Next Article in Journal
The Expression of Testin, Ki-67 and p16 in Cervical Cancer Diagnostics
Next Article in Special Issue
Expressions of Type I and III Interferons, Endogenous Retroviruses, TRIM28, and SETDB1 in Children with Respiratory Syncytial Virus Bronchiolitis
Previous Article in Journal
OPA1 Dominant Optic Atrophy: Diagnostic Approach in the Pediatric Population
Previous Article in Special Issue
Glutathione and Its Metabolic Enzymes in Gliomal Tumor Tissue and the Peritumoral Zone at Different Degrees of Anaplasia
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Protective Effect of Vitamin D against Hepatic Molecular Apoptosis Caused by a High-Fat Diet in Rats

by
Huda F. Alshaibi
1,2,*,
Sherin Bakhashab
1,3,
Asma Almuhammadi
4,5,
Yusuf S. Althobaiti
6,7,
Mohammed A. Baghdadi
8 and
Khadeejah Alsolami
6
1
Department of Biochemistry, Faculty of Sciences, King Abdulaziz University, Jeddah 21589, Saudi Arabia
2
Embryonic Stem Cell Unit, King Fahd Medical Research Center, King Abdulaziz University, Jeddah 21589, Saudi Arabia
3
Center of Excellence in Genomic Medicine Research, King Abdulaziz University, Jeddah 21589, Saudi Arabia
4
Department of Biological Sciences, Faculty of Sciences, King Abdulaziz University, Jeddah 21589, Saudi Arabia
5
Biology Department, College of Science, Jouf University, P.O. Box 2014, Sakaka 72388, Saudi Arabia
6
Department of Pharmacology and Toxicology, College of Pharmacy, Taif University, P.O. Box 11099, Taif 21944, Saudi Arabia
7
Addiction and Neuroscience Research Unit, Taif University, Taif 21944, Saudi Arabia
8
Research Center, King Faisal Specialist Hospital and Research Center, Jeddah 21589, Saudi Arabia
*
Author to whom correspondence should be addressed.
Curr. Issues Mol. Biol. 2023, 45(1), 479-489; https://doi.org/10.3390/cimb45010031
Submission received: 6 December 2022 / Revised: 27 December 2022 / Accepted: 31 December 2022 / Published: 5 January 2023
(This article belongs to the Special Issue Metabolic Reprogramming of Immune Cells in Tumor Microenvironment)

Abstract

The protective effects of vitamin D (VitD) in different diseases were studied. The liver is of great interest, especially with the presence of VitD receptors. A high-fat diet (HFD) is associated with many diseases, including liver injury. Consumption of saturated fatty acids triggers hepatic apoptosis and is associated with increased inflammation. We aimed in this study to investigate the protective effects of VitD on hepatic molecular apoptotic changes in response to an HFD in rats. Forty male Wistar albino rats were used and divided into four groups: control, HFD, control + VitD, and VitD-supplemented HFD (HFD + VitD) groups. After six months, the rats were sacrificed, and the livers were removed. RNA was extracted from liver tissues and used for the quantitative real-time RT-PCR of different genes: B-cell lymphoma/leukemia-2 (BCL2), BCL-2-associated X protein (Bax), Fas cell surface death receptor (FAS), FAS ligand (FASL), and tumor necrosis factor α (TNF-α). The results showed that an HFD increased the expression of the pro-apoptotic genes Bax, FAS, and FASL, and reduced the expression of the anti-apoptotic gene BCL2. Interestingly, a VitD-supplemented HFD significantly increased the BCL2 expression and decreased the expression of all pro-apoptotic genes and TNFα. In conclusion, VitD has a protective role against hepatic molecular apoptotic changes in response to an HFD.

1. Introduction

Liver damage can be triggered by different factors, such as alcohol intake, viral infection, drug abuse, and the consumption of a fat-rich diet, particularly saturated fatty acids [1,2,3,4]. Saturated fatty acids accumulate in hepatocytes, resulting in cell death via various death modes, including apoptosis, necrosis, and necroptosis [5,6,7].
Apoptosis primarily occurs through two main mechanisms that involve either the internal mitochondrial intrinsic pathway or the external death receptor extrinsic pathway [8]. The pro-apoptotic protein B-cell lymphoma/leukemia-2 (Bcl2)-associated X protein (Bax) mediates the mitochondrial intrinsic pathway by a series of cascade signal transduction pathways that end by activating caspase-9, which is the promoter of the intrinsic pathway. In contrast, Bcl2 acts as an anti-apoptotic protein in this process [9]. The death receptor pathway is mediated by various proteins that belong to the tumor necrosis factor (TNF) superfamily, including FAS and TNF receptor type 1 (TNFR1) [10]. Once TNF-α binds to its receptor, it recruits the TNFR1-associated death domain (TRADD) adapter protein [10]. This activation of TNFR1 triggers the formation of several signaling complexes called Complex I, IIa, IIb, and IIc, and each one of these complexes is responsible for specific cellular responses [11,12]. Complex I, for example, results in the activation of nuclear factor kB (NF-kB) and mitogen-activated protein kinases (MAPKs), thus resulting in inducing inflammation, cellular proliferation, and cellular survival [12,13,14,15]. Complex IIa and Complex IIb activate caspase-8, which is the promoter of the extrinsic apoptosis pathway [9,16]. Complex IIc consists of receptor-interacting serine/threonine protein kinase 1 (RIPK1) and receptor-interacting serine/threonine protein kinase 3 (RIPK3). This complex activates the mixed lineage kinase domain-like protein (MLKL). The outcome of this signaling cascade is the induction of necroptosis and inflammation [16,17]. In addition, TNF-α acts as an important inflammatory cytokine synthesized in response to the presence of reactive oxygen species and impaired α-oxidation enzymes due to the consumption of a high-fat diet (HFD) [18,19,20]. Thus, it can cause both hepatocyte apoptosis and necroptosis, which may result in chronic liver inflammation, creating a vicious cycle [19,21].
Vitamin D (VitD) was previously mainly linked with calcium/phosphorus homeostasis, bone health, and growth. However, in the last few decades, VitD has become known to be associated with various cellular functions, such as cellular proliferation, differentiation, immunomodulation, and apoptosis [22,23]. Therefore, many studies have focused on the protective role of VitD in several diseases, including hypertension, diabetes, cardiovascular disease, and many more [22,24,25,26]. The role of VitD in hepatic pathophysiology and its progression has attracted attention after studies have reported the upregulation of VitD receptors (VDR) in injured hepatocytes such as hepatocellular carcinoma and nonalcoholic fatty liver disease (NAFLD) compared with normal hepatocytes [27,28,29,30].
However, studies on this topic remain limited. Therefore, this study aims to investigate the protective role of VitD on hepatic molecular apoptotic changes in response to an HFD in rats.

