroscience 2024, 46, 3635–3658. [Google Scholar] [CrossRef]
  57. Liu, Q.; Cai, Y.D.; Ma, L.; Liu, H.; Linghu, T.; Guo, S.; Wei, S.; Song, F.; Tian, L.; Cai, W. Relaxed purifying selection pressure drives accelerated and dynamic gene rearrangements in thrips (Insecta: Thysanoptera) mitochondrial genomes. Int. J. Biol. Macromol. 2023, 253, 126742. [Google Scholar] [CrossRef]
  58. Mower, J.P.; Jain, K.; Hepburn, N.J. The Role of Horizontal Transfer in Shaping the Plant Mitochondrial Genome. Adv. Bot. Res. 2012, 63, 41–69. [Google Scholar]
  59. Sasikala, N.; Ramasubbu, R. Population status and floral biology of Trichopus zeylanicus ssp. travancoricus Burkill ex K. Narayanan (Dioscoreaceae), an important ethnomedicinal plant of the southern Western Ghats, India. J. Threat. Taxa 2019, 11, 13156–13161. [Google Scholar] [CrossRef]
  60. Merckx, V.; Schols, P.; de Kamer, H.M.; Maas, P.; Huysmans, S.; Smets, E. Phylogeny and Evolution of Burmanniaceae (Dioscoreales) Based on Nuclear and Mitochondrial Data. Am. J. Bot. 2006, 93, 1684–1698. [Google Scholar] [CrossRef]
Cimb 47 00553 g001
Figure 1. Circular visualization of the mitochondrial genome of Trichopus zeylanicus. Genes transcribed clockwise are labeled outside the circle, while those transcribed counterclockwise are labeled inside the circle. Different functional categories are represented by distinct colors. The central photograph depicts the characteristic morphology of T. zeylanicus, showing its broad, dark green leaves, as observed in its natural habitat in the Western Ghats.
Figure 1. Circular visualization of the mitochondrial genome of Trichopus zeylanicus. Genes transcribed clockwise are labeled outside the circle, while those transcribed counterclockwise are labeled inside the circle. Different functional categories are represented by distinct colors. The central photograph depicts the characteristic morphology of T. zeylanicus, showing its broad, dark green leaves, as observed in its natural habitat in the Western Ghats.
Cimb 47 00553 g001
Cimb 47 00553 g002
Figure 2. Repetitive sequences in the mitochondrial genome of Trichopus zeylanicus and its closely related species. (A). The distribution of simple sequence repeats (SSRs), long repeats, and tandem repeats across the species. The number of different types of repeats in each species is shown above the respective bars. (B). The distribution of different types of simple sequence repeats (SSRs) in the mitochondrial genome of T. zeylanicus. The numbers above the bars represent the copy number of each repeat.
Figure 2. Repetitive sequences in the mitochondrial genome of Trichopus zeylanicus and its closely related species. (A). The distribution of simple sequence repeats (SSRs), long repeats, and tandem repeats across the species. The number of different types of repeats in each species is shown above the respective bars. (B). The distribution of different types of simple sequence repeats (SSRs) in the mitochondrial genome of T. zeylanicus. The numbers above the bars represent the copy number of each repeat.
Cimb 47 00553 g002
Cimb 47 00553 g003
Figure 3. The distribution of RNA-editing sites across the 29 protein-coding genes in the mitochondrial genome of T. zeylanicus. The numbers above each batch represent the number of RNA-editing sites in the respective genes.
Figure 3. The distribution of RNA-editing sites across the 29 protein-coding genes in the mitochondrial genome of T. zeylanicus. The numbers above each batch represent the number of RNA-editing sites in the respective genes.
Cimb 47 00553 g003
Cimb 47 00553 g004
Figure 4. Codon usage analysis of the mitochondrial genome of Trichopus zeylanicus. A heatmap of relative synonymous codon usage (RSCU) values across mitochondrial protein-coding genes of Trichopus zeylanicus. Each row represents an individual mitochondrial gene, while each column corresponds to a specific codon labeled with its associated amino acid. The color gradient reflects the RSCU values, ranging from low (deep purple) to high (bright yellow), with values above 1.0 indicating preferred codon usage.
Figure 4. Codon usage analysis of the mitochondrial genome of Trichopus zeylanicus. A heatmap of relative synonymous codon usage (RSCU) values across mitochondrial protein-coding genes of Trichopus zeylanicus. Each row represents an individual mitochondrial gene, while each column corresponds to a specific codon labeled with its associated amino acid. The color gradient reflects the RSCU values, ranging from low (deep purple) to high (bright yellow), with values above 1.0 indicating preferred codon usage.
Cimb 47 00553 g004
Cimb 47 00553 g005
