Development and Evaluation of a New qPCR Assay for the Detection of Mycoplasma in Cell Cultures
Abstract
:1. Introduction
2. Materials and Methods
2.1. Supernatant Samples
2.2. Samples for Cell Culture Screening
2.3. Standard DNA
2.4. The Design of Primers and Probes
2.5. qPCR Conditions
2.6. qPCR Mycoplasma Detection with a Venor®GeM qEP Kit
2.7. Purification of Amplified Bands
2.8. DNA Sequencing
2.9. Sequence Assembly and Clustering
2.10. Mycoplasma Detection with Plasmotest®
2.11. Controls Used in the Study
- -
- Venor®GeM qEP includes a positive control in the kit that was used as an additional sample. Ultrapure water included in the kit was added as a negative control.
- -
- A M. fermentans DNA standard containing 1 × 102 copies of strain NCTC 10117 was used as the new qPCR assay positive control. Ultrapure water was added as a negative control.
- -
- 1/10 dilutions of the negative and positive controls included in the Plasmotest® kit were used as controls and treated as any other sample.
3. Results
3.1. Mycoplasma qPCR Development
3.2. Comparative Analysis of Detection Methods
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Soheily, Z.; Soleimani, M.; Majidzadeh-Ardebili, K. Detection of Mycoplasma Contamination of Cell Culture by A Loop-Mediated Isothermal Amplification Method. Cell J. 2019, 21, 43–48. [Google Scholar] [CrossRef] [PubMed]
- Corral-Vazquez, C.; Aguilar-Quesada, R.; Catalina, P.; Lucena-Aguilar, G.; Ligero, G.; Miranda, B.; Carrillo-Avila, J.A. Cell lines authentication and mycoplasma detection as minimun quality control of cell lines in biobanking. Cell Tissue Bank. 2017, 18, 271–280. [Google Scholar] [CrossRef] [PubMed]
- Shannon, M.; Capes-Davis, A.; Eggington, E.; Georghiou, R.; Huschtscha, L.I.; Moy, E.; Power, M.; Reddel, R.R.; Arthur, J.W. Is cell culture a risky business? Risk analysis based on scientist survey data. Int. J. Cancer 2016, 138, 664–670. [Google Scholar] [CrossRef] [PubMed]
- Weiskirchen, S.; Schroder, S.K.; Buhl, E.M.; Weiskirchen, R. A Beginner’s Guide to Cell Culture: Practical Advice for Preventing Needless Problems. Cells 2023, 12, 682. [Google Scholar] [CrossRef]
- Stanbridge, E. Mycoplasmas and cell cultures. Bacteriol. Rev. 1971, 35, 206–227. [Google Scholar] [CrossRef]
- Young, L.; Sung, J.; Stacey, G.; Masters, J.R. Detection of Mycoplasma in cell cultures. Nat. Protoc. 2010, 5, 929–934. [Google Scholar] [CrossRef]
- Uphoff, C.C.; Drexler, H.G. Detection of Mycoplasma contamination in cell cultures. Curr. Protoc. Mol. Biol. 2014, 106, 28.4.1–28.4.14. [Google Scholar] [CrossRef]
- Uphoff, C.C.; Drexler, H.G. Comparative PCR analysis for detection of mycoplasma infections in continuous cell lines. In Vitro Cell Dev. Biol. Anim. 2002, 38, 79–85. [Google Scholar] [CrossRef]
- Nikfarjam, L.; Farzaneh, P. Prevention and detection of Mycoplasma contamination in cell culture. Cell J. 2012, 13, 203–212. [Google Scholar]
