Protective Effect of Vitamin D against Hepatic Molecular Apoptosis Caused by a High-Fat Diet in Rats
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Diets and VitD
2.3. Experimental Design
2.4. qRT-PCR
2.5. Statistical Analyses
3. Results
3.1. BMI of HFD and HFD + VitD Groups
3.2. qRT-PCR
3.2.1. Intrinsic Apoptotic Pathway Genes
3.2.2. Extrinsic Apoptotic Pathway Genes
3.3. TNF-α as an Inflammatory and Apoptotic Mediator
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Eccleston, H.B.; Andringa, K.K.; Betancourt, A.M.; King, A.L.; Mantena, S.K.; Swain, T.M.; Tinsley, H.N.; Nolte, R.N.; Nagy, T.R.; Abrams, G.A.; et al. Chronic exposure to a high-fat diet induces hepatic steatosis, impairs nitric oxide bioavailability, and modifies the mitochondrial proteome in mice. Antioxid. Redox Signal. 2011, 15, 447–459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, P.G.; Tee, L.B.; Yeoh, G.C. Appearance of oval cells in the liver of rats after long-term exposure to ethanol. Hepatology 1996, 23, 145–154. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.; Jin, X.L.; Xiao, J.C. Oval cells in hepatitis B virus-positive and hepatitis C virus-positive liver cirrhosis: Histological and ultrastructural study. Histopathology 2006, 48, 546–555. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waldhauser, K.M.; Török, M.; Ha, H.R.; Thomet, U.; Konrad, D.; Brecht, K.; Follath, F.; Krähenbühl, S. Hepatocellular toxicity and pharmacological effect of amiodarone and amiodarone derivatives. J. Pharmacol. Exp. Ther. 2006, 319, 1413–1423. [Google Scholar] [CrossRef] [Scilit]
- Neuman, M.G.; Cameron, R.G.; Haber, J.A.; Katz, G.G.; Malkiewicz, I.M.; Shear, N.H. Inducers of cytochrome P450 2E1 enhance methotrexate-induced hepatocytoxicity. Clin. Biochem. 1999, 32, 519–536. [Google Scholar] [CrossRef] [Scilit]
- Machado, M.V.; Michelotti, G.A.; Jewell, M.L.; Pereira, T.A.; Xie, G.; Premont, R.T.; Diehl, A.M. Caspase-2 promotes obesity, the metabolic syndrome and nonalcoholic fatty liver disease. Cell Death Dis. 2016, 7, e2096. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Machado, M.V.; Michelotti, G.A.; Pereira Tde, A.; Boursier, J.; Kruger, L.; Swiderska-Syn, M.; Karaca, G.; Xie, G.; Guy, C.D.; Bohinc, B.; et al. Reduced lipoapoptosis, hedgehog pathway activation and fibrosis in caspase-2 deficient mice with non-alcoholic steatohepatitis. Gut 2015, 64, 1148–1157. [Google Scholar] [CrossRef] [Scilit]
- Alkhouri, N.; Carter-Kent, C.; Feldstein, A.E. Apoptosis in nonalcoholic fatty liver disease: Diagnostic and therapeutic implications. Expert Rev. Gastroenterol. Hepatol. 2011, 5, 201–212. [Google Scholar] [CrossRef] [Scilit]
- Zhao, P.; Sun, X.; Chaggan, C.; Liao, Z.; In Wong, K.; He, F.; Singh, S.; Loomba, R.; Karin, M.; Witztum, J.L.; et al. An AMPK-caspase-6 axis controls liver damage in nonalcoholic steatohepatitis. Science 2020, 367, 652–660. [Google Scholar] [CrossRef] [Scilit]
- Pobezinskaya, Y.L.; Liu, Z. The role of TRADD in death receptor signaling. Cell Cycle 2012, 11, 871–876. [Google Scholar] [CrossRef] [Scilit]