Figure 5. Genes under selection pressure. The Ka/Ks ratios of 24 mitochondrial protein-coding genes in Trichopus zeylanicus. Genes with Ka/Ks < 1 are considered to be under purifying selection, indicating functional conservation, while values > 1 suggest positive selection and potential adaptive evolution. The red dashed line represents the neutral selection threshold (Ka/Ks = 1). Ka—nonsynonymous substitution rate; Ks—synonymous substitution rate.
Figure 5. Genes under selection pressure. The Ka/Ks ratios of 24 mitochondrial protein-coding genes in Trichopus zeylanicus. Genes with Ka/Ks < 1 are considered to be under purifying selection, indicating functional conservation, while values > 1 suggest positive selection and potential adaptive evolution. The red dashed line represents the neutral selection threshold (Ka/Ks = 1). Ka—nonsynonymous substitution rate; Ks—synonymous substitution rate.
Cimb 47 00553 g005
Cimb 47 00553 g006
Figure 6. Chloroplast-to-mitochondrion sequence migration in the mitochondrial genome of Trichopus zeylanicus. The circular diagram shows regions of sequence homology between the chloroplast genome (red segment) and mitochondrial genome (blue segment). Orange lines indicate sequences in direct orientation, while green lines represent sequences in reverse orientation.
Figure 6. Chloroplast-to-mitochondrion sequence migration in the mitochondrial genome of Trichopus zeylanicus. The circular diagram shows regions of sequence homology between the chloroplast genome (red segment) and mitochondrial genome (blue segment). Orange lines indicate sequences in direct orientation, while green lines represent sequences in reverse orientation.
Cimb 47 00553 g006
Cimb 47 00553 g007
Figure 7. The phylogenetic analysis of Trichopus zeylanicus and closely related species based on six mitochondrial genes. The blue branches represent the species within the order Dioscoreales. The red branches denote other monocot species, illustrating the phylogenetic divergence between Dioscoreales and other monocot groups. The evolutionary history was inferred by using the Maximum Likelihood method and the Kimura 2-parameter model. The bootstrap values supporting the clustering are shown. Two dicots, Arabidopsis thaliana and Brassica oleracea, were used as outgroups.
Figure 7. The phylogenetic analysis of Trichopus zeylanicus and closely related species based on six mitochondrial genes. The blue branches represent the species within the order Dioscoreales. The red branches denote other monocot species, illustrating the phylogenetic divergence between Dioscoreales and other monocot groups. The evolutionary history was inferred by using the Maximum Likelihood method and the Kimura 2-parameter model. The bootstrap values supporting the clustering are shown. Two dicots, Arabidopsis thaliana and Brassica oleracea, were used as outgroups.
Cimb 47 00553 g007
Table 3. Details of tandem repeats in the mitochondrial genome of T. zeylanicus.
Table 3. Details of tandem repeats in the mitochondrial genome of T. zeylanicus.
No.SizeCopyStartEndSequence
125335,38835,462GTCTCATAGGTTACATGGAATACCG
2172127,171127,204AGTGAATCAGATCGTAG
3272127,199127,252TGGTAGTTCGCGTGCTCAAGTGAAATG
4172141,404141,440CAAGGCAAGGTCAGGCT
5173141,404141,446CAAGGCAAGGTCAGGCT
6172201,046201,079AACCCTGATCGTCTTCC
7223219,866219,933CGTGCATGTCACCGTCTCCACC
8182224,271224,308TGTTGTTGCAATACCCGT
9132254,962254,986TCAAAGTGAGAAC
10132381,379381,403TTGTATATCCAAA
11192385,131385,169AATAGTAATAGTTCTATTC
12132458,381458,411TAGCCTCTAACTC
13252472,717472,764GTAGCATGAAGAAAGCAGAAGTGGA
14272487,362487,427ATACTTGCAGCGGGGATTCTACCTCTT
15212536,618536,665TCGGCGTCCGTCTATCTATTG
16212570,837570,876TTGATAATCCTACTCTTTTCC
17253596,343596,417CGAAGAAAGCACTACACCTGGCAGG
18142691,088691,117AGGGACTGCCTGGAA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chellappan, B.V.; Shidhi, P.R.; Sasi, A.; Ibrahim, R.I.H.; Zahra, H.A. Assembly and Comparative Analysis of Complete Mitochondrial Genome Sequence of Endangered Medicinal Plant Trichopus zeylanicus. Curr. Issues Mol. Biol. 2025, 47, 553. https://doi.org/10.3390/cimb47070553

AMA Style

Chellappan BV, Shidhi PR, Sasi A, Ibrahim RIH, Zahra HA. Assembly and Comparative Analysis of Complete Mitochondrial Genome Sequence of Endangered Medicinal Plant Trichopus zeylanicus. Current Issues in Molecular Biology. 2025; 47(7):553. https://doi.org/10.3390/cimb47070553

Chicago/Turabian Style

Chellappan, Biju Vadakkemukadiyil, P. R. Shidhi, Anu Sasi, Rashid Ismael Hag Ibrahim, and Hamad Abu Zahra. 2025. "Assembly and Comparative Analysis of Complete Mitochondrial Genome Sequence of Endangered Medicinal Plant Trichopus zeylanicus" Current Issues in Molecular Biology 47, no. 7: 553. https://doi.org/10.3390/cimb47070553

APA Style

Chellappan, B. V., Shidhi, P. R., Sasi, A., Ibrahim, R. I. H., & Zahra, H. A. (2025). Assembly and Comparative Analysis of Complete Mitochondrial Genome Sequence of Endangered Medicinal Plant Trichopus zeylanicus. Current Issues in Molecular Biology, 47(7), 553. https://doi.org/10.3390/cimb47070553

Article Metrics

Back to TopTop