- Pisal, R.V.; Hrebikova, H.; Chvatalova, J.; Kunke, D.; Filip, S.; Mokry, J. Detection of Mycoplasma Contamination Directly from Culture Supernatant Using Polymerase Chain Reaction. Folia Biol. 2016, 62, 203–206. [Google Scholar]
- Nübling, C.M.; Baylis, S.A.; Hanschmann, K.M.; Montag-Lessing, T.; Chudy, M.; Kreß, J.; Ulrych, U.; Czurda, S.; Rosengarten, R. World Health Organization International Standard to Harmonize Assays for Detection of Mycoplasma DNA. Appl. Environ. Microbiol. 2015, 81, 5694–5702. [Google Scholar] [CrossRef]
- Armstrong, S.E.; Mariano, J.A.; Lundin, D.J. The scope of mycoplasma contamination within the biopharmaceutical industry. Biologicals 2010, 38, 211–213. [Google Scholar] [CrossRef] [PubMed]
- Volokhov, D.V.; Norris, T.; Rios, C.; Davidson, M.K.; Messick, J.B.; Gulland, F.M.; Chizhikov, V.E. Novel hemotrophic mycoplasma identified in naturally infected California sea lions (Zalophus californianus). Vet. Microbiol. 2011, 149, 262–268. [Google Scholar] [CrossRef] [PubMed]
- WHO (Ed.) Sixty-fourth report. In Expert Committee on Biological Standardization; WHO Tech Rep Ser; WHO: Geneva, Switzerland, 2014. [Google Scholar]
- Geraghty, R.J.; Capes-Davis, A.; Davis, J.M.; Downward, J.; Freshney, R.I.; Knezevic, I.; Lovell-Badge, R.; Masters, J.R.; Meredith, J.; Stacey, G.N.; et al. Guidelines for the use of cell lines in biomedical research. Br. J. Cancer 2014, 111, 1021–1046. [Google Scholar] [CrossRef]
- Duke, P.S.; Landgraf, W.; Mitamura, A.E.; Demopoulos, H.B. Study of S91 mouse melanomas by electron paramagnetic resonance spectroscopy and tissue culture. I. The effect of cysteine on blue light signals and on growth in vitro. J. Natl. Cancer Inst. 1966, 37, 191–198. [Google Scholar]
- Pharmaceuticals and Medical Devices Agency. Japanese Pharmacopoeia, 18th ed.; Pharmaceuticals and Medical Devices Agency: Tokyo, Japan, 2021. [Google Scholar]
- Sheppard, S.K.; Dallas, J.F.; MacRae, M.; McCarthy, N.D.; Sproston, E.L.; Gormley, F.J.; Strachan, N.J.; Ogden, I.D.; Maiden, M.C.; Forbes, K.J. Campylobacter genotypes from food animals, environmental sources and clinical disease in Scotland 2005/6. Int. J. Food Microbiol. 2009, 134, 96–103. [Google Scholar] [CrossRef]
- Vega-Orellana, O.; Poveda, J.B.; Rosales, R.S.; Bradbury, J.M.; Poveda, C.G.; Mederos-Iriarte, L.E.; Tavio, M.M.; Ramirez, A.S. Comparison of different NAT assays for the detection of microorganisms belonging to the class Mollicutes. BMC Vet. Res. 2017, 13, 195. [Google Scholar] [CrossRef] [PubMed]
- Dreolini, L.; Cullen, M.; Yung, E.; Laird, L.; Webb, J.R.; Nelson, B.H.; Hay, K.A.; Balasundaram, M.; Kekre, N.; Holt, R.A. A Rapid and Sensitive Nucleic Acid Amplification Technique for Mycoplasma Screening of Cell Therapy Products. Mol. Ther. Methods Clin. Dev. 2020, 17, 393–399. [Google Scholar] [CrossRef]
- Kong, F.; James, G.; Gordon, S.; Zelynski, A.; Gilbert, G.L. Species-specific PCR for identification of common contaminant mollicutes in cell culture. Appl. Environ. Microbiol. 2001, 67, 3195–3200. [Google Scholar] [CrossRef]