- Pasparakis, M.; Vandenabeele, P. Necroptosis and its role in inflammation. Nature 2015, 517, 311–320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brenner, D.; Blaser, H.; Mak, T.W. Regulation of tumour necrosis factor signalling: Live or let die. Nat. Rev. Immunol. 2015, 15, 362–374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gerlach, B.; Cordier, S.M.; Schmukle, A.C.; Emmerich, C.H.; Rieser, E.; Haas, T.L.; Webb, A.I.; Rickard, J.A.; Anderton, H.; Wong, W.W.; et al. Linear ubiquitination prevents inflammation and regulates immune signalling. Nature 2011, 471, 591–596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haas, T.L.; Emmerich, C.H.; Gerlach, B.; Schmukle, A.C.; Cordier, S.M.; Rieser, E.; Feltham, R.; Vince, J.; Warnken, U.; Wenger, T.; et al. Recruitment of the linear ubiquitin chain assembly complex stabilizes the TNF-R1 signaling complex and is required for TNF-mediated gene induction. Mol. Cell 2009, 36, 831–844. [Google Scholar] [CrossRef] [Scilit]
- Aggarwal, B.B.; Gupta, S.C.; Kim, J.H. Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey. Blood 2012, 119, 651–665. [Google Scholar] [CrossRef] [Scilit]
- Holbrook, J.; Lara-Reyna, S.; Jarosz-Griffiths, H.; McDermott, M. Tumour necrosis factor signalling in health and disease. F1000Research 2019, 8, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Cho, Y.S.; Challa, S.; Moquin, D.; Genga, R.; Ray, T.D.; Guildford, M.; Chan, F.K. Phosphorylation-driven assembly of the RIP1-RIP3 complex regulates programmed necrosis and virus-induced inflammation. Cell 2009, 137, 1112–1123. [Google Scholar] [CrossRef] [Scilit]
- Tell, G.; Vascotto, C.; Tiribelli, C. Alterations in the redox state and liver damage: Hints from the EASL Basic School of Hepatology. J. Hepatol. 2013, 58, 365–374. [Google Scholar] [CrossRef] [Scilit]
- Pessayre, D.; Berson, A.; Fromenty, B.; Mansouri, A. Mitochondria in steatohepatitis. Semin. Liver Dis. 2001, 21, 57–69. [Google Scholar] [CrossRef] [Scilit]
- Pessayre, D.; Mansouri, A.; Fromenty, B. Nonalcoholic steatosis and steatohepatitis. V. Mitochondrial dysfunction in steatohepatitis. Am. J. Physiol. Gastrointest. Liver Physiol. 2002, 282, G193–G199. [Google Scholar] [CrossRef] [Scilit]
- Canbay, A.; Taimr, P.; Torok, N.; Higuchi, H.; Friedman, S.; Gores, G.J. Apoptotic body engulfment by a human stellate cell line is profibrogenic. Lab. Investig. 2003, 83, 655–663. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lai, Y.H.; Fang, T.C. The pleiotropic effect of vitamin d. ISRN Nephrol. 2013, 2013, 898125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, A.; Wang, Y.; Xie, H.; Zheng, S. Calcitriol inhibits hepatocyte apoptosis in rat allograft by regulating apoptosis-associated genes. Int. Immunopharmacol. 2007, 7, 1122–1128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cosentino, N.; Campodonico, J.; Milazzo, V.; De Metrio, M.; Brambilla, M.; Camera, M.; Marenzi, G. Vitamin D and Cardiovascular Disease: Current Evidence and Future Perspectives. Nutrients 2021, 13, 3603. [Google Scholar] [CrossRef] [Scilit]
