Next Article in Journal
Developmental Cues and Molecular Drivers in Myelinogenesis: Revisiting Early Life to Re-Evaluate the Integrity of CNS Myelin
Next Article in Special Issue
Genome-Wide Association Study Reveals Candidate Genes for Root-Related Traits in Rice
Previous Article in Journal
Juglone from Walnut Produces Cardioprotective Effects against Isoproterenol-Induced Myocardial Injury in SD Rats
Previous Article in Special Issue
Rice Lesion Mimic Gene Cloning and Association Analysis for Disease Resistance
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Association Study of Partial Resistance to P. sojae in Wild Soybeans from Heilongjiang Province, China

1
Crop Tillage and Cultivation Institute of Heilongjiang Academy of Agricultural Sciences (HAAS), Harbin 150086, China
2
College of Agriculture, Nanjing Agricultural University, Nanjing 210095, China
*
Author to whom correspondence should be addressed.
Curr. Issues Mol. Biol. 2022, 44(7), 3194-3207; https://doi.org/10.3390/cimb44070221
Submission received: 10 May 2022 / Revised: 12 July 2022 / Accepted: 13 July 2022 / Published: 17 July 2022
(This article belongs to the Special Issue Functional Genomics and Comparative Genomics Analysis in Plants)

Abstract

:
Phytophthora root rot (PRR) is a destructive disease of soybeans (Glycine max (L.) Merr) caused by Phytophthora sojae (P. sojae). The most effective way to prevent the disease is growing resistant or tolerant varieties. Partial resistance provides a more durable resistance against the pathogen compared to complete resistance. Wild soybean (Glycine soja Sieb. & Zucc.) seems to be an extraordinarily important gene pool for soybean improvement due to its high level of genetic variation. In this study, 242 wild soybean germplasms originating from different regions of Heilongjiang province were used to identify resistance genes to P. sojae race 1 using a genome-wide association study (GWAS). A total of nine significant SNPs were detected, repeatedly associated with P. sojae resistance and located on chromosomes 1, 10, 12, 15, 17, 19 and 20. Among them, seven favorable allelic variations associated with P. sojae resistance were evaluated by a t-test. Eight candidate genes were predicted to explore the mechanistic hypotheses of partial resistance, including Glysoja.19G051583, which encodes an LRR receptor-like serine/threonine protein kinase protein, Glysoja.19G051581, which encodes a receptor-like cytosolic serine/threonine protein kinase protein. These findings will provide additional insights into the genetic architecture of P. sojae resistance in a large sample of wild soybeans and P. sojae-resistant breeding through marker-assisted selection.

1. Introduction

Phytophthora root rot (PRR), caused by the Phytophthora sojae pathogen, is one of the most destructive diseases of soybeans in world [1]. In China, PRR was first detected in Heilongjiang province in 1989. Subsequently, PRR spread to most soybean-producing areas, which caused significant yield losses each year [2,3]. Currently, the most effective ways to control PRR is to grow soybean cultivars, which confer resistance genes to P. sojae [4].
Two types of resistance to PRR have been reported in soybeans, including partial resistance, which is controlled by multiple genes, and complete resistance, which is mediated by the single dominant Rps resistance gene [5]. The management of PRR has primarily relied on single dominant resistance genes. A large amount of research on resistance-gene mapping has been conducted since the first resistance gene to P. sojae was identified in the 1950s [6]. To date, more than 33 Rps genes/alleles on 9 different soybean linkage groups/chromosomes have been identified and mapped: Rps1a, Rps1b, Rps1c, Rps1d, Rps1k, RpsYu25, and Rps7 were in linkage group N; Rps2 was in group J; Rps3a, Rps3b, Rps3c, and Rps8 were in group F; Rps4, Rps5, and Rps6 were in group G; and Rps1Su was in group O. Moreover, Rps12, RpsHN, RpsQ, RpsGZ, Rps14, and Rps11 were reported as resistance genes to P. sojae [7,8,9,10,11,12,13]. The Rps11 gene was located from Pi 594527 in chromosome 7 by using SNP genotyping [14]. Recently, a Phytophthora resistance gene RpsWy was mapped on chromosome 3 by high-throughput genome-wide sequencing [15]. Two candidate genes, Glyma.03G033700 and Glyma.03G033800, conferring PRR against race 1 were also identified on chromosome 3 using the Specific Locus Amplified Fragment Sequencing (SLAF-seq) approach [16]. A novel Phytophthora resistance gene, RpsZS18, was detected on chromosome 2 of the soybean cultivar Zaoshu18 [17]. RpsYD25 was predicted as a candidate gene and validated to be a diagnostic marker for P. sojae resistance breeding [18].
Complete resistance and partial resistance were not completely independent, the varieties with a complete resistance gene also had higher partial resistance levels. Partial resistance, known as horizontal resistance, was a quantitative trait controlled by QTL. Partial resistance could limit the spread of P. sojae in plant tissues and reduce the degree of root rot [19]. Recently, more than 70 quantitative trait loci (QTL) related to soybean partial resistance against P. sojae have been identified by genome-wide association studies (GWAS) [20]. Glyma.13g32980, Glyma.13g33900, and Glyma.13g33512 were identified on chromosome 13 by GWAS based on naturally occurring variations of 279 accessions from Yangtze–Huai soybean breeding germplasms [21]. A major QDRL (quantitative disease-resistance locus) on chromosome 18 (QDRL-18) was identified in PI 427105B and PI 427106, which represents a valuable resistance source for breeding programs [22]. Moreover, some genes, such as Glyma.01g32800, Glyma.01g32855, and Glyma.14g087500, which are likely involved in PRR resistance, were identified. These works lay a foundation for exploring the mechanism of P. sojae resistance [23,24,25]. However, even though the rapid shift in quantities of P. sojae limits the effectiveness of resistance genes, the durability of an Rps gene is generally only 8–15 years [3,26]. Therefore, researchers must continuously search for more valuable resistance sources to identify new resistance genes.
Wild genetic resources play a significant role in transferring traits of interest, such as disease and insect resistance, improved quality, abiotic stress tolerance, and manipulation in modes of reproduction [27,28]. China is the origin and diversification center of the wild soybean that possesses many agronomically beneficial traits, such as high protein and lipid contents, adaptation to harsh conditions, and resistance to insects and disease [29]. Serving as valuable genetic resources, wild soybean harbors a high level of genetic variation and is certainly an extraordinarily important gene pool for soybean improvement [30]. However, many soybean collections, but few wild soybeans, were screened for exploiting novel resistance or tolerance sources [31,32,33].
Hence, the objectives of this study are to (i) detect the genetic resource presenting resistance and possibly carrying candidate genes or alleles by screening 242 wild soybeans from different regions in Heilongjiang province, (ii) map the resistance gene through a genome-wide association study (GWAS), and (iii) identify the candidate genes and their functional markers for marker-assisted selection.