2. Materials and Methods

2.1. Animals

Male Wistar albino rats (n = 40; weighing 150–200 g) were used in this study. The rats were obtained from King Fahad Medical Research Centre, Jeddah, Saudi Arabia, and kept in the animal house unit during the time of the study. The rats were housed under a standard laboratory temperature (23 °C ± 3 °C) and humidity, and a natural 12 h:12 h light/dark cycle, with free access to water ad libitum. All animals were kept under conditions that prevented them from experiencing unnecessary pain and discomfort according to the standard guidelines of the European College of Laboratory Animal Medicine. The study was approved by the Ethical Committee of the Faculty of Medicine, King Abdulaziz University, Jeddah, Saudi Arabia (reference number 369-16).

2.2. Diets and VitD

A standard diet and an HFD were acquired from Research Diets Inc., New Brunswick, NJ, USA, and the composition of both diets is listed in Table 1. VitD was purchased from Sigma-Aldrich Co., St. Louis, MO, USA.

2.3. Experimental Design

After 1 week of acclimatization, the rats were randomly divided into the following groups:
Group I (control; C): rats in this group received the standard diet for 6 months (n = 10).
Group II (control + VitD): rats in this group received the standard diet for six months and were co-administered with vitamin D by gavage in a dose of 400 IU/kg/day for six months (n = 10).
Group II (HFD): rats in this group received an HFD for 6 months (n = 10).
Group III (HFD + VitD): rats in this group received the HFD for 6 months and were co-administered with VitD by oral gavage in a dose of 400 IU/kg/day [31,32] (n = 10).
Food intake was monitored throughout the study. Body weight and body length (oral to anus length, OA) were measured at the beginning to assess body mass index (BMI) (body weight [g] / the square of OA length [cm2]). This procedure was repeated every 45 days and at the end of the experiment [33]. After 6 months, the rats were sacrificed under anesthesia using diethyl ether. The livers were removed and washed with normal saline. RNA was preserved for quantitative real-time polymerase chain reaction (qRT-PCR) assessment.

2.4. qRT-PCR

Total RNA was extracted from liver tissues using an RNAeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The FAS and FAS ligand (FASL) genes and the Bax, Bcl2, and TNFα genes were selected for the extrinsic and intrinsic apoptotic pathways, respectively.
Total RNA (5 μg) was reverse transcribed into cDNA in a final reaction mix of 20 μL using a reverse kit (ImProm-IITm Reverse Transcription System, Promega, Madison, WI, USA, cat no. A3800), according to the manufacturer’s instructions. The reaction was conducted on a thermal cycler with the following cycling conditions: 25 °C for 5 min, 42 °C for 120 min, and 70 °C for 15 min.
qRT-PCR was performed on a StepOne plus Real-Time PCR system (Thermo Fisher Scientific, Waltham, MA, USA) in a 20 μL reaction mix containing 2 μL of cDNA, 10 μL of EverGreen Universal qPCR Master Mix (2X) (Haven Scientific, Jeddah, Saudi Arabia), 6 μL of DNase/RNase-free water (Thermo Fisher Scientific), and 1 μL of each forward/reverse primer of the target and reference genes (Macrogen, Seoul, Republic of Korea). The list of primer genes is shown in Table 2. Thermocycling was conducted at 95 °C for 2 min, followed by 40 cycles at 95 °C for 15 s, and 60 °C for 1 min. All samples were performed in triplicate. The relative gene expression of each target gene was quantified using the 2−ΔΔCT method, which was normalized to the reference gene for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The fold change was calculated using the equation ∆dct/3.3 × −10, ∆dct/3.3 ×−10 [34].

2.5. Statistical Analyses

The data were processed using GraphPad Prism 9 (GraphPad Software, Inc., La Jolla, CA, USA), and the results were presented as the mean ± SEM. Statistical significance was tested using one-way analysis of variance (ANOVA) and Šídák’s multiple comparison test to identify the significant differences between groups. A p-value of <0.05 was considered significant.