- Khan, H.; Kunutsor, S.; Franco, O.H.; Chowdhury, R. Vitamin D, type 2 diabetes and other metabolic outcomes: A systematic review and meta-analysis of prospective studies. Proc. Nutr. Soc. 2013, 72, 89–97. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.M.; Liu, M.; Lee, K.; Luo, Y.; Wong, N.D. Does low vitamin D amplify the association of COPD with total and cardiovascular disease mortality? Clin. Cardiol. 2014, 37, 473–478. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Gao, Y.; Jia, Z.; Mishra, L.; Guo, K.; Li, Z.; Le, X.; Wei, D.; Huang, S.; Xie, K. Dysregulated Krüppel-Like Factor 4 and Vitamin D Receptor Signaling Contribute to Progression of Hepatocellular Carcinoma. Gastroenterology 2012, 143, 799–810. [Google Scholar] [CrossRef] [Scilit]
- Pourgholami, M.H.; Akhter, J.; Lu, Y.; Morris, D.L. In vitro and in vivo inhibition of liver cancer cells by 1,25-dihydroxyvitamin D3. Cancer Lett. 2000, 151, 97–102. [Google Scholar] [CrossRef] [Scilit]
- Bozic, M.; Guzmán, C.; Benet, M.; Sánchez-Campos, S.; García-Monzón, C.; Gari, E.; Gatius, S.; Valdivielso, J.M.; Jover, R. Hepatocyte vitamin D receptor regulates lipid metabolism and mediates experimental diet-induced steatosis. J. Hepatol. 2016, 65, 748–757. [Google Scholar] [CrossRef] [Scilit]
- Dong, B.; Zhou, Y.; Wang, W.; Scott, J.; Kim, K.; Sun, Z.; Guo, Q.; Lu, Y.; Gonzales, N.M.; Wu, H.; et al. Vitamin D Receptor Activation in Liver Macrophages Ameliorates Hepatic Inflammation, Steatosis, and Insulin Resistance in Mice. Hepatology 2020, 71, 1559–1574. [Google Scholar] [CrossRef] [Scilit]
- Al-Solami, K.M.; Al-refaie, Z.; Awad, H.; Rasool, M. Potential Protective Effect of Vitamin D on Cardiac Extrinsic pathways of apoptosis in Male Rats Fed with high fat diet. Genet. Mol. Res. 2019, 18, 1–7. [Google Scholar]
- Vieth, R. Why the optimal requirement for Vitamin D3 is probably much higher than what is officially recommended for adults. J. Steroid Biochem. Mol. Biol. 2004, 89–90, 575–579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Novelli, E.L.; Diniz, Y.S.; Galhardi, C.M.; Ebaid, G.M.; Rodrigues, H.G.; Mani, F.; Fernandes, A.A.; Cicogna, A.C.; Novelli Filho, J.L. Anthropometrical parameters and markers of obesity in rats. Lab. Anim. 2007, 41, 111–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Mei, S.; Ni, H.M.; Manley, S.; Bockus, A.; Kassel, K.M.; Luyendyk, J.P.; Copple, B.L.; Ding, W.X. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. J. Pharmacol. Exp. Ther. 2011, 339, 487–498. [Google Scholar] [CrossRef] [Scilit]
- Ramalho, L.; da Jornada, M.N.; Antunes, L.C.; Hidalgo, M.P. Metabolic disturbances due to a high-fat diet in a non-insulin-resistant animal model. Nutr. Diabetes 2017, 7, e245. [Google Scholar] [CrossRef] [Scilit]
- Hirsova, P.; Ibrabim, S.H.; Gores, G.J.; Malhi, H. Lipotoxic lethal and sublethal stress signaling in hepatocytes: Relevance to NASH pathogenesis. J. Lipid Res. 2016, 57, 1758–1770. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Berk, M.; McIntyre, T.M.; Gores, G.J.; Feldstein, A.E. The lysosomal-mitochondrial axis in free fatty acid-induced hepatic lipotoxicity. Hepatology 2008, 47, 1495–1503. [Google Scholar] [CrossRef] [Scilit]