2. Materials and Methods

2.1. Plant Materials

The resistance evaluation and correlation analysis of 242 soybean germplasms were conducted. These resources were obtained from 13 different ecological regions in Heilongjiang province and sampled according to the principle of representative and balanced sampling. All the materials were self-bred.

2.2. Medium and P. sojae Strain Preparation

Preparation of medium and strains are shown as follows:
Formula for medium: carrots (200 g) were juiced, boiled (30 min), and filtered; the volume was fixed to 1000 mL; and then agar (20 g) was added. This was then sterilized at 120 °C for 20 min. The prepared medium was poured into culture dishes with a thickness of 0.6 cm.
Culture of strain: race 1 of P. sojae was placed in the incubator at 25 °C for dark culture for 7 days.

2.3. Pot Experiment

Before planting, the soil was packed into small bags for sterilization at 121 °C for 1h. The seed coat was gently cut and broken with a knife, then sterilized with 75% alcohol for 50 s, and rinsed with sterile water 3–5 times. A total of 5 seeds from each material were planted in a pot and this was repeated 3 times. After emergence, 3 seedlings with consistent growths were kept in each pot. After the first three compound leaves were fully spread, inoculation and identification could be started. The materials were planted in batches every 7 days, which was repeated 3 times, After identification, fresh leaves were sampled and stored in a −80 °C refrigerator for DNA extraction. The CTAB method was used for DNA extraction [34].

2.4. Inoculation Identification

The leaf inoculation method was used in this study [35]. The three compound leaves that spread first were obtained and placed in a tray pre-arranged with sterile gauze. Distilled water was sprayed onto the bottom of the tray to keep the gauze moist. Cut a 0.5 cm wound in the center of each leaf with a blade. Then, cut the cultivated fungal medium into 0.5 × 0.5 cm pieces and inoculate it on the leaf wound with the growth side facing upward. The culture medium with no fungus was taken as the control. The inoculation test was repeated 3 times. The culture conditions were 24 °C, 12 h of light, and the relative humidity was 100%. After 5 days of inoculation, the disease status of the inoculated leaves was investigated. The standard of resistance identification is shown in Table 1 [35]. The formula for calculating the infection rate is as follows: infection rate = number of infected leaves (yellowing, browning, or yellowing)/total number of inoculated leaves × 100%.

2.5. Genotype Data and Quality Control

Data analysis was performed via R software (3.6.1 the 1me4 packages were loaded). The best linear unbiased prediction (BLUP) was obtained from the three-batch resistance to P. sojae of 242 accessions. The BLUP was used as the phenotypic value for association analysis. The calculation of the broad sense heritability (h2) was obtained using the equation h2 = δg2/(δg2 + δe2), the variance of genetic variation and residual was calculated by the covariance of the genetic kinship matrix between individuals. Significant differences were evaluated by using one-way ANOVA and Duncan’s test at p ≤ 0.05. Tukey’s honest significant difference tests were conducted.
Genomic DNA was extracted by random disruption, DNA fragments were recovered, cluster was prepared by splicing, and enrichment amplification and sequencing were performed on Hiseq4000. The sequence data were compared with reference genome sequence by BWA software (0.7.17). When the level of mapping rate was below 70%, elimination was performed. SNPs were identified by Samtools (1.10) and Genome Analysis Toolkit (GATK4.0) [36]. SNP markers were excluded with a missing rate of >50% and a minor allele frequency (MAF) < 0.05.

2.6. Population Structure and Linkage Disequilibrium Analysis

The population heterozygosity (He), polymorphism information (PIC), and genetic diversity (π, θ) were calculated by VCF tools. The neighbor-joining tree was constructed using Phylip(3.5c). Population structure was calculated by fast structure [37]. Principal component analysis (PCA), which determines the population structure of G. soja accessions, was calculated using the R software package. The number of subgroups can be estimated by calculating the marginal likelihood. The pairwise linkage disequilibrium (LD) between SNP markers was calculated by using squared allele frequency correlations (r2) with PopLD decay.

2.7. Genome-Wide Association Analysis

The association analysis was performed with a general linear model (GLM) in GAPIT (3.0) [38]. The population structure was explained by PCA and the kinship was calculated by the Vanraden method [39].

2.8. Fluorescence Quantitative PCR Detection

The resistant and susceptible G. soja accessions were selected to screen differential expressions of candidate genes by fluorescence quantitative PCR. Samples were obtained from the stem 0.5 cm above and below the hypocotyl inoculation site at 0 h, 6 h, 12 h, 24 h, 36 h, and 48 h after inoculation, and were immediately frozen in liquid nitrogen and stored at −80 °C. RNA isolation was performed on each sample using a plant RNA Extraction Kit (Tiangen). The first cDNA strand was synthesized using the transcript RT Kit (Tiangen), according to the manufacturer’s instructions. Real-time fluorescent quantitative PCR was performed on a LightCycler480 II (Roche, Rotkreuz, Switzerland). Primer sequences of the candidate gene Glysoja.19G051583 (F: CACCACCAAATCCCAGTT; R: AAGCACCAAAGACCAACAAAA), Glysoja. 15 g042014 (F: AAAAGTTGCTGACCCATTGGTAAAT; R: TACCATACTGATGCTTACACGCT) were used for fluorescence amplification. The relative levels of transcript abundance were calculated using the underlying comparative threshold method 2−(∆ Ct) with GmActin4 (GenBank accession no. AF049106) as the internal standard.