3. Results

3.1. BMI of HFD and HFD + VitD Groups

At the end of the 6 months, the body weight, OA length, and BMI were not significantly different compared with the controls, as shown in Table 3.

3.2. qRT-PCR

3.2.1. Intrinsic Apoptotic Pathway Genes

There was no significant difference between the control group and the control group supplemented with VitD in the expression of both Bax and Bcl2. Gene expression of the intrinsic apoptotic signaling gene pro-apoptotic Bax and the anti-apoptotic gene Bcl2 were measured. At the end of the six months, the HFD significantly increased the expression of the pro-apoptotic gene Bax relative to the control (9.7-fold change, p = 0.013, one-way ANOVA, Šídák’s test). In contrast, the HFD decreased the expression of the anti-apoptotic gene Bcl2 (−4.2-fold change); however, this reduction was not significant. The rats given a combination of VitD and HFD exhibited a significant downregulation of the Bax gene toward the normal level (−1-fold change, p = 0.02), whereas Bcl2 was significantly upregulated (2.2-fold change, p ≤ 0.0001, one-way ANOVA, Šídák’s test), as shown in Figure 1A,B.

3.2.2. Extrinsic Apoptotic Pathway Genes

There was no significant difference between the control group and the control group supplemented with VitD in the expression of both FAS and FASL. Gene expression of the extrinsic apoptotic signaling genes FAS and FASL were measured. At the end of the six months, the HFD significantly increased the expression of both FAS and FASL genes relative to the control, with 63.4- and 6.9-fold changes, respectively (p ≤ 0.0001, p ≤ 0.0001, one-way ANOVA, Šídák’s test). However, in the HFD + VitD rats’ group, the expression of the FAS and FASL genes was at normal levels and significantly different relative to the rats in the HFD group, with −2.5- and −2.2-fold changes, respectively (p ≤ 0.0001, p ≤ 0.0001, one-way ANOVA, Šídák’s test) (Figure 2A,B).

3.3. TNF-α as an Inflammatory and Apoptotic Mediator

After six months, there was no significant difference between the control group and the control group supplemented with VitD in the expression of TNF-α, while the expression of TNF-α increased in rats in the HFD group significantly (1.8-fold change p = 0.03, one-way ANOVA, Šídák’s test). In contrast, in the HFD + VitD group, the expression was significantly downregulated relative to the group fed with the HFD (−2.7-fold change, p = 0.0006, one-way ANOVA, Šídák’s test), as shown in Figure 3.

4. Discussion

Chronic consumption of an HFD, particularly saturated fatty acids, is strongly associated with hepatocyte apoptosis [35]. Both the intrinsic mitochondrial pathway and the extrinsic death receptor pathway are stimulated by an HFD. The present study showed the protective effect of VitD against molecular apoptotic changes in rats fed an HFD for 6 months.
No significant changes were found in body weight and BMI between HFD- (45% fat) and HFD + VitD-fed rats relative to the control group. These results were similar to the study carried out by Ramalho et al. 2017, suggesting that an HFD is linked to hyperinsulinemia and insulin resistance without developing obesity [36].
In this study, we showed that an HFD stimulated the intrinsic apoptosis pathway of hepatocytes, indicated by the significant increase in the gene expression of the pro-apoptotic gene Bax and the decreased gene expression of the anti-apoptotic gene Bcl2 relative to the control group. Other studies reported the redistribution of Cathepsin B into the cytoplasm by enhancing the translocation of Bax to lysosomes in response to an HFD [37,38]. In addition, free fatty acids increase lysosomal permeabilization, which may lead to mitochondrial dysfunction, thus demonstrating the role of exogenous fat on lysosomes in the initiation of the intrinsic apoptotic pathway [38,39]. An HFD supplemented with VitD decreased the gene expression of Bax and increased the gene expression of Bcl2 back to a normal level compared to the control. These results suggest a protective effect of VitD in an HFD. The same protective effect of VitD has been previously reported [40]. In addition, a recent study has investigated the role of VitD in non-alcoholic fatty liver disease in rats and reported a similar result found in our study: VitD injection enhances the expression of Bcl2 compared to the group fed only with an HFD [41].
The harmful effect of the HFD on triggering apoptosis was not only limited to the activation of the intrinsic pathway, as mentioned earlier, but was also involved in activating the extrinsic pathway. This finding was based on the significant increase in both FAS and FASL gene expression in the HFD-fed rats. This increase in gene expression was significantly reduced in the group receiving the VitD-supplemented HFD. To our knowledge, the protective effect of VitD on the extrinsic apoptotic genes FAS and FASL was not investigated in the liver before. However, several studies have reported the same protective effect of VitD against pathological changes in extrinsic gene expression pathways in different organs, including the heart and spleen [31,42,43,44].
Feeding rats with an HFD not only induced the gene expression of intrinsic and extrinsic apoptosis but also increased the hepatic expression of the inflammatory cytokine TNF-α compared to the control. Thus, increased apoptosis could be one of the suggested mechanisms that can cause liver inflammation and vice versa. The expressions of both FAS and TNF-α are elevated in liver biopsy samples collected from NAFL patients and in hepatocyte cell lines treated with free fatty acids [45,46]. Accordingly, hepatocyte apoptosis is thoroughly associated with hepatic inflammation and fibrosis [47,48]. We found that VitD significantly reduced the gene expression of TNF-α compared to the HFD-fed group, which is consistent with several other studies that reported the anti-inflammatory activity of VitD [40,41,49,50]. However, the protective effect of VitD was only associated with the HFD but had no protective role in the normal control group since there were no differences between the two control groups in all studied genes.
Several suggested mechanisms may explain the protective role of VitD against inflammation and apoptosis, and one of these mechanisms is through binding with specific VDR, as reported previously [38]. Another suggested mechanism is that VitD downregulates the toll-like receptor 4-mediated inflammatory pathway, which may be activated by an HFD and fatty acid deposition in the liver [51,52].

