Study on the Role of MicroRNA-214 in the Rehabilitation of Cartilage in Mice with Exercise-Induced Traumatic Osteoarthritis
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Models
2.2. Experimental Grouping
2.3. Treadmill Exercise Protocol
2.4. Sampling
2.5. Micro-CT Scan
2.6. Histological Evaluation
2.7. RT-qPCR Detection
2.8. Cell Isolation and Culture
2.9. Cell Treatments Protocol
2.10. Cell Viability Assay
2.11. RT-qPCR Detection
2.12. Western Blot Analysis
2.13. Data Analysis
3. Results
3.1. The Effect of Exercise on the Weight of Mice
3.2. The Effect of Exercise on Articular Cartilage and Chondrocyte
3.3. The Effect of Exercise on the Subchondral Bone of Femoral Condyle
3.4. The Effect of Exercise on Articular Cartilage Metabolism and Inflammation Expression
3.5. The Effects of Exercise on the Expression of miR-214 and Related Downstream Genes in Articular Cartilage
3.6. Toluidine Blue O Staining and Chondrocyte Identification
3.7. The Cell Viability of Chondrocytes Stimulated with IL-1β at Different Concentrations
3.8. The Effects of Mechanical Strain on the Expression of miR-214 and OA-Related Genes in IL-1β-Treated Chondrocytes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Glyn-Jones, S.; Palmer, A.J.; Agricola, R.; Price, A.J.; Vincent, T.L.; Weinans, H.; Carr, A.J. Osteoarthritis. Lancet 2015, 386, 376–387. [Google Scholar] [CrossRef] [Scilit]
- Hunter, D.J.; Bierma-Zeinstra, S. Osteoarthritis. Lancet 2019, 393, 1745–1759. [Google Scholar] [CrossRef] [Scilit]
- Whittaker, J.L.; Roos, E.M. A pragmatic approach to prevent post-traumatic osteoarthritis after sport or exercise-related joint injury. Best Pract. Res. Clin. Rheumatol. 2019, 33, 158–171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Souza, R.B.; Baum, T.; Wu, S.; Feeley, B.T.; Kadel, N.; Li, X.; Link, T.M.; Majumdar, S. Effects of Unloading on Knee Articular Cartilage T1rho and T2 Magnetic Resonance Imaging Relaxation Times: A Case Series. J. Orthop. Sports Phys. Ther. 2012, 42, 511–520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hinterwimmer, S.; Krammer, M.; Krötz, M.; Gläser, C.; Baumgart, R.; Reiser, M.; Eckstein, F. Cartilage atrophy in the knees of patients after seven weeks of partial load bearing. Arthritis Care Res. 2004, 50, 2516–2520. [Google Scholar] [CrossRef] [Scilit]
- Vanwanseele, B.; Eckstein, F.; Knecht, H.; Stüssi, E.; Spaepen, A. Knee cartilage of spinal cord-injured patients displays progressive thinning in the absence of normal joint loading and movement. Arthritis Care Res. 2002, 46, 2073–2078. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fregly, B.J.; Besier, T.; Lloyd, D.; Delp, S.L.; Banks, S.; Pandy, M.; D’Lima, D. Grand challenge competition to predict in vivo knee loads. J. Orthop. Res. 2011, 30, 503–513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heinlein, B.; Kutzner, I.; Graichen, F.; Bender, A.; Rohlmann, A.; Halder, A.M.; Beier, A.; Bergmann, G. ESB clinical biomechanics award 2008: Complete data of total knee replacement loading for level walking and stair climbing measured in vivo with a follow-up of 6–10 months. Clin. Biomech. 2009, 24, 315–326. [Google Scholar] [CrossRef] [Scilit]