3. Results

3.1. Variation in Resistant Levels among G. soja Accessions

A total of 242 G. soja accessions originating from Heilongjiang province were evaluated for their response to one virulent isolate of P. sojae, race 1, using the leaf inoculation method. The susceptible rate for the inoculated accessions ranged from the lowest at 3.70% to the highest at 91.36%. The result’s phenotypic evaluation revealed a broad range of P. sojae resistance among the screened accessions. A total of 47 susceptible accessions, 167 intermediate accessions, and 27 resistant accessions were identified according to the standard of resistance; the percentage of genotyping was 19.50%, 69.29%, and 11.20%, respectively, among the tested accessions (Table 2).
The phenotypic variations of three batches of P. sojae resistance were analyzed, including descriptive statistics, significance analysis, and generalized heritability (Table 3). The results show that there is a wide variation of resistance to P. sojae in the population, and the distribution is continuous (Figure 1). The kurtosis and skew of the first and third batches were all greater than 0, and the kurtosis and skew of the second batches were less than 0.

3.2. SNP Data

A total of 2.27 TB of data was acquired by high-throughput sequencing. According to the variation of SNPs, we calculated that the population’s He was 0.2898, PIC was 0.2389, diversity π was 1.45 × 10−3, and theta was 0.1576. A total of 4,152,769 SNPs were polymorphic in our data set (1 SNP/228 bp); a minimum minor allele frequency (MAF) of ≥5% was employed. Of the polymorphic SNPs, 999,800 had an MAF ≥ 5% and missing rate ≤ 50%, and these were evaluated in the present study for associations with P. sojae resistance.

3.3. Population Structure

The structure and relevance of soybean populations were analyzed. The marginal likelihood of population composition was estimated from 2 to 9 subgroups in turn. The 242 accessions were divided into two sub-populations (clusters), K1 (red) and K2 (blue), based on structure analysis, as the maximal delta K value was observed when K = 2 (Figure 2). Sub-population K1 represented typical wild soybean accessions with smaller seeds, and sub-population K2 was predominantly composed of semi-wild soybeans with larger seeds. From the principal component analysis (PCA) (Figure 3), the total amounts of genetic variations explained by the first two principal components were 12.58% and 10.24%. The first two principal components visually differentiated accessions into wild soybeans and semi-wild soybeans, which were consistent with the structure analysis. Sub-populations K1 and K2 were clustered together in the phylogenetic tree analysis (Figure 4), respectively, which displayed consistent results in agreement with the population structure analysis.

3.4. Linkage Disequilibrium

The linkage disequilibrium (LD) was calculated using 999,800 SNPs with a minor allele frequency ≥ 5% covering the 20 chromosomes. LD decayed to an r2 of 0.2 at approximately 50 kb for the whole population. While the LD value of subgroup 1 was 60 kb, the decrement distance of subgroup 2 could not be obtained (Figure 5).

3.5. Genome-Wide Association Analysis

A total of 79 SNPs were identified to be significantly associated with resistance; at least one batch tested P. sojae race 1 at the level of −log10 (p) ≥ 4.5 in the GLM analysis (Figure 6, Table 4). We identified 14 SNPs associated with race 1 for the first batch, 15 SNPs were associated with race 1 for the second batch, and 25 SNPs were associated with race 1 for the third batch. Moreover, 25 SNPs were identified to be associated with race 1 for the BLUP. To evaluate the potential resistance gene of P. sojae, the methods used in this study applied several approaches to avoid Rps-mediated responses. A total of 9 SNPs were found to be repeatedly associated with race 1 for both the batch and the BLUP, and were located on chromosomes 1, 10, 12, 15, 17, 19, and 20 (three sites on chromosome 19). The phenotypic variation explanation of 9 association SNPs ranged from 7.43% to 10.05% (Table 5).
To confirm the reliability of resistance-associated markers identified by the GLM method, as shown in Table 6, for each variation, the accessions were divided into two groups based on the variations of SNPs. A t-test was performed for the mean value of the susceptible rate between the two groups. The susceptible rate of accessions with alleles that were significantly lower in disease resistance can be selected as reliable variants for screening favorable germplasm resources; meanwhile, alleles with no significant differences in disease resistance were unreliable. A total of seven favorable allelic variations (rs10641-T, rs532502-T, rs718743-C, rs922217-G, rs938638-G, rs940996-C, and rs1958957-T) were detected in nine significant associated alleles (Table 6). The typical carrier accessions were HAAS_077 and HAAS_264.

3.6. Prediction of Candidate Genes for PRR Resistance

As the stable resistance-associated SNPs located on different chromosomes were consistently identified to be associated with the P. sojae resistance in all batches, we performed the candidate gene prediction analysis in the genomic region surrounding the even associated SNPs (Table 6). According to the LD distance, we extended and selected the region of 500 kb upstream and downstream of the peak SNP marker on both sides. We found that four SNPs were located within the gene, the other three SNPs were located in intergenic regions. A total of 30 candidate genes were predicted within the search region (Table 7). Based on the detailed annotations for soybean reference genomes in SoyBase (http://www.soybase.org, accessed on 8 April 2020), or wild soybean candidate genes in NCBI (http://www.ncbi.nlm.nih.gov, accessed on 8 April 2020), 8 candidate genes were predicted from these 30 genes for possibly regulating P. sojae resistance in soybeans and considered to be candidate genes associated with PRR resistance (Table 8). This candidate list included genes encoding resistance to Phytophthora-related proteins, receptor-like kinase proteins, a caffeoyl-CoA O-methyl transferase, and glutathione S-transferase. Two identified RKF3 genes (Glysoja.19G051583 and Glysoja.19G051582) and one RBK2 gene (Glysoja.19G051581) were close to SNP rs938638. The gene Glysoja.19G051582 was only 1 kb away from SNP rs938638, the gene Glysoja.19G051581 was 4 kb away from it, and the gene Glysoja.19G051583 was 7.6 kb away from SNP rs938638.

3.7. Expression of Candidate Gene’s Response to P. sojae Infection in Resistant and Susceptible Germplasms

Quantitative real-time reverse transcription PCRs (qRTPCRs) showed that expressions of Glysoja.19G051583 and Glysoja.15G042014 were obviously induced by P. sojae infection in the resistant wild soybeans. The abundance of gene expression varied along the processing times at 0 h, 3 h, 6 h, 9 h, 12 h, 24 h, and 48 h after inoculation with Phytophthora infestans. However, the gene expression at 6 h after inoculation was highest for both Glysoja.19G051583 and Glysoja.15G042014, followed by 9 h and 3 h. Importantly, the gene expression was significantly (p < 0.01) higher in resistant germplasms in comparison to susceptible germplasms (Figure 7). The gene Glysoja.19G051583 was up-regulated within 48 h after inoculation, compared to susceptible germplasms, while the Glysoja.15G042014 gene was up-regulated within 12 h after inoculation, compared to susceptible germplasms.