5. Conclusions

Our results showed that feeding rats an HFD for 6 months increased both intrinsic and extrinsic apoptotic gene expressions; however, body weight was not increased. In addition, it increased the inflammatory cytokine TNF-α, which may also induce the shared intracellular pathway between apoptosis and necrosis, called necroptosis. VitD supplementation was effective in inhibiting apoptosis and inflammation by reducing the expression of Bax, FAS, FASL, and TNF-α, as well as decreasing the expression of Bcl2. The limitation of this study was the lack of funds. However, future studies are required where more apoptotic genes may be studied, as well as investigating the protective role of VitD in reducing hepatic apoptosis and inflammation in response to an HFD at the cellular level.

Author Contributions

Conceptualization, Y.S.A. and M.A.B.; data curation, S.B.; formal analysis, H.F.A.; funding acquisition, K.A.; methodology, H.F.A. and M.A.B.; project administration, K.A.; resources, A.A.; software, H.F.A.; supervision, Y.S.A.; validation, S.B.; visualization, S.B.; writing—original draft, H.F.A.; writing—review and editing, A.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The animal study protocol was approved by the Unit of Biomedical Ethics Research Committee of King Abdulaziz University (Reference No 369-16, 2016).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors wish to thank everyone who contributed to the completion of this research, especially the Embryonic Stem Cell Unit, King Fahd Medical Research Center, King Abdulaziz University, and King Faisal Specialist Hospital and Research Centre in Jeddah, where this study was conducted.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Eccleston, H.B.; Andringa, K.K.; Betancourt, A.M.; King, A.L.; Mantena, S.K.; Swain, T.M.; Tinsley, H.N.; Nolte, R.N.; Nagy, T.R.; Abrams, G.A.; et al. Chronic exposure to a high-fat diet induces hepatic steatosis, impairs nitric oxide bioavailability, and modifies the mitochondrial proteome in mice. Antioxid. Redox Signal. 2011, 15, 447–459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Smith, P.G.; Tee, L.B.; Yeoh, G.C. Appearance of oval cells in the liver of rats after long-term exposure to ethanol. Hepatology 1996, 23, 145–154. [Google Scholar] [CrossRef] [PubMed]
  3. Sun, C.; Jin, X.L.; Xiao, J.C. Oval cells in hepatitis B virus-positive and hepatitis C virus-positive liver cirrhosis: Histological and ultrastructural study. Histopathology 2006, 48, 546–555. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Waldhauser, K.M.; Török, M.; Ha, H.R.; Thomet, U.; Konrad, D.; Brecht, K.; Follath, F.; Krähenbühl, S. Hepatocellular toxicity and pharmacological effect of amiodarone and amiodarone derivatives. J. Pharmacol. Exp. Ther. 2006, 319, 1413–1423. [Google Scholar] [CrossRef] [Scilit]
  5. Neuman, M.G.; Cameron, R.G.; Haber, J.A.; Katz, G.G.; Malkiewicz, I.M.; Shear, N.H. Inducers of cytochrome P450 2E1 enhance methotrexate-induced hepatocytoxicity. Clin. Biochem. 1999, 32, 519–536. [Google Scholar] [CrossRef] [Scilit]
  6. Machado, M.V.; Michelotti, G.A.; Jewell, M.L.; Pereira, T.A.; Xie, G.; Premont, R.T.; Diehl, A.M. Caspase-2 promotes obesity, the metabolic syndrome and nonalcoholic fatty liver disease. Cell Death Dis. 2016, 7, e2096. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Machado, M.V.; Michelotti, G.A.; Pereira Tde, A.; Boursier, J.; Kruger, L.; Swiderska-Syn, M.; Karaca, G.; Xie, G.; Guy, C.D.; Bohinc, B.; et al. Reduced lipoapoptosis, hedgehog pathway activation and fibrosis in caspase-2 deficient mice with non-alcoholic steatohepatitis. Gut 2015, 64, 1148–1157. [Google Scholar] [CrossRef] [Scilit]
  8. Alkhouri, N.; Carter-Kent, C.; Feldstein, A.E. Apoptosis in nonalcoholic fatty liver disease: Diagnostic and therapeutic implications. Expert Rev. Gastroenterol. Hepatol. 2011, 5, 201–212. [Google Scholar] [CrossRef] [Scilit]
  9. Zhao, P.; Sun, X.; Chaggan, C.; Liao, Z.; In Wong, K.; He, F.; Singh, S.; Loomba, R.; Karin, M.; Witztum, J.L.; et al. An AMPK-caspase-6 axis controls liver damage in nonalcoholic steatohepatitis. Science 2020, 367, 652–660. [Google Scholar] [CrossRef] [Scilit]