- Reilly, D.T.; Martens, M. Experimental Analysis of the Quadriceps Muscle Force and Patello-Femoral Joint Reaction Force for Various Activities. Acta Orthop. Scand. 1972, 43, 126–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, X.; Cao, H.; Wang, M.; Zou, J.; Wu, W. Moderate-intensity treadmill running relieves motion-induced post-traumatic osteoarthritis mice by up-regulating the expression of lncRNA H19. Biomed. Eng. Online 2021, 20, 1–22. [Google Scholar] [CrossRef] [Scilit]
- Iversen, M.D. Rehabilitation interventions for pain and disability in osteoarthritis: A review of interventions including exercise, manual techniques, and assistive devices. Orthop. Nurs. 2012, 31, 103–108. [Google Scholar] [CrossRef] [Scilit]
- Brockman, B.S.; Maupin, J.J.; Thompson, S.F.; Hollabaugh, K.M.; Thakral, R. Complication Rates in Total Knee Arthroplasty Performed for Osteoarthritis and Post-Traumatic Arthritis: A Comparison Study. J. Arthroplast. 2019, 35, 371–374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, C. Do NSAIDs affect the progression of osteoarthritis? Inflammation 2002, 26, 139–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nissen, S.E.; Yeomans, N.D.; Solomon, D.H.; Lüscher, T.F.; Libby, P.; Husni, M.E.; Graham, D.Y.; Borer, J.S.; Wisniewski, L.M.; Wolski, K.E.; et al. Cardiovascular Safety of Celecoxib, Naproxen, or Ibuprofen for Arthritis. N. Engl. J. Med. 2016, 375, 2519–2529. [Google Scholar] [CrossRef] [Scilit]
- García-Rayado, G.; Navarro, M.; Lanas, A. NSAID induced gastrointestinal damage and designing GI-sparing NSAIDs. Expert Rev. Clin. Pharmacol. 2018, 11, 1031–1043. [Google Scholar] [CrossRef] [Scilit]
- McAlindon, T.E.; Bannuru, R.R.; Sullivan, M.C.; Arden, N.K.; Berenbaum, F.; Bierma-Zeinstra, S.M.; Hawker, G.A.; Henrotin, Y.; Hunter, D.J.; Kawaguchi, H.; et al. OARSI guidelines for the non-surgical management of knee osteoarthritis. Osteoarthr. Cartil. 2014, 22, 363–388. [Google Scholar] [CrossRef] [Scilit]
- Sun, H.B. Mechanical loading, cartilage degradation, and arthritis. Ann. N. Y. Acad. Sci. 2010, 1211, 37–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tanaka, R.; Ozawa, J.; Kito, N.; Moriyama, H. Effects of exercise therapy on walking ability in individuals with knee osteoarthritis: A systematic review and meta-analysis of randomised controlled trials. Clin. Rehabil. 2015, 30, 36–52. [Google Scholar] [CrossRef] [Scilit]
- Aguiar, G.C.; Nascimento, M.R.D.; De Miranda, A.S.; Rocha, N.P.; Teixeira, A.L.; Scalzo, P.L. Effects of an exercise therapy protocol on inflammatory markers, perception of pain, and physical performance in individuals with knee osteoarthritis. Rheumatol. Int. 2014, 35, 525–531. [Google Scholar] [CrossRef] [Scilit]
- Holsgaard-Larsen, A.; Clausen, B.; Søndergaard, J.; Christensen, R.; Andriacchi, T.; Roos, E. The effect of instruction in analgesic use compared with neuromuscular exercise on knee-joint load in patients with knee osteoarthritis: A randomized, single-blind, controlled trial. Osteoarthr. Cartil. 2017, 25, 470–480. [Google Scholar] [CrossRef] [Scilit]
- Fransen, M.; McConnell, S.; Harmer, A.R.; Van Der Esch, M.; Simic, M.; Bennell, K.L. Exercise for osteoarthritis of the knee: A Cochrane systematic review. Br. J. Sports Med. 2015, 49, 1554–1557. [Google Scholar] [CrossRef] [Scilit]