4. Discussion

PRR is one of the most serious diseases in soybeans and has caused a great reduction in soybean production in recent years. The application of resistant varieties seemed to be the most effective way to control PRR. However, the widespread use of complete resistance genes can lead to the adaptation of P. sojae populations to the deployed resistance. Searching for more valuable resistance sources has become important to develop cultivars with increased levels of partial resistance. A large quantity of soybean germplasms have been screened for PRR resistance [31,32,33,40,41]. Wild soybean is an extraordinarily important gene pool for soybean breeding. In this study, 27 resistant wild soybeans were identified in response to race 1 of P. sojae, the dominant race of PRR; these works could be useful for breeding and the genetic research on resistance to P. sojae. The intention of this investigation was to identify SNPs by GWAS and candidate genes that play an important role in the PRR resistance variation in our wild soybean population.
For the GWAS analysis, we used the GLM method to identify the markers associated with PRR resistance. By using the genotypic data of 999,800 SNPs with MAF ≥ 5%, a total of 79 SNPs were identified to be significantly associated with the resistance to P. sojae race 1 of at least one tested batch at the level of −log10 (p) ≥ 4.5. Among these SNPs, 9 SNPs were detected to be associated with race 1 for both the batch and BLUP. Compared to previous GWAS studies on P. sojae resistance, our resistance-associated regions were either not on the same chromosomes or were at various distances from the reported alleles and QTLs. Niu et al. (2018) used 337 accessions to identify resistance regions associated with PRR resistance by GWAS, 26 significant SNPs associated with Phytophthora resistance were detected on chromosome 1, and no previous studies have reported resistance loci in this 441 kb region [23]. Schneider et al. (2016) used 1395 Korea accessions to identify seven QTLs on Chr. 3, 13, and 19 associated with partial resistance to P. sojae [42]. The SNPs we identified for race 1 were on Chr. 1, 10, 12, 15, 17, 19, and 20, while Qin et al. (2017) identified six SNPs located on Chr. 3, 5, 13, and 18 associated with race 1. The result show that ss715614943 on Chr. 13 has the highest significant association with P. sojae race 1 with an LOD value of 4.46 in the GLM analysis [24]. Li et al. (2016) also identified a resistance-associated region containing three candidate genes (Glyma.13g32980, Glyma.13g33900, and Glyma.13g33512) on chromosome 13 [21]. The highest significant association rs718743 was identified on Chr. 15 with an LOD value of 5.68 in the GLM analysis in our result. Interestingly, a relatively major effect P. sojae resistance QTL was identified on Chr. 15 through whole-genome resequencing using a diverse panel of 357 soybean accessions in the previous study [20]. Moreover, in our study, a total of seven favorable allelic variations (rs10641-T, rs532502-T, rs718743-C, rs922217-G, rs938638-G, rs940996-C, and rs1958957-T) were identified to be candidate regions for resistance to P. sojae in wild soybeans on chromosomes 1, 12, 15, 19, and 20, which had not been reported. It indicated that these seven favorable materials, including HAAS_077, which carries six tightly resistant associated alleles, could be useful for germplasm innovation and molecular marker-assisted breeding. For candidate gene identification, we discovered even significant SNPs on five different chromosomes that were associated with P. sojae resistance in our wild soybean sample. SNPs in clusters, especially those on chromosomes 15 and 19, are probably the most interesting and worth further investigation. Eight candidate genes involved in plant defense-related reactions were identified here. Glysoja.15G042020 and Glysoja.15G042019, which encode Glutathione S-transferase, were detected in the 48099201–48129356 region on chromosomes 15. A number of studies have reported that Glutathione S-transferase, caffeoyl-CoA O-methyltransferase, LRR receptor-like serine/threonine protein kinase, and receptor-like protein kinases play important roles in plant defense-related reactions against fungal attacks [43,44,45,46,47,48]. Jing et al. (2015) found that the expression of the GST family in soybeans was down-regulated following P. sojae infections [49]. These results imply that Glysoja.15G042020 or Glysoja.15G042019 are likely candidate genes conferring resistance to P. sojae. Receptor-like protein kinases (RLKs) and other stress-related plant protein kinases have been found to be involved in signal transduction. The RLKs located on plant cell membranes have attracted considerable attention in the study of plant signal pathways [50,51]. Interestingly, three of the candidate genes (Glysoja.19G051582, Glysoja.19G051583) were identified close to SNP rs938638, which encode LRR receptor-like serine/threonine protein kinase located on chromosome 19 in the region of 41190378-41199245. Four serine/threonine protein kinase-coding genes are mapped and annotated in the region that is a well-known location for Rps1 and Rps7 in a previous study [52]. Furthermore, the expression of Glysoja.19G051583 reached the highest level at 6 h after inoculation. Importantly, the gene expression was 10-fold greater in resistant germplasms compared with susceptible germplasms. Li et al. (2017) found that Glyma.03g27200 encoding a protein with a typical serine/threonine protein kinase structure and the expression pattern analysis showed that this gene was induced by P. sojae infection, which was suggested as the best candidate gene for RpsQ [9]. Further research revealed that RpsX and RpsQ share common nonsynonymous SNPs and a 144-bp insertion in the Glyma.03g027200 sequence encoding a leucine-rich repeat (LRR) region, which may be important for PRR resistance in soybeans [3]. The results of the present study provide foundational knowledge for researchers who are interested in soybean–P. sojae interactions. A further characterization should focus on validating the role of candidate genes against P. sojae and modulating the resistance between the accessions carrying the R or S alleles in this population.

5. Conclusions

In the present study, a GWAS was performed to detect genomic regions contributing to partial resistance to P. sojae using wild soybean accessions obtained from Heilongjiang province China. Nine SNPs were detected to be repeatedly associated with race 1 and were located on chromosomes 1, 10, 12, 15, 17, 19, and 20. Some SNPs that coincided with previously reported QTLs for resistance to P. sojae were identified. A total of eight candidate genes were predicted to explore mechanistic hypotheses of partial resistance, including RKF3 and RBK2, which was involved in morphology and development, basal defense, and signal transduction. Some of these SNPs may be useful for P. sojae resistance breeding. Our results also provide additional insights into the genetic architecture of P. sojae resistance in a large sample of wild soybeans.

Author Contributions

Methodology, J.-X.L.; software, C.F.; formal analysis, G.Y., W.-W.L.; investigation, M.L., L.W., S.-F.D.; resources, Y.-C.L.; writing—original draft preparation, W.L., D.-Y.Y.; funding acquisition, Y.-D.B. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Outstanding Youth Fund of Heilongjiang Province, China (No. JQ2019C003), and the Horizon 2020 of European Union (EUCLEG/No.727312).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Tyler, B.M. Phytophthora sojae: Root rot pathogen of soybean and model oomycete. Mol. Plant Pathol. 2007, 8, 1–8. [Google Scholar] [CrossRef] [PubMed]
  2. Niu, J.P. Mapping of Resistance Gene to Phytophthora Sojae in Soybean and Analysis of Candidate Genes; Nanjing Agricultural University: Nanjing, China, 2018; pp. 3–4. [Google Scholar]
  3. Zhong, C.; Li, Y.; Sun, S.; Duan, C.; Zhu, Z. Genetic Mapping and Molecular Characterization of a Broad-spectrum Phytophthora sojae Resistance Gene in Chinese Soybean. Int. J. Mol. Sci. 2019, 20, 1809. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Sugimoto, T.; Kato, M.; Yoshida, S.; Matsumoto, I.; Kobayashi, T.; Kaga, A.; Hajika, M.; Yamamoto, R.; Watanabe, K.; Aino, M.; et al. Pathogenic diversity of Phytophthora sojae and breeding strategies to develop Phytophthora-resistant soybeans. Breed. Sci. 2012, 61, 511–522. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Sun, J.; Li, L.; Zhao, J.; Huang, J.; Yan, Q.; Xing, H.; Guo, N. Genetic analysis and fine mapping of RpsJS, a novel resistance gene to Phytophthora sojae in soybean [Glycine max (L.) Merr.]. Theor. Appl. Genet. 2014, 127, 913–919. [Google Scholar] [CrossRef] [PubMed]
  6. Bernard, R.; Smith, P.; Kaufmann, M.; Schmitthenner, A.F. Inheritance of resistance to phytophthora root and stem rot in soybean. Agron. J. 1957, 49, 391. [Google Scholar] [CrossRef]
  7. Sahoo, D.K.; Abeysekara, N.S.; Cianzio, S.R.; Robertson, A.E.; Bhattacharyya, M.K. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes. PLoS ONE 2017, 12, e0169950. [Google Scholar] [CrossRef] [Green Version]
  8. Niu, J.; Guo, N.; Sun, J.; Li, L.; Cao, Y.; Li, S.; Huang, J.; Zhao, J.; Zhao, T.; Xing, H. Fine Mapping of a Resistance Gene RpsHN that Controls Phytophthora sojae Using Recombinant Inbred Lines and Secondary Populations. Front. Plant Sci. 2017, 8, 538. [Google Scholar] [CrossRef] [Green Version]
  9. Li, Y.; Sun, S.; Zhong, C.; Wang, X.; Wu, X.; Zhu, Z. Genetic mapping and development of co-segregating markers of RpsQ, which provides resistance to Phytophthora sojae in soybean. Theor. Appl. Genet. 2017, 130, 1223–1233. [Google Scholar] [CrossRef]
  10. Jiang, B.; Cheng, Y.; Cai, Z.; Li, M.; Jiang, Z.; Ma, R.; Yuan, Y.; Xia, Q.; Nian, H. Fine mapping of a Phytophthora-resistance locus RpsGZ in soybean using genotyping-by-sequencing. BMC Genom. 2020, 21, 280. [Google Scholar] [CrossRef] [Green Version]
  11. Chen, L.; Wang, W.; Ping, J.; Fitzgerald, J.C.; Cai, G.; Clark, C.B.; Aggarwal, R.; Ma, J. Identification and molecular mapping of Rps14, a gene conferring broad-spectrum resistance to Phytophthora sojae in soybean. Theor. Appl. Genet. 2021, 134, 3863–3872. [Google Scholar] [CrossRef]
  12. Van, K.; Rolling, W.; Biyashev, R.M.; Matthiesen, R.L.; Abeysekara, N.S.; Robertson, A.E.; Veney, D.J.; Dorrance, A.E.; McHale, L.K.; Maroof, M.A.S. Mining germplasm panels and phenotypic datasets to identify loci for resistance to Phytophthora sojae in soybean. Plant Genome 2020, 14, e20063. [Google Scholar] [CrossRef] [PubMed]
  13. Wang, W.; Chen, L.; Fengler, K.; Bolar, J.; Llaca, V.; Wang, X.; Clark, C.B.; Fleury, T.J.; Myrvold, J.; Oneal, D.; et al. A giant NLR gene confers broad-spectrum resistance to Phytophthora sojae in soybean. Nat. Commun. 2021, 12, 6263. [Google Scholar] [CrossRef] [PubMed]
  14. Ping, J.; Fitzgerald, J.C.; Zhang, C.; Lin, F.; Bai, Y.; Wang, D.; Aggarwal, R.; Rehman, M.; Crasta, O.; Ma, J. Identification and molecular mapping of Rps11, a novel gene conferring resistance to Phytophthora sojae in soybean. Theor. Appl. Genet. 2016, 129, 445–451. [Google Scholar] [CrossRef] [PubMed]