  10. Pobezinskaya, Y.L.; Liu, Z. The role of TRADD in death receptor signaling. Cell Cycle 2012, 11, 871–876. [Google Scholar] [CrossRef] [Scilit]
  11. Pasparakis, M.; Vandenabeele, P. Necroptosis and its role in inflammation. Nature 2015, 517, 311–320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Brenner, D.; Blaser, H.; Mak, T.W. Regulation of tumour necrosis factor signalling: Live or let die. Nat. Rev. Immunol. 2015, 15, 362–374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Gerlach, B.; Cordier, S.M.; Schmukle, A.C.; Emmerich, C.H.; Rieser, E.; Haas, T.L.; Webb, A.I.; Rickard, J.A.; Anderton, H.; Wong, W.W.; et al. Linear ubiquitination prevents inflammation and regulates immune signalling. Nature 2011, 471, 591–596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Haas, T.L.; Emmerich, C.H.; Gerlach, B.; Schmukle, A.C.; Cordier, S.M.; Rieser, E.; Feltham, R.; Vince, J.; Warnken, U.; Wenger, T.; et al. Recruitment of the linear ubiquitin chain assembly complex stabilizes the TNF-R1 signaling complex and is required for TNF-mediated gene induction. Mol. Cell 2009, 36, 831–844. [Google Scholar] [CrossRef] [Scilit]
  15. Aggarwal, B.B.; Gupta, S.C.; Kim, J.H. Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey. Blood 2012, 119, 651–665. [Google Scholar] [CrossRef] [Scilit]
  16. Holbrook, J.; Lara-Reyna, S.; Jarosz-Griffiths, H.; McDermott, M. Tumour necrosis factor signalling in health and disease. F1000Research 2019, 8, 1–12. [Google Scholar] [CrossRef] [Scilit]
  17. Cho, Y.S.; Challa, S.; Moquin, D.; Genga, R.; Ray, T.D.; Guildford, M.; Chan, F.K. Phosphorylation-driven assembly of the RIP1-RIP3 complex regulates programmed necrosis and virus-induced inflammation. Cell 2009, 137, 1112–1123. [Google Scholar] [CrossRef] [Scilit]
  18. Tell, G.; Vascotto, C.; Tiribelli, C. Alterations in the redox state and liver damage: Hints from the EASL Basic School of Hepatology. J. Hepatol. 2013, 58, 365–374. [Google Scholar] [CrossRef] [Scilit]
  19. Pessayre, D.; Berson, A.; Fromenty, B.; Mansouri, A. Mitochondria in steatohepatitis. Semin. Liver Dis. 2001, 21, 57–69. [Google Scholar] [CrossRef] [Scilit]
  20. Pessayre, D.; Mansouri, A.; Fromenty, B. Nonalcoholic steatosis and steatohepatitis. V. Mitochondrial dysfunction in steatohepatitis. Am. J. Physiol. Gastrointest. Liver Physiol. 2002, 282, G193–G199. [Google Scholar] [CrossRef] [Scilit]
  21. Canbay, A.; Taimr, P.; Torok, N.; Higuchi, H.; Friedman, S.; Gores, G.J. Apoptotic body engulfment by a human stellate cell line is profibrogenic. Lab. Investig. 2003, 83, 655–663. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Lai, Y.H.; Fang, T.C. The pleiotropic effect of vitamin d. ISRN Nephrol. 2013, 2013, 898125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Zhang, A.; Wang, Y.; Xie, H.; Zheng, S. Calcitriol inhibits hepatocyte apoptosis in rat allograft by regulating apoptosis-associated genes. Int. Immunopharmacol. 2007, 7, 1122–1128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Cosentino, N.; Campodonico, J.; Milazzo, V.; De Metrio, M.; Brambilla, M.; Camera, M.; Marenzi, G. Vitamin D and Cardiovascular Disease: Current Evidence and Future Perspectives. Nutrients 2021, 13, 3603. [Google Scholar] [CrossRef] [Scilit]
  25. Khan, H.; Kunutsor, S.; Franco, O.H.; Chowdhury, R. Vitamin D, type 2 diabetes and other metabolic outcomes: A systematic review and meta-analysis of prospective studies. Proc. Nutr. Soc. 2013, 72, 89–97. [Google Scholar] [CrossRef] [Scilit]
  26. Lee, H.M.; Liu, M.; Lee, K.; Luo, Y.; Wong, N.D. Does low vitamin D amplify the association of COPD with total and cardiovascular disease mortality? Clin. Cardiol. 2014, 37, 473–478. [Google Scholar] [CrossRef] [Scilit]
  27. Li, Q.; Gao, Y.; Jia, Z.; Mishra, L.; Guo, K.; Li, Z.; Le, X.; Wei, D.; Huang, S.; Xie, K. Dysregulated Krüppel-Like Factor 4 and Vitamin D Receptor Signaling Contribute to Progression of Hepatocellular Carcinoma. Gastroenterology 2012, 143, 799–810. [Google Scholar] [CrossRef] [Scilit]
  28. Pourgholami, M.H.; Akhter, J.; Lu, Y.; Morris, D.L. In vitro and in vivo inhibition of liver cancer cells by 1,25-dihydroxyvitamin D3. Cancer Lett. 2000, 151, 97–102. [Google Scholar] [CrossRef] [Scilit]