- Allen, J.; Imbert, I.; Havelin, J.; Henderson, T.; Stevenson, G.; Liaw, L.; King, T. Effects of Treadmill Exercise on Advanced Osteoarthritis Pain in Rats. Arthritis Rheumatol. 2017, 69, 1407–1417. [Google Scholar] [CrossRef] [Scilit]
- Iijima, H.; Aoyama, T.; Ito, A.; Yamaguchi, S.; Nagai, M.; Tajino, J.; Zhang, X.; Kuroki, H. Effects of short-term gentle treadmill walking on subchondral bone in a rat model of instability-induced osteoarthritis. Osteoarthr. Cartil. 2015, 23, 1563–1574. [Google Scholar] [CrossRef] [Scilit]
- Halbwirth, F.; Niculescu-Morzsa, E.; Zwickl, H.; Bauer, C.; Nehrer, S. Mechanostimulation changes the catabolic phenotype of human dedifferentiated osteoarthritic chondrocytes. Knee Surg. Sports Traumatol. Arthrosc. 2014, 23, 104–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Yang, C.-S.; Nakashima, K.; Rana, T.M. Small RNA-mediated regulation of iPS cell generation. EMBO J. 2011, 30, 823–834. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karsenty, G.; Kronenberg, H.M.; Settembre, C. Genetic control of bone formation. Annu. Rev. Cell Dev. Biol. 2009, 25, 629–648. [Google Scholar] [CrossRef] [Scilit]
- Goldring, M.B. Chondrogenesis, chondrocyte differentiation, and articular cartilage metabolism in health and osteoarthritis. Ther. Adv. Musculoskelet. Dis. 2012, 4, 269–285. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, Y.; Guo, J.; Zhang, L.; Tong, X.; Zhang, S.; Zhou, X.; Zhang, M.; Chen, X.; Lei, L.; Li, H.; et al. MiR-214 Attenuates the Osteogenic Effects of Mechanical Loading on Osteoblasts. Endoscopy 2019, 40, 931–940. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, X.; Li, L.; Guo, J.; Zhang, L.; Yuan, Y.; Chen, B.; Sun, Z.; Xu, J.; Zou, J. Treadmill running exercise prevents senile osteoporosis and upregulates the Wnt signaling pathway in SAMP6 mice. Oncotarget 2016, 7, 71072–71086. [Google Scholar] [CrossRef] [Scilit]
- Beckett, J.; Jin, W.; Schultz, M.; Chen, A.; Tolbert, D.; Moed, B.R.; Zhang, Z. Excessive running induces cartilage degeneration in knee joints and alters gait of rats. J. Orthop. Res. Off. Publ. Orthop. Res. Soc. 2012, 30, 1604–1610. [Google Scholar] [CrossRef] [Scilit]
- Musumeci, G.; Trovato, F.M.; Pichler, K.; Weinberg, A.M.; Loreto, C.; Castrogiovanni, P. Extra-virgin olive oil diet and mild physical activity prevent cartilage degeneration in an osteoarthritis model: An in vivo and in vitro study on lubricin expression. J. Nutr. Biochem. 2013, 24, 2064–2075. [Google Scholar] [CrossRef] [Scilit]
- Gerwin, N.; Bendele, A.; Glasson, S.; Carlson, C. The OARSI histopathology initiative–recommendations for histological assessments of osteoarthritis in the rat. Osteoarthr. Cartil. 2010, 18, S24–S34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mankin, H.J.; Dorfman, H.; Lippiello, L.; Zarins, A. Biochemical and metabolic abnormalities in articular cartilage from osteo-arthritic human hips. II. Correlation of morphology with biochemical and metabolic data. J. Bone Jt. Surg. 1971, 53, 523–537. [Google Scholar] [CrossRef] [Scilit]