- Totten, A.H.; Adams, A.J.; Halas, H.K.; Gebo, J.E.T.; East, A.D.; Lau, A.F. Comparison of Five Commercial Molecular Assays for Mycoplasma Testing of Cellular Therapy Products. J. Clin. Microbiol. 2023, 61, e0149822. [Google Scholar] [CrossRef]
- Asarnow, D.; Warford, A.; Fernandez, L.; Hom, J.; Sandhu, G.; Candichoy, Z.; Luna, G.; Goldman, M.; Rarich, R. Validation and international regulatory experience for a mycoplasma touchdown PCR assay. Biologicals 2010, 38, 224–231. [Google Scholar] [CrossRef] [PubMed]
- Salling, H.K.; Bang-Christensen, S.R. Multi-primer qPCR assay capable of highly efficient and specific detection of the vast majority of all known Mycoplasma. Biologicals 2016, 44, 129–138. [Google Scholar] [CrossRef] [PubMed]
- Stormer, M.; Vollmer, T.; Henrich, B.; Kleesiek, K.; Dreier, J. Broad-range real-time PCR assay for the rapid identification of cell-line contaminants and clinically important mollicute species. Int. J. Med. Microbiol. 2009, 299, 291–300. [Google Scholar] [CrossRef] [PubMed]
- Zhi, Y.; Mayhew, A.; Seng, N.; Takle, G.B. Validation of a PCR method for the detection of mycoplasmas according to European Pharmacopoeia section 2.6.7. Biologicals 2010, 38, 232–237. [Google Scholar] [CrossRef]
- Carrillo-Avila, J.A.; Aguilar-Quesada, R.; Ligero, G.; Panadero-Fajardo, S.; Santos-Pirez, M.V.; Catalina, P. Identification of cell culture contamination by an unusual species of Mycoplasma related to the M. mycoides cluster. Cytotechnology 2023, 75, 135–141. [Google Scholar] [CrossRef]
- Molla Kazemiha, V.; Bonakdar, S.; Amanzadeh, A.; Azari, S.; Memarnejadian, A.; Shahbazi, S.; Shokrgozar, M.A.; Mahdian, R. Real-time PCR assay is superior to other methods for the detection of mycoplasma contamination in the cell lines of the National Cell Bank of Iran. Cytotechnology 2016, 68, 1063–1080. [Google Scholar] [CrossRef]
- Peredeltchouk, M.; David, S.A.; Bhattacharya, B.; Volokhov, D.V.; Chizhikov, V. Detection of mycoplasma contamination in cell substrates using reverse transcription-PCR assays. J. Appl. Microbiol. 2011, 110, 54–60. [Google Scholar] [CrossRef]
- Mathews, S.; Rabani, R.; Rasti, M.; Viswanathan, S. In-house abbreviated qualification of a real-time polymerase chain reaction method and strategies to amplify mycoplasma detection in human mesenchymal stromal cells. Cytotherapy 2021, 23, 1036–1044. [Google Scholar] [CrossRef]
- Janetzko, K.; Rink, G.; Hecker, A.; Bieback, K.; Kluter, H.; Bugert, P. A single-tube real-time PCR assay for Mycoplasma detection as a routine quality control of cell therapeutics. Transfus. Med. Hemother 2014, 41, 83–89. [Google Scholar] [CrossRef]
- Jean, A.; Tardy, F.; Allatif, O.; Grosjean, I.; Blanquier, B.; Gerlier, D. Assessing mycoplasma contamination of cell cultures by qPCR using a set of universal primer pairs targeting a 1.5 kb fragment of 16S rRNA genes. PLoS ONE 2017, 12, e0172358. [Google Scholar] [CrossRef]