  29. Bozic, M.; Guzmán, C.; Benet, M.; Sánchez-Campos, S.; García-Monzón, C.; Gari, E.; Gatius, S.; Valdivielso, J.M.; Jover, R. Hepatocyte vitamin D receptor regulates lipid metabolism and mediates experimental diet-induced steatosis. J. Hepatol. 2016, 65, 748–757. [Google Scholar] [CrossRef] [Scilit]
  30. Dong, B.; Zhou, Y.; Wang, W.; Scott, J.; Kim, K.; Sun, Z.; Guo, Q.; Lu, Y.; Gonzales, N.M.; Wu, H.; et al. Vitamin D Receptor Activation in Liver Macrophages Ameliorates Hepatic Inflammation, Steatosis, and Insulin Resistance in Mice. Hepatology 2020, 71, 1559–1574. [Google Scholar] [CrossRef] [Scilit]
  31. Al-Solami, K.M.; Al-refaie, Z.; Awad, H.; Rasool, M. Potential Protective Effect of Vitamin D on Cardiac Extrinsic pathways of apoptosis in Male Rats Fed with high fat diet. Genet. Mol. Res. 2019, 18, 1–7. [Google Scholar]
  32. Vieth, R. Why the optimal requirement for Vitamin D3 is probably much higher than what is officially recommended for adults. J. Steroid Biochem. Mol. Biol. 2004, 89–90, 575–579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Novelli, E.L.; Diniz, Y.S.; Galhardi, C.M.; Ebaid, G.M.; Rodrigues, H.G.; Mani, F.; Fernandes, A.A.; Cicogna, A.C.; Novelli Filho, J.L. Anthropometrical parameters and markers of obesity in rats. Lab. Anim. 2007, 41, 111–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
  35. Mei, S.; Ni, H.M.; Manley, S.; Bockus, A.; Kassel, K.M.; Luyendyk, J.P.; Copple, B.L.; Ding, W.X. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. J. Pharmacol. Exp. Ther. 2011, 339, 487–498. [Google Scholar] [CrossRef] [Scilit]
  36. Ramalho, L.; da Jornada, M.N.; Antunes, L.C.; Hidalgo, M.P. Metabolic disturbances due to a high-fat diet in a non-insulin-resistant animal model. Nutr. Diabetes 2017, 7, e245. [Google Scholar] [CrossRef] [Scilit]
  37. Hirsova, P.; Ibrabim, S.H.; Gores, G.J.; Malhi, H. Lipotoxic lethal and sublethal stress signaling in hepatocytes: Relevance to NASH pathogenesis. J. Lipid Res. 2016, 57, 1758–1770. [Google Scholar] [CrossRef] [Scilit]
  38. Li, Z.; Berk, M.; McIntyre, T.M.; Gores, G.J.; Feldstein, A.E. The lysosomal-mitochondrial axis in free fatty acid-induced hepatic lipotoxicity. Hepatology 2008, 47, 1495–1503. [Google Scholar] [CrossRef] [Scilit]
  39. Feldstein, A.E.; Werneburg, N.W.; Canbay, A.; Guicciardi, M.E.; Bronk, S.F.; Rydzewski, R.; Burgart, L.J.; Gores, G.J. Free fatty acids promote hepatic lipotoxicity by stimulating TNF-alpha expression via a lysosomal pathway. Hepatology 2004, 40, 185–194. [Google Scholar] [CrossRef] [Scilit]
  40. Seif, A.A.; Abdelwahed, D.M. Vitamin D ameliorates hepatic ischemic/reperfusion injury in rats. J. Physiol. Biochem. 2014, 70, 659–666. [Google Scholar] [CrossRef] [Scilit]
  41. Ibrahim, M.Y.; Ragi, M.M.; El-Hamid, A.; Heba, A.; Ayed, S. Study of the Role of Vitamin D in Non-Alcoholic Fatty Liver Disease in Male Albino Rats. Minia J. Med. Res. 2020, 31, 37–42. [Google Scholar] [CrossRef] [Scilit]
  42. Uberti, F.; Lattuada, D.; Morsanuto, V.; Nava, U.; Bolis, G.; Vacca, G.; Squarzanti, D.F.; Cisari, C.; Molinari, C. Vitamin D Protects Human Endothelial Cells From Oxidative Stress Through the Autophagic and Survival Pathways. J. Clin. Endocrinol. Metab. 2014, 99, 1367–1374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Zeng, X.; Yu, X.; Xiao, S.; Yao, H.; Zhu, J. Effects of 1,25-dihydroxyvitamin D3 on pathological changes in rats with diabetic cardiomyopathy. Lipids Health Dis. 2017, 16, 109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Mohamed, H.K. Effect of vitamin D on the spleen of adult male rats fed on diet with high fat: A histological and immunohistochemical study. Egypt. J. Histol. 2019, 42, 1001–1017. [Google Scholar] [CrossRef] [Scilit]
  45. Bechmann, L.; Kocabayoglu, P.; Sowa, J.; Sydor, S.; Best, J.; Schlattjan, M.; Beilfuss, A.; Schmitt, J.; Hannivoort, R.; Rust, C. Free fatty acids repress SHP activation and adiponectin counteracts bile acid induced liver injury in super-obese patients with NASH. Hepatology 2013, 57, 1394–1406. [Google Scholar] [CrossRef] [Scilit]
  46. Malhi, H.; Barreyro, F.J.; Isomoto, H.; Bronk, S.F.; Gores, G.J. Free fatty acids sensitise hepatocytes to TRAIL mediated cytotoxicity. Gut 2007, 56, 1124–1131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Moschen, A.R.; Wieser, V.; Tilg, H. Adiponectin: Key player in the adipose tissue-liver crosstalk. Curr. Med. Chem. 2012, 19, 5467–5473. [Google Scholar] [CrossRef] [Scilit]