- Iijima, H.; Ito, A.; Nagai, M.; Tajino, J.; Yamaguchi, S.; Kiyan, W.; Nakahata, A.; Zhang, J.; Wang, T.; Aoyama, T.; et al. Physiological exercise loading suppresses post-traumatic osteoarthritis progression via an increase in bone morphogenetic proteins expression in an experimental rat knee model. Osteoarthr. Cartil. 2016, 25, 964–975. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abed, E.; Bouvard, B.; Martineau, X.; Jouzeau, J.-Y.; Reboul, P.; Lajeunesse, D. Elevated hepatocyte growth factor levels in osteoarthritis osteoblasts contribute to their altered response to bone morphogenetic protein-2 and reduced mineralization capacity. Bone 2015, 75, 111–119. [Google Scholar] [CrossRef] [Scilit]
- Zhen, G.; Wen, C.; Jia, X.; Li, Y.; Crane, J.; Mears, S.C.; Askin, F.B.; Frassica, F.J.; Chang, W.; Yao, J.; et al. Inhibition of TGF-β signaling in mesenchymal stem cells of subchondral bone attenuates osteoarthritis. Nat. Med. 2013, 19, 704–712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, X.; Cao, H.; Yuan, Y.; Wu, W. Biochemical Signals Mediate the Crosstalk between Cartilage and Bone in Osteoarthritis. BioMed Res. Int. 2020, 2020, 5720360–5720368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, L.; Chang, X.; Yao, W.; He, H.; Tang, Z.; Wu, J. MiR-214 inhibits knee osteoarthritis in rats through MAPK signaling pathway. Panminerva Med. 2019. online ahead of print. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.P.; Zhuang, H.T.; Xin, M.Y.; Zhou, Y.L. MiR-214 inhibits human mesenchymal stem cells differentiating into osteoblasts through targeting beta-catenin. Eur. Rev. Med. Pharmacol. Sci. 2017, 21, 4777–4783. [Google Scholar] [PubMed]
- Buchtova, M.; Oralova, V.; Aklian, A.; Masek, J.; Vesela, I.; Ouyang, Z.; Obadalova, T.; Konecna, Z.; Spoustova, T.; Pospisilova, T.; et al. Fibroblast growth factor and canonical WNT/beta-catenin signaling cooperate in suppression of chondrocyte differentiation in experimental models of FGFR signaling in cartilage. Biochim. Biophys Acta 2015, 1852, 839–850. [Google Scholar] [CrossRef] [Scilit]
- Ning, B.; Wang, P.; Pei, X.; Kang, Y.; Song, J.; Wang, D.; Ma, R. Dual function of β-catenin in articular cartilage growth and degeneration at different stages of postnatal cartilage development. Int. Orthop. 2012, 36, 655–664. [Google Scholar] [PubMed]
- Praxenthaler, H.; Kramer, E.; Weisser, M.; Hecht, N.; Fischer, J.; Grossner, T.; Richter, W. Extracellular matrix content and WNT/beta-catenin levels of cartilage determine the chondrocyte response to compressive load. Biochim Biophys Acta 2018, 1864, 851–859. [Google Scholar]
- Guo, Y.; Li, L.; Gao, J.; Chen, X.; Sang, Q. miR-214 suppresses the osteogenic differentiation of bone marrow-derived mesenchymal stem cells and these effects are mediated through the inhibition of the JNK and p38 pathways. Int. J. Mol. Med. 2016, 39, 71–80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, C.; Sun, W.; Zhang, P.; Ling, S.; Li, Y.; Zhao, D.; Pengfei, Z.; Wang, A.; Li, Q.; Song, J.; et al. miR-214 promotes osteoclastogenesis by targeting Pten/PI3k/Akt pathway. RNA Biol. 2015, 12, 343–353. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Groups | Abbreviations | Intervention Program | Sacrifice Age |
|---|---|---|---|
| Model control group (n = 8) | MC | 4 w nonintervention | 25 w |
| Model group(n = 8) | M | 4 w HITE | 25 w |
| Rehabilitation control group (n = 8) | RC | 8 w nonintervention | 30 w |
| Model + rehabilitation group (n = 8) | M + R | 4 w HITE + 4 w MITE | 30 w |
| Model + convalescent group (n = 8) | M + C | 4 w HITE + 4 w nonintervention | 30 w |