- Feldstein, A.E.; Werneburg, N.W.; Canbay, A.; Guicciardi, M.E.; Bronk, S.F.; Rydzewski, R.; Burgart, L.J.; Gores, G.J. Free fatty acids promote hepatic lipotoxicity by stimulating TNF-alpha expression via a lysosomal pathway. Hepatology 2004, 40, 185–194. [Google Scholar] [CrossRef] [Scilit]
- Seif, A.A.; Abdelwahed, D.M. Vitamin D ameliorates hepatic ischemic/reperfusion injury in rats. J. Physiol. Biochem. 2014, 70, 659–666. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, M.Y.; Ragi, M.M.; El-Hamid, A.; Heba, A.; Ayed, S. Study of the Role of Vitamin D in Non-Alcoholic Fatty Liver Disease in Male Albino Rats. Minia J. Med. Res. 2020, 31, 37–42. [Google Scholar] [CrossRef] [Scilit]
- Uberti, F.; Lattuada, D.; Morsanuto, V.; Nava, U.; Bolis, G.; Vacca, G.; Squarzanti, D.F.; Cisari, C.; Molinari, C. Vitamin D Protects Human Endothelial Cells From Oxidative Stress Through the Autophagic and Survival Pathways. J. Clin. Endocrinol. Metab. 2014, 99, 1367–1374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeng, X.; Yu, X.; Xiao, S.; Yao, H.; Zhu, J. Effects of 1,25-dihydroxyvitamin D3 on pathological changes in rats with diabetic cardiomyopathy. Lipids Health Dis. 2017, 16, 109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohamed, H.K. Effect of vitamin D on the spleen of adult male rats fed on diet with high fat: A histological and immunohistochemical study. Egypt. J. Histol. 2019, 42, 1001–1017. [Google Scholar] [CrossRef] [Scilit]
- Bechmann, L.; Kocabayoglu, P.; Sowa, J.; Sydor, S.; Best, J.; Schlattjan, M.; Beilfuss, A.; Schmitt, J.; Hannivoort, R.; Rust, C. Free fatty acids repress SHP activation and adiponectin counteracts bile acid induced liver injury in super-obese patients with NASH. Hepatology 2013, 57, 1394–1406. [Google Scholar] [CrossRef] [Scilit]
- Malhi, H.; Barreyro, F.J.; Isomoto, H.; Bronk, S.F.; Gores, G.J. Free fatty acids sensitise hepatocytes to TRAIL mediated cytotoxicity. Gut 2007, 56, 1124–1131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moschen, A.R.; Wieser, V.; Tilg, H. Adiponectin: Key player in the adipose tissue-liver crosstalk. Curr. Med. Chem. 2012, 19, 5467–5473. [Google Scholar] [CrossRef] [Scilit]
- Zheng, H.; Li, S.; Ma, L.; Cheng, L.; Deng, C.; Chen, Z.; Xie, C.; Xiang, M.; Jiang, W.; Chen, L. A novel agonist of PPAR-γ based on barbituric acid alleviates the development of non-alcoholic fatty liver disease by regulating adipocytokine expression and preventing insulin resistance. Eur. J. Pharmacol. 2011, 659, 244–251. [Google Scholar] [CrossRef] [Scilit]
- El-Sherbiny, M.; Eldosoky, M.; El-Shafey, M.; Othman, G.; Elkattawy, H.A.; Bedir, T.; Elsherbiny, N.M. Vitamin D nanoemulsion enhances hepatoprotective effect of conventional vitamin D in rats fed with a high-fat diet. Chem.-Biol. Interact. 2018, 288, 65–75. [Google Scholar] [CrossRef] [Scilit]