  48. Zheng, H.; Li, S.; Ma, L.; Cheng, L.; Deng, C.; Chen, Z.; Xie, C.; Xiang, M.; Jiang, W.; Chen, L. A novel agonist of PPAR-γ based on barbituric acid alleviates the development of non-alcoholic fatty liver disease by regulating adipocytokine expression and preventing insulin resistance. Eur. J. Pharmacol. 2011, 659, 244–251. [Google Scholar] [CrossRef] [Scilit]
  49. El-Sherbiny, M.; Eldosoky, M.; El-Shafey, M.; Othman, G.; Elkattawy, H.A.; Bedir, T.; Elsherbiny, N.M. Vitamin D nanoemulsion enhances hepatoprotective effect of conventional vitamin D in rats fed with a high-fat diet. Chem.-Biol. Interact. 2018, 288, 65–75. [Google Scholar] [CrossRef] [Scilit]
  50. Al-ghamdi, H.A.; Al Fayez, F.F.; Bima, A.I.; Khawaji, T.M.; Elsamanoudy, A.Z. Study of Cellular Senescence and Vitamin D Deficiency in Nonalcoholic Fatty Liver Disease and The Potential Protective Effect of Vitamin D Supplementation. J. Clin. Exp. Hepatol. 2021, 11, 219–226. [Google Scholar] [CrossRef] [Scilit]
  51. Wang, H.; Zhang, Q.; Chai, Y.; Liu, Y.; Li, F.; Wang, B.; Zhu, C.; Cui, J.; Qu, H.; Zhu, M. 1,25(OH)2D3 downregulates the Toll-like receptor 4-mediated inflammatory pathway and ameliorates liver injury in diabetic rats. J. Endocrinol. Investig. 2015, 38, 1083–1091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Zhang, H.; Yang, N.; Wang, T.; Dai, B.; Shang, Y. Vitamin D reduces inflammatory response in asthmatic mice through HMGB1/TLR4/NF-κB signaling pathway. Mol. Med. Rep. 2018, 17, 2915–2920. [Google Scholar] [PubMed]
Figure 1. Gene expression of the intrinsic apoptotic signaling genes. (A) The gene expression of the pro-apoptotic Bax in rats fed with a normal diet (Control), a high-fat diet (HFD), and a vitamin D-supplemented HFD (HFD + VitD). Bax was significantly increased in the group fed with the HFD (p = 0.013) relative to the control. Combining vitamin D with the HFD downregulated the expression of this gene (p = 0.02). (B) The gene expression of the anti-apoptotic Bcl2. Combining VitD with the HFD caused a significant upregulation relative to the control and HFD groups (p = 0.0056, p ≤ 0.0001). Data were normalized to the reference gene GAPDH. All data were expressed as mean ± SEM. Data were considered significant if p < 0.05.
Figure 1. Gene expression of the intrinsic apoptotic signaling genes. (A) The gene expression of the pro-apoptotic Bax in rats fed with a normal diet (Control), a high-fat diet (HFD), and a vitamin D-supplemented HFD (HFD + VitD). Bax was significantly increased in the group fed with the HFD (p = 0.013) relative to the control. Combining vitamin D with the HFD downregulated the expression of this gene (p = 0.02). (B) The gene expression of the anti-apoptotic Bcl2. Combining VitD with the HFD caused a significant upregulation relative to the control and HFD groups (p = 0.0056, p ≤ 0.0001). Data were normalized to the reference gene GAPDH. All data were expressed as mean ± SEM. Data were considered significant if p < 0.05.
Cimb 45 00031 g001
Figure 2. Gene expression of the extrinsic apoptotic signaling genes. (A) The gene expression of FAS in rats fed a normal diet (Control), a high-fat diet (HFD), and a vitamin D-supplemented HFD (HFD + VitD). FAS was increased in the group fed with HFD (p ≤ 0.0001) compared with the control. Combining vitamin D with HFD caused this gene to be significantly downregulated (p ≤ 0.0001). (B) The gene expression of FAS ligand (FASL). The HFD increased the expression of FASL in comparison to the control (p ≤ 0.0001). Combining vitamin D with the HFD significantly downregulated this gene in comparison to the control (p ≤ 0.0001). Data were normalized to the reference gene GAPDH. All data were expressed as mean ± SEM. Data were considered significant if p < 0.05.
Figure 2. Gene expression of the extrinsic apoptotic signaling genes. (A) The gene expression of FAS in rats fed a normal diet (Control), a high-fat diet (HFD), and a vitamin D-supplemented HFD (HFD + VitD). FAS was increased in the group fed with HFD (p ≤ 0.0001) compared with the control. Combining vitamin D with HFD caused this gene to be significantly downregulated (p ≤ 0.0001). (B) The gene expression of FAS ligand (FASL). The HFD increased the expression of FASL in comparison to the control (p ≤ 0.0001). Combining vitamin D with the HFD significantly downregulated this gene in comparison to the control (p ≤ 0.0001). Data were normalized to the reference gene GAPDH. All data were expressed as mean ± SEM. Data were considered significant if p < 0.05.