  15. Cheng, Y.; Ma, Q.; Ren, H.; Xia, Q.; Song, E.; Tan, Z.; Li, S.; Zhang, G.; Nian, H. Fine mapping of a Phytophthora-resistance gene RpsWY in soybean (Glycine max L.) by high-throughput genome-wide sequencing. Theor. Appl. Genet. 2017, 130, 1041–1051. [Google Scholar] [CrossRef] [Green Version]
  16. Zhao, X.; Bao, D.; Wang, W.; Zhang, C.; Jing, Y.; Jiang, H.; Qiu, L.; Li, W.; Han, Y. Loci and candidate gene identification for soybean resistance to Phytophthora root rot race 1 in combination with association and linkage mapping. Mol. Breed. 2020, 40, 100. [Google Scholar] [CrossRef]
  17. Zhong, C.; Sun, S.; Yao, L.; Ding, J.; Duan, C.; Zhu, Z. Fine Mapping and Identification of a Novel Phytophthora Root Rot Resistance Locus RpsZS18 on Chromosome 2 in Soybean. Front. Plant Sci. 2018, 9, 44. [Google Scholar] [CrossRef] [PubMed]
  18. Zhong, C.; Sun, S.; Zhang, X.; Duan, C.; Zhu, Z. Fine Mapping, Candidate Gene Identification and Co-segregating Marker Development for the Phytophthora Root Rot Resistance Gene RpsYD25. Front. Genet. 2020, 11, 799. [Google Scholar] [CrossRef] [PubMed]
  19. Tooley, P.W. Identification and quantitative characterization of rate-reducing resistance to phytophthora megasperma f. sp. glycinea in soybean seedlings. Phytopathology 1982, 72, 727–733. [Google Scholar] [CrossRef]
  20. de Ronne, M.; Santhanam, P.; Cinget, B.; Labbé, C.; Lebreton, A.; Ye, H.; Vuong, T.D.; Hu, H.; Valliyodan, B.; Edwards, D.; et al. Mapping of partial resistance to Phytophthora sojae in soybean PIs using whole-genome sequencing reveals a major QTL. Plant Genome 2021, 15, e20184. [Google Scholar] [CrossRef]
  21. Li, L.H.; Guo, N.; Niu, J.P.; Wang, Z.; Cui, X.; Sun, J.; Zhao, T.; Xing, H. Loci and Candidate Gene Identification for Resistance to Phytophthora sojae via Association Analysis in Soybean [Glycine Max (L.) Merr.]. Mol. Genet. Genom. 2016, 291, 1095–1103. [Google Scholar] [CrossRef]
  22. Karhoff, S.; Lee, S.; Mian, M.A.R.; Ralston, T.I.; Niblack, T.L.; Dorrance, A.E.; McHale, L.K. Phenotypic Characterization of a Major Quantitative Disease Resistance Locus for Partial Resistance to Phytophthora sojae. Crop Sci. 2019, 59, 968–980. [Google Scholar] [CrossRef] [Green Version]
  23. Niu, J.; Guo, N.; Zhang, Z.; Wang, Z.; Huang, J.; Zhao, J.; Chang, F.; Wang, H.; Zhao, T.; Xing, H. Genome-wide SNP-based association mapping of resistance to Phytophthora sojae in soybean (Glycine max (L.) Merr.). Euphytica 2018, 214, 187. [Google Scholar] [CrossRef]
  24. Qin, J.; Song, Q.; Shi, A.; Li, S.; Zhang, M.; Zhang, B. Genome-wide association mapping of resistance to Phytophthora sojae in a soybean [Glycine max (L.) Merr.] germplasm panel from maturity groups IV and V. PLoS ONE 2017, 12, e0184613. [Google Scholar] [CrossRef] [PubMed]
  25. Sun, J.; Guo, N.; Lei, J.; Li, L.; Hu, G.; Xing, H. Association mapping for partial resistance to Phytophthora sojae in soybean (Glycine max (L.) Merr.). J. Genet. 2014, 93, 355–363. [Google Scholar] [CrossRef] [PubMed]
  26. Lin, F.; Zhao, M.; Ping, J.; Johnson, A.; Zhang, B.; Abney, T.S.; Hughes, T.J.; Ma, J. Molecular mapping of two genes conferring resistance to Phytophthora sojae in a soybean landrace PI 567139B. Theor. Appl. Genet. 2013, 126, 2177–2185. [Google Scholar] [CrossRef] [PubMed]
  27. Chauhan, A.; Sharma, D.; Banyal, S.K. Potential, Challenges and Strategies Involved in Gene Introgression from Wild Relatives of Vegetable Crops: A Review. Agric. Rev. 2021, 4, 390–397. [Google Scholar] [CrossRef]
  28. Francis, D.; Bernal, E.; Orchard, C.; Subode, S. New approaches in the discovery and introgression of disease resistance genes from wild tomato. Acta Hortic. 2021, 1316, 23–34. [Google Scholar] [CrossRef]
  29. Jin, Y.; He, T.; Lu, B. Fine scale genetic structure in a wild soybean (Glycine soja) population and the implications for conservation. New Phytol. 2003, 159, 513–519. [Google Scholar] [CrossRef]
  30. Li, W.; Peng, M.; Wang, Z.; Bi, Y.; Liu, M.; Wang, L.; Di, S.; Liu, J.; Fan, C.; Yang, G.; et al. The Evaluation of Agronomic Traits of Wild Soybean Accessions (Glycine soja Sieb. and Zucc.) in Heilongjiang Province, China. Agronomy 2021, 11, 586. [Google Scholar] [CrossRef]
  31. Huang, J.; Guo, N.; Li, Y.; Sun, J.; Hu, G.; Zhang, H.; Li, Y.; Zhang, X.; Zhao, J.; Xing, H.; et al. Phenotypic evaluation and genetic dissection of resistance to Phytophthora sojae in the Chinese soybean mini core collection. BMC Genet. 2016, 17, 85. [Google Scholar] [CrossRef] [Green Version]
  32. Jiang, C.-J.; Sugano, S.; Kaga, A.; Lee, S.S.; Sugimoto, T.; Takahashi, M.; Ishimoto, M. Evaluation of Resistance to Phytophthora sojae in Soybean Mini Core Collections Using an Improved Assay System. Phytopathology 2017, 107, 216–223. [Google Scholar] [CrossRef]