- Al-ghamdi, H.A.; Al Fayez, F.F.; Bima, A.I.; Khawaji, T.M.; Elsamanoudy, A.Z. Study of Cellular Senescence and Vitamin D Deficiency in Nonalcoholic Fatty Liver Disease and The Potential Protective Effect of Vitamin D Supplementation. J. Clin. Exp. Hepatol. 2021, 11, 219–226. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Zhang, Q.; Chai, Y.; Liu, Y.; Li, F.; Wang, B.; Zhu, C.; Cui, J.; Qu, H.; Zhu, M. 1,25(OH)2D3 downregulates the Toll-like receptor 4-mediated inflammatory pathway and ameliorates liver injury in diabetic rats. J. Endocrinol. Investig. 2015, 38, 1083–1091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.; Yang, N.; Wang, T.; Dai, B.; Shang, Y. Vitamin D reduces inflammatory response in asthmatic mice through HMGB1/TLR4/NF-κB signaling pathway. Mol. Med. Rep. 2018, 17, 2915–2920. [Google Scholar] [PubMed]



| Standard Diet, D12450H | HFD D12451 | |||
|---|---|---|---|---|
| Product Details | gm% | Kcl% | gm% | Kcl% |
| Protein | 19.2 | 20 | 24 | 20 |
| Carbohydrate | 67.3 | 70 | 41 | 35 |
| Fat | 4.3 | 10 | 24 | 45 |
| Total | - | 100 | - | 100 |
| Kcl/gm | 3.58 | - | 4.73 | - |
| Rat Primers | Forward Primer | Reverse Primer |
|---|---|---|
| FAS | CTGATAGCATCTCTGAGG | CTGATAGCATCTCTGAGG |
| FASL | GACAACATAGAGCTGTGG | GACAACATAGAGCTGTGG |
| Bax | CTGGACAACAACATGGAGC | CAGACGGCAACTTCAACTG |
| Bcl2 | AGTGGGATACTGGAGATG | CTGGCTGTCTCTGAAGAC |
| TNFα | CTTCTGTCTACTGAACTTCG | CCAATGGCATGGATCTCAA |
| Group | Initial Rat Weight (gm) | Initial AO Length (cm) | BMI (g/cm2) | Final Rat Weight (gm) | Final OA Length (cm) | BMI (g/cm2) |
|---|---|---|---|---|---|---|
| Control | 201.4 ± 9.5 | 20.704 ± 0.8 | 0.4710 ± 0.04 | 534.4 ± 42.03 | 25.5 ± 0.4 | 0.8218 ± 0.1 |
| Control + VitD | 215.4 ± 13.4 | 21.6 ± 0.74 | 0.4620 ± 0.03 | 512.4 ± 57.7 | 25.1 ± 0.42 | 0.8148 ± 0.1 |
| HFD | 218.7 ± 7.2 | 21.45 ± 0.4 | 0.4755 ± 0.02 | 521.8 ± 63.42 | 24.95 ± 0.55 | 0.8383 ± 0.1 |
| HFD + VitD | 230.4 ± 12.5 | 22.26 ± 0.6 | 0.4649 ± 0.02 | 534 ± 33.25 | 25.563 ± 0.5 | 0.8171 ± 0.04 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alshaibi, H.F.; Bakhashab, S.; Almuhammadi, A.; Althobaiti, Y.S.; Baghdadi, M.A.; Alsolami, K. Protective Effect of Vitamin D against Hepatic Molecular Apoptosis Caused by a High-Fat Diet in Rats. Curr. Issues Mol. Biol. 2023, 45, 479-489. https://doi.org/10.3390/cimb45010031
Alshaibi HF, Bakhashab S, Almuhammadi A, Althobaiti YS, Baghdadi MA, Alsolami K. Protective Effect of Vitamin D against Hepatic Molecular Apoptosis Caused by a High-Fat Diet in Rats. Current Issues in Molecular Biology. 2023; 45(1):479-489. https://doi.org/10.3390/cimb45010031
Chicago/Turabian StyleAlshaibi, Huda F., Sherin Bakhashab, Asma Almuhammadi, Yusuf S. Althobaiti, Mohammed A. Baghdadi, and Khadeejah Alsolami. 2023. "Protective Effect of Vitamin D against Hepatic Molecular Apoptosis Caused by a High-Fat Diet in Rats" Current Issues in Molecular Biology 45, no. 1: 479-489. https://doi.org/10.3390/cimb45010031
APA StyleAlshaibi, H. F., Bakhashab, S., Almuhammadi, A., Althobaiti, Y. S., Baghdadi, M. A., & Alsolami, K. (2023). Protective Effect of Vitamin D against Hepatic Molecular Apoptosis Caused by a High-Fat Diet in Rats. Current Issues in Molecular Biology, 45(1), 479-489. https://doi.org/10.3390/cimb45010031