Cimb 45 00031 g002
Figure 3. Tumor necrosis factor (TNF-α) gene expression. The high-fat diet (HFD) increased the expression of TNFα significantly (p = 0.03) compared to the control, whereas VitD supplementation with the HFD significantly decreased the expression of TNFα (p = 0.0006). Data were normalized to the reference gene GAPDH. All data were expressed as mean ± SEM. Data were considered significant if * p < 0.05, *** p < 0.001.
Figure 3. Tumor necrosis factor (TNF-α) gene expression. The high-fat diet (HFD) increased the expression of TNFα significantly (p = 0.03) compared to the control, whereas VitD supplementation with the HFD significantly decreased the expression of TNFα (p = 0.0006). Data were normalized to the reference gene GAPDH. All data were expressed as mean ± SEM. Data were considered significant if * p < 0.05, *** p < 0.001.
Cimb 45 00031 g003
Table 1. Standard diet and high-fat diet (HFD) composition.
Table 1. Standard diet and high-fat diet (HFD) composition.
Standard Diet, D12450HHFD D12451
Product Detailsgm%Kcl%gm%Kcl%
Protein19.2202420
Carbohydrate67.3704135
Fat4.3102445
Total-100-100
Kcl/gm3.58-4.73-
Table 2. Rat primers of all targeted genes used in the quantitative real-time polymerase chain reaction.
Table 2. Rat primers of all targeted genes used in the quantitative real-time polymerase chain reaction.
Rat PrimersForward PrimerReverse Primer
FASCTGATAGCATCTCTGAGGCTGATAGCATCTCTGAGG
FASLGACAACATAGAGCTGTGGGACAACATAGAGCTGTGG
BaxCTGGACAACAACATGGAGCCAGACGGCAACTTCAACTG
Bcl2AGTGGGATACTGGAGATGCTGGCTGTCTCTGAAGAC
TNFαCTTCTGTCTACTGAACTTCGCCAATGGCATGGATCTCAA
Table 3. Initial and final body weight, oral to anus (OA) length, and body mass index (BMI) after 6 months.
Table 3. Initial and final body weight, oral to anus (OA) length, and body mass index (BMI) after 6 months.
GroupInitial Rat Weight (gm)Initial AO Length (cm)BMI (g/cm2)Final Rat Weight (gm)Final OA Length (cm)BMI (g/cm2)
Control201.4 ± 9.520.704 ± 0.80.4710 ± 0.04534.4 ± 42.0325.5 ± 0.40.8218 ± 0.1
Control + VitD215.4 ± 13.421.6 ± 0.740.4620 ± 0.03512.4 ± 57.725.1 ± 0.420.8148 ± 0.1
HFD218.7 ± 7.221.45 ± 0.40.4755 ± 0.02521.8 ± 63.4224.95 ± 0.550.8383 ± 0.1
HFD + VitD230.4 ± 12.522.26 ± 0.60.4649 ± 0.02534 ± 33.2525.563 ± 0.50.8171 ± 0.04
Control + VitD: rats fed a regular diet treated with vitamin D. HFD: rats fed with a high-fat diet, HFD + VD: rats fed with a high-fat diet treated with vitamin D. Values were expressed as mean ± SD. Data were analyzed using an analysis of variance t-test. NS: not significant compared with the BMI value of the control rats.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Alshaibi, H.F.; Bakhashab, S.; Almuhammadi, A.; Althobaiti, Y.S.; Baghdadi, M.A.; Alsolami, K. Protective Effect of Vitamin D against Hepatic Molecular Apoptosis Caused by a High-Fat Diet in Rats. Curr. Issues Mol. Biol. 2023, 45, 479-489. https://doi.org/10.3390/cimb45010031

AMA Style

Alshaibi HF, Bakhashab S, Almuhammadi A, Althobaiti YS, Baghdadi MA, Alsolami K. Protective Effect of Vitamin D against Hepatic Molecular Apoptosis Caused by a High-Fat Diet in Rats. Current Issues in Molecular Biology. 2023; 45(1):479-489. https://doi.org/10.3390/cimb45010031

Chicago/Turabian Style

Alshaibi, Huda F., Sherin Bakhashab, Asma Almuhammadi, Yusuf S. Althobaiti, Mohammed A. Baghdadi, and Khadeejah Alsolami. 2023. "Protective Effect of Vitamin D against Hepatic Molecular Apoptosis Caused by a High-Fat Diet in Rats" Current Issues in Molecular Biology 45, no. 1: 479-489. https://doi.org/10.3390/cimb45010031

APA Style

Alshaibi, H. F., Bakhashab, S., Almuhammadi, A., Althobaiti, Y. S., Baghdadi, M. A., & Alsolami, K. (2023). Protective Effect of Vitamin D against Hepatic Molecular Apoptosis Caused by a High-Fat Diet in Rats. Current Issues in Molecular Biology, 45(1), 479-489. https://doi.org/10.3390/cimb45010031

Article Metrics

Back to TopTop