- DaMassa, A.J.; Tully, J.G.; Rose, D.L.; Pitcher, D.; Leach, R.H.; Cottew, G.S. Mycoplasma auris sp. nov., Mycoplasma cottewii sp. nov., and Mycoplasma yeatsii sp. nov., new sterol-requiring mollicutes from the external ear canals of goats. Int. J. Syst. Bacteriol. 1994, 44, 479–484. [Google Scholar] [CrossRef] [PubMed]
- Boonyayatra, S.; Fox, L.K.; Gay, J.M.; Sawant, A.; Besser, T.E. Discrimination between Mycoplasma and Acholeplasma species of bovine origin using digitonin disc diffusion assay, nisin disc diffusion assay, and conventional polymerase chain reaction. J. Vet. Diagn. Investig. 2012, 24, 7–13. [Google Scholar] [CrossRef] [PubMed]
- Jimena, O.N.; Laura, J.M.; Elena, M.M.; Alonso, N.H.; Teresa, Q.M. Association of Raillietia caprae with the presence of Mycoplasmas in the external ear canal of goats. Prev. Vet. Med. 2009, 92, 150–153. [Google Scholar] [CrossRef] [PubMed]
- Calcutt, M.J.; Szikriszt, B.; Poti, A.; Molnar, J.; Gervai, J.Z.; Tusnady, G.E.; Foecking, M.F.; Szuts, D. Genome Sequence Analysis of Mycoplasma sp. HU2014, Isolated from Tissue Culture. Genome Announc. 2015, 3, e01086-15. [Google Scholar] [CrossRef] [PubMed]
- Del Giudice, R.A. M-CMRL, a new axenic medium to replace indicator cell cultures for the isolation of all strains of Mycoplasma hyorhinis. In Vitro Cell Dev. Biol. Anim. 1998, 34, 88–89. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.Y.; Dumontelle, J.L.; Zolodz, M.; Deora, A.; Mozier, N.M.; Golding, B. Use of toll-like receptor assays to detect and identify microbial contaminants in biological products. J. Clin. Microbiol. 2009, 47, 3427–3434. [Google Scholar] [CrossRef] [PubMed]
- Boslett, B.; Nag, S.; Resnick, A. Detection and antibiotic treatment of Mycoplasma arginini contamination in a mouse epithelial cell line restore normal cell physiology. BioMed Res. Int. 2014, 2014, 532105. [Google Scholar] [CrossRef]
- Section 2.6.7. Mycoplasmas. In European Pharmacopoeia, 10th ed.; 10/2020; Council of Europe: Strasbourg, France, 2020.
Sample | Cell Line | Passage | Cell Origin | This Study qPCR | Venor®GeM qEP | PlasmoTest® | Sequencing Results | Accession Number |
---|---|---|---|---|---|---|---|---|
1 | Cell line 1 | 5 | Mesenchymal fat cells | |||||
3 | 6 | |||||||
4 | 7 | |||||||
5 | 8 | |||||||
6 | 10 | |||||||
2 | Cell line 2 | 4 | Umbilical cord mesenchymal cells | |||||
7 | Cell line 3 | 15 | Umbilical cord mesenchymal cells | |||||
8 | 20 | |||||||
9 | Cell line 4 | 10 | Umbilical cord mesenchymal cells | |||||
10 | 12 | |||||||
11 | 15 | |||||||
12 | 17 | |||||||
42 | Cell line 5 | 20 | iPSCs | P (29.19) | Negative | P | ≈M. mycoides cluster | OP626186 |
43 | 21 | P (31.82) | P (31.87) | Negative | ≈M. mycoides cluster | OP626187 | ||
17 | 27 | P (28) | P (33.02) | P | ≈M. mycoides cluster | OP626181 | ||
13 | 29 | |||||||
14 | Cell line 6 | 18 | iPSCs | P (27.94) | P (29.9) | P | ≈M. mycoides cluster | OP626179 |
18 | 19 | P (26.84) | P (30.61) | P | ≈M. mycoides cluster | OP626182 | ||
44 | 20 | P (28) | P (28.87) | P | ≈M. mycoides cluster | OP626188 | ||
45 | 21 | P (27.8) | P (29.51) | P | ≈M. mycoides cluster | OP626189 | ||