  33. Yang, J.; Ye, W.; Wang, X.; Ren, L.; Yao, Y.; Wang, X.; Wang, Y.; Dong, S.; Zheng, X.; Wang, Y. An Improved Method for the Identification of Soybean Resistance to Phytophthora sojae Applied to Germplasm Resources from the Huanghuaihai and Dongbei Regions of China. Plant Dis. 2020, 104, 408–413. [Google Scholar] [CrossRef] [PubMed]
  34. Weigel, D.; Glazebrook, J.; Glazebrook, W. Arabidopsis a Laboratory Manual; CSHL Press: Cold Spring Harbor, NY, USA, 2002. [Google Scholar]
  35. Yang, X.B. Races of Phytophthora sojae in Iowa soybean fields. Plant Dis. 1996, 80, 14180–14201. [Google Scholar] [CrossRef]
  36. Lam, H.-M.; Xu, X.; Liu, X.; Chen, W.; Yang, G.; Wong, F.-L.; Li, M.-W.; He, W.; Qin, N.; Wang, B.; et al. Resequencing of 31 wild and cultivated soybean genomes identifies patterns of genetic diversity and selection. Nat. Genet. 2010, 42, 1053–1059. [Google Scholar] [CrossRef] [PubMed]
  37. Raj, A.; Stephens, M.; Pritchard, J.K. fastSTRUCTURE: Variational Inference of Population Structure in Large SNP Data Sets. Genetics 2014, 197, 573–589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Lipka, A.E.; Tian, F.; Wang, Q.; Peiffer, J.; Li, M.; Bradbury, P.J.; Gore, M.A.; Buckler, E.S.; Zhang, Z. GAPIT: Genome association and prediction integrated tool. Bioinformatics 2012, 28, 2397–2399. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. VanRaden, P. Efficient Methods to Compute Genomic Predictions. J. Dairy Sci. 2008, 91, 4414–4423. [Google Scholar] [CrossRef] [Green Version]
  40. Yang, J.; Wang, X.M.; Ye, W.W.; Zheng, X.; Wang, Y. Identification of soybean resistance to Phytophthora sojae in the germplasm resources from Huanghuaihai Region of China. Soybean Sci. 2020, 1, 12–22. [Google Scholar] [CrossRef]
  41. Jin, L.M.; Xu, P.F.; Wu, J.J.; Li, W.; Qiu, L.; Chang, R.; Xu, P.; Zhang, S. Identification the resistance of wild soybean germplasm to Phytophthora sojae. Soybean Sci. 2007, 26, 300–304. [Google Scholar]
  42. Schneider, R.; Rolling, W.; Song, Q.; Cregan, P.; Dorrance, A.E.; McHale, L.K. Genome-wide association mapping of partial resistance to Phytophthora sojae in soybean plant introductions from the Republic of Korea. BMC Genom. 2016, 17, 607. [Google Scholar] [CrossRef] [Green Version]
  43. Zhang, Y.; He, J.; Xiao, Y.; Zhang, Y.; Liu, Y.; Wan, S.; Liu, L.; Dong, Y.; Liu, H.; Yu, Y. CsGSTU8, a Glutathione S-Transferase from Camellia sinensis, Is Regulated by CsWRKY48 and Plays a Positive Role in Drought Tolerance. Front. Plant Sci. 2021, 12, 795919. [Google Scholar] [CrossRef]
  44. Zhao, D.; Luan, Y.; Shi, W.; Zhang, X.; Meng, J.; Tao, J. A Paeonia ostii caffeoyl-CoA O-methyltransferase confers drought stress tolerance by promoting lignin synthesis and ROS scavenging. Plant Sci. 2021, 303, 110765. [Google Scholar] [CrossRef] [PubMed]
  45. Zambounis, A.; Psomopoulos, F.E.; Ganopoulos, I.; Avramidou, E.; Aravanopoulos, F.; Tsaftaris, A.; Madesis, P. In silico analysis of the LRR receptor-like serine threonine kinases subfamily in Morus notabilis. Plant Omics 2016, 9, 319–326. [Google Scholar] [CrossRef]
  46. Sun, Y.; Zhao, X.; Gao, Y.; Jiao, J.; Sun, Y.; Zhu, D.; Yang, J.; Wu, F.; Su, H. Genome-wide analysis of lectin receptor-like kinases (LecRLKs) in sweet cherry (Prunus avium) and reveals PaLectinL16 enhances sweet cherry resistance with salt stress. Environ. Exp. Bot. 2022, 194, 104751. [Google Scholar] [CrossRef]
  47. Cui, Y.W.; Lu, X.T.; Gou, X.P. Receptor-like protein kinases in plant reproduction: Current understanding and future perspec-tives. Plant Commun. 2021, 3, 100273. [Google Scholar] [CrossRef]
  48. Mondal, R.; Biswas, S.; Srivastava, A.; Basu, S.; Trivedi, M.; Singh, S.K.; Mishra, Y. In silico analysis and expression profiling of S-domain receptor-like kinases (SD-RLKs) under different abiotic stresses in Arabidopsis thaliana. BMC Genom. 2021, 22, 817. [Google Scholar] [CrossRef] [PubMed]
  49. Jing, M.; Ma, H.; Li, H.; Guo, B.; Zhang, X.; Ye, W.; Wang, H.; Wang, Q.; Wang, Y. Differential regulation of defense-related proteins in soybean during compatible and incompatible interactions between Phytophthora sojae and soybean by comparative proteomic analysis. Plant Cell Rep. 2015, 34, 1263–1280. [Google Scholar] [CrossRef]
  50. Zeng, M.; Wan, B.; Wang, L.; Chen, Z.; Lin, Y.; Ye, W.; Wang, Y.; Wang, Y. Identification and characterization of L-type lectin receptor-like kinases involved in Glycine maxPhytophthora sojae interaction. Planta 2021, 254, 128. [Google Scholar] [CrossRef]
  51. Verbruggen, N.; Hanikenne, M.; Clemens, S. GmSnRK1.1, a Sucrose Non-fermenting-1(SNF1)-Related Protein Kinase, Promotes Soybean Resistance to Phytophthora sojae. Front. Plant Sci. 2019, 10, 996. [Google Scholar] [CrossRef] [Green Version]
  52. Jang, I.-H.; Kang, I.J.; Kim, J.-M.; Kang, S.-T.; Jang, Y.E.; Lee, S. Genetic Mapping of a Resistance Locus to Phytophthora sojae in the Korean Soybean Cultivar Daewon. Plant Pathol. J. 2020, 36, 591–599. [Google Scholar] [CrossRef]
Figure 1. Frequency of G. soja resistance to P. sojae.
Figure 1. Frequency of G. soja resistance to P. sojae.
Cimb 44 00221 g001
Figure 2. Population structure analysis of G. soja.
Figure 2. Population structure analysis of G. soja.
Cimb 44 00221 g002
Figure 3. The PCA of G. soja.
Figure 3. The PCA of G. soja.
Cimb 44 00221 g003
Figure 4. A neighbor-joining tree of G. soja.
Figure 4. A neighbor-joining tree of G. soja.
Cimb 44 00221 g004
Figure 5. Analysis of LD.
Figure 5. Analysis of LD.
Cimb 44 00221 g005
Figure 6. Manhattan and QQ plots of GWAS for wild soybeans resistance to PRR.
Figure 6. Manhattan and QQ plots of GWAS for wild soybeans resistance to PRR.
Cimb 44 00221 g006
Figure 7. Relative expressions of candidate genes were induced by P. sojae. Note *: 0.05 level; **: 0.01 level.
Figure 7. Relative expressions of candidate genes were induced by P. sojae. Note *: 0.05 level; **: 0.01 level.
Cimb 44 00221 g007
Table 1. Standard of resistance to P. sojae.
Table 1. Standard of resistance to P. sojae.
ReactionStandard of IdentificationSusceptible Rate (%)
RYellowing, browning, or chlorosis of leaves<30
I30–70
S>70
R: resistance; S: susceptible; I: intermediate.
Table 2. Analysis of resistance identification for G. soja accessions.
Table 2. Analysis of resistance identification for G. soja accessions.
ReactionNumbersPercent
S4719.50
I16769.29
R2711.20
Table 3. Descriptive statistics of G. soja resistance to P. sojae.
Table 3. Descriptive statistics of G. soja resistance to P. sojae.
BatchSkewKurtosisHeritability
First0.62−0.6765.82
Second−0.17−0.73
Third0.080.07
Table 4. SNPs associated with G. soja resistance to P. sojae.
Table 4. SNPs associated with G. soja resistance to P. sojae.
BatchSNPChrPositionSNPChrPosition
Firstrs64989151,714,188rs4943191115,826,009
rs7053029,109,207rs4943721115,827,702
rs7055029,110,030rs4972131117,412,064
rs7064629,120,078rs4985071117,862,252
rs264115621,032,877rs570096131,285,457
rs434454108,904,675rs7790741724,607,598
rs4448181014,862,256rs885444198,001,494
Secondrs32673127,448,011rs7174761546,519,729
rs248180530,006,501rs7174781546,519,754
rs2996337625,039rs7174791546,519,777
rs5308811215,479,974rs7174801546,519,780
rs5309111215,481,110rs7187431547,944,309
rs5325021216,557,015rs8753661856,051,504
rs7171971546,275,173rs9409961949,218,250
rs7174751546,519,716
Thirdrs9312110,161,448rs193415430,457,058
rs9748110,439,969rs200863436,132,462
rs10026110,532,649rs281244634,683,089
rs10216110,586,571rs37141196,767,103
rs10270110,593,132rs576319136,313,762
rs10380110,641,555rs721959165,055,148
rs10436110,669,494rs8016451738,595,915
rs10641110,725,370rs9216471927,986,596
rs6759922,186,517rs9218001928,122,057
rs6771722,190,064rs9218011928,122,124
rs6771822,190,067rs9222171928,376,899
rs6772022,190,157rs9386381941,267,399
rs116637245,054,777
BLUPrs10641110,725,370rs7186751547,928,197
rs64791151,140,109rs7186931547,938,751
rs85323220,208,766rs7187431547,944,309
rs190201427,955,786rs7187561547,944,902
rs230678516,483,623rs7790741724,607,598
rs286790638,875,969rs8449041832,247,141
rs4448181014,862,256rs9222171928,376,899
rs4903701112,974,021rs9386371941,267,263
rs4905211113,035,152rs9386381941,267,399
rs5325021216,557,015rs9408141948,382,478
rs5397551221,078,905rs9409961949,218,250
rs5454541222,657,211rs9589572012,404,540
rs7186531547,921,059
Table 5. The SNPs repeatedly associated with PRR.
Table 5. The SNPs repeatedly associated with PRR.
ChrSNPBatchPositionp Value−log10(p)MafPhenotypic Variation (%)
1rs10641Third10,725,3701.98 × 10−54.700.138.21
BLUP3.13 × 10−54.507.43
10rs444818First14,862,2561.46 × 10−54.840.127.75
BLUP1.60 × 10−54.808
12rs532502Second16,557,0152.35 × 10−54.630.337.63
BLUP2.37 × 10−54.637.67
15rs718743Second47,944,3092.36 × 10−54.630.307.63
BLUP2.07 × 10−65.689.77
17rs779074First24,607,5981.27 × 10−54.900.177.59
BLUP2.03 × 10−54.697.8
19rs922217Third28,376,8992.79 × 10−54.550.197.91
BLUP1.75 × 10−54.767.92
rs938638Third41,267,3992.33 × 10−54.630.368.07
BLUP4.71 × 10−65.339.05
rs940996Second49,218,2501.55 × 10−54.810.427.98
BLUP2.00 × 10−54.707.81
20rs958957First12,404,5405.29 × 10−65.280.4110.05
BLUP1.95 × 10−54.717.83
Table 6. Favorable allele effects and carrier accessions.
Table 6. Favorable allele effects and carrier accessions.
SNPChrPositionAlleleMean of Susceptible RateAlleleMean of
Susceptible Rate
t-TestSignificant
Material
rs10641Chr0110,725,370C48.45T37.040.0038HAAS_077
rs532502Chr1216,557,015C59.4T48.780.0034HAAS_264
rs718743Chr1547,944,309A63.98C51.140.0010HAAS_264
rs922217Chr1928,376,899A54.22G44.490.0089HAAS_077
rs93863841,267,399T52.31G43.920.0018HAAS_077
rs94099649,218,250C47.83G60.200.0002HAAS_077
rs958957Chr2012,404,540C48.44T37.960.0003HAAS_077
Table 7. Prediction of candidate genes.
Table 7. Prediction of candidate genes.
SNPGENE IDAnnotations
Chr15
rs718743
Glysoja.15G042021Putative glutathione S-transferase parC