| Experiment Stages | Speed | Frequency | Slope | Time of Duration |
|---|---|---|---|---|
| Pre-adaptation | 0–20 m/min | 60 min each time; 5 times a week | 5° | 1 w |
| HITE Acceleration phase | 0–20 m/min | 10 min each time; 5 times a week | 5° | 4 w |
| HITE Uniform phase | 20 m/min | 60 min each time; 5 times a week | 5° | |
| HITE Deceleration stage | 20–0 m/min | 10 min each time; 5 times a week | 5° | |
| MITE | 8 m/min | 40 min each time; 5 times a week | 0° | 4 w |
| Primer | Forward Sequence (3′→5′) | Reverse Sequence (3′→5′) |
|---|---|---|
| miR-214 | ACAGCAGGCACAGACAGGC | |
| U6 | AACGCTTCACGAATTTGCGT | CAGAAGGAGGAGGCAGGAAGAGG |
| β-catenin | CCCAGTCCTTCACGCAAGA | CCCTCTGAGCCCTAGTCA |
| COL2A | TCGGCCCTCATCTCTACATC | GGCTCCCAGAACATCACCTA |
| MMP-13 | ACGTGTGGAGGTGAGGCATCC | GCAGAAGGCAGACCGCAATGG |
| TNF-α | AGGCTGCCCCGACTACGT | GACTTTCTCCTGGTATGAGATAGCAAA |
| IL-6 | CTGCAAGAGACTTCCATCCAG | AGTGGTATAGACAGGTCTGTTGG |
| ACAN | CACTCCTGCCTGCTATGGAATGC | CCTGGTGATGCTGGTGCTGTTAG |
| WNT1 | ACAGCGTTCATCCTCGCAATCACC | AAATCGTTGTTGTCACTGCAGCCC |
| β-actin | CGTTGACATCCGTAAAGACC | AACAGTCCGCCTAGAAGCAC |
| GAPDH | GTGTGAACGGATTTGGCCG | CCAGTAGACTCCACGACATA |
| Group | Abbreviation | Strain Intensity | Time | IL-1β Stimulation |
|---|---|---|---|---|
| Control group | C | - | - | - |
| IL-1β + 0 h strain group | IL-1β 0 h | - | - | 10%IL-1β |
| IL-1β + 1 h strain group | IL-1β 1 h | 10% | 1 h | 10%IL-1β |
| IL-1β + 2 h strain group | IL-1β 2 h | 10% | 2 h | 10%IL-1β |
| IL-1β + 4 h strain group | IL-1β 4 h | 10% | 4 h | 10%IL-1β |
| Group | BMD/mg HA·ccm−1 | BV/TV/% | Tb.N/mm−1 | Tb.Th/mm | Tb.Sp/mm |
|---|---|---|---|---|---|
| MC | 1007.017 ± 5.65 | 0.599 ± 0.02 | 6.48 ± 0.188 | 0. 110 ± 0.002 | 0.137 ± 0.006 |
| M | 1024.669 ± 13.75 | 0.636 ± 0.02 * | 6.58 ± 0.18 | 0.124 ± 0. 011 | 0.133 ± 0.008 |
| RC | 1034.46 ± 5.78 | 0.62 ± 0.02 | 6.72 ± 0.22 | 0. 115 ± 0.006 | 0.130 ± 0.006 |
| M + C | 1042.02 ± 7.86 # | 0.59 ± 0.02 ## | 6.42 ± 0.42 ## | 0. 111 ± 0.005 | 0.137 ± 0.009 # |
| M + R | 1056.40 ± 6.75 | 0.64 ± 0.02 | 7.14 ± 0.19 | 0. 121 ± 0. 009 | 0.128 ± 0.006 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, H.; Zhou, X.; Li, H.; Wang, M.; Wu, W.; Zou, J. Study on the Role of MicroRNA-214 in the Rehabilitation of Cartilage in Mice with Exercise-Induced Traumatic Osteoarthritis. Curr. Issues Mol. Biol. 2022, 44, 4100-4117. https://doi.org/10.3390/cimb44090281
Cao H, Zhou X, Li H, Wang M, Wu W, Zou J. Study on the Role of MicroRNA-214 in the Rehabilitation of Cartilage in Mice with Exercise-Induced Traumatic Osteoarthritis. Current Issues in Molecular Biology. 2022; 44(9):4100-4117. https://doi.org/10.3390/cimb44090281
Chicago/Turabian StyleCao, Hong, Xuchang Zhou, Hui Li, Miao Wang, Wei Wu, and Jun Zou. 2022. "Study on the Role of MicroRNA-214 in the Rehabilitation of Cartilage in Mice with Exercise-Induced Traumatic Osteoarthritis" Current Issues in Molecular Biology 44, no. 9: 4100-4117. https://doi.org/10.3390/cimb44090281
APA StyleCao, H., Zhou, X., Li, H., Wang, M., Wu, W., & Zou, J. (2022). Study on the Role of MicroRNA-214 in the Rehabilitation of Cartilage in Mice with Exercise-Induced Traumatic Osteoarthritis. Current Issues in Molecular Biology, 44(9), 4100-4117. https://doi.org/10.3390/cimb44090281