15 | Cell line 7 | 18 | iPSCs | P (33.91) | P (34.48) | P | M. hyorhinis | OP626180 |
19 | 21 | |||||||
16 | Cell line 8 | 7 | iPSCs | P (25.9) | P (26.24) | P | ≈M. mycoides cluster | OP626183 |
32 | 12 | |||||||
37 | 13 | |||||||
40 | 14 | |||||||
41 | 15 | |||||||
20 | Cell line 9 | 10 | HEK-2 cells | |||||
21 | Cell line 10 | 23 | Colon tumoral cells | |||||
22 | Cell line 11 | 47 | hESCs | |||||
23 | 49 | |||||||
24 | 50 | |||||||
25 | 51 | |||||||
26 | 77 | |||||||
27 | 79 | |||||||
28 | Cell line 12 | 23 | Colon tumoral cells | |||||
29 | 24 | |||||||
30 | 25 | |||||||
31 | 26 | |||||||
33 | Cell line 13 | 44 | iPSCs | |||||
38 | 46 | P (28.81) | P (28.53) | P | ≈M. mycoides cluster | OP626184 | ||
39 | 47 | P (28.02) | P (26.66) | P | ≈M. mycoides cluster | OP626185 | ||
34 | Cell line 14 | 5 | Skin fibroblast cells | |||||
35 | 6 | |||||||
36 | 8 |
Primer Name | Sequence (5′→3′) | Reference | Utility |
---|---|---|---|
Myco U&D-F1 | CGCCTGAGTAGTACGTWCGC | [8] | PCR Forward [8] |
Myco U&D-F2 | TGCCTGRGTAGTACATTCGC | [8] | |
Myco U&D-F3 | CRCCTGAGTAGTATGCTCGC | [8] | |
Myco U&D-F4 | CGCCTGGGTAGTACATTCGC | [8] | |
Myco-R5 | GCTCGTTRCRGGACTTRACC | This study | PCR Reverse |
Myco-S1 Probe | [6FAM]GGAATTGACGGGRMYCCGCAC[BHQ1] | This study | Mycoplasma Probe |
Myco-IC-S1 Probe | [HEX]AGTAGTGTGTGCCCGTCTGT[BHQ1] | This study | Internal Control Probe |
Sample | Cq | Cq Std. Dev. |
---|---|---|
A. laidlawii | 36.18 | ±0.51 |
M. arginini | 36.74 | ±1.34 |
M. fermentans | 36.16 | ±0.21 |
M. gallisepticum | 36.59 | ±0.59 |
M. hyorhinis | 36.15 | ±0.47 |
M. orale | 35.96 | ±0.97 |
M. pneumoniae | 36.74 | ±1.23 |
M. synoviae | 36.21 | ±0.07 |
S. citri | 29.4 | ±0.21 |
C-Standard | ||
C− | ||
C+ | 30.06 | ±1.08 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Carrillo-Ávila, J.A.; de la Fuente, A.; Aguilar-Quesada, R.; Ligero, G.; del Río-Ortiz, J.M.; Catalina, P. Development and Evaluation of a New qPCR Assay for the Detection of Mycoplasma in Cell Cultures. Curr. Issues Mol. Biol. 2023, 45, 6903-6915. https://doi.org/10.3390/cimb45080435
Carrillo-Ávila JA, de la Fuente A, Aguilar-Quesada R, Ligero G, del Río-Ortiz JM, Catalina P. Development and Evaluation of a New qPCR Assay for the Detection of Mycoplasma in Cell Cultures. Current Issues in Molecular Biology. 2023; 45(8):6903-6915. https://doi.org/10.3390/cimb45080435
Chicago/Turabian StyleCarrillo-Ávila, José A., Amanda de la Fuente, Rocío Aguilar-Quesada, Gertrudis Ligero, Juan Manuel del Río-Ortiz, and Purificación Catalina. 2023. "Development and Evaluation of a New qPCR Assay for the Detection of Mycoplasma in Cell Cultures" Current Issues in Molecular Biology 45, no. 8: 6903-6915. https://doi.org/10.3390/cimb45080435
APA StyleCarrillo-Ávila, J. A., de la Fuente, A., Aguilar-Quesada, R., Ligero, G., del Río-Ortiz, J. M., & Catalina, P. (2023). Development and Evaluation of a New qPCR Assay for the Detection of Mycoplasma in Cell Cultures. Current Issues in Molecular Biology, 45(8), 6903-6915. https://doi.org/10.3390/cimb45080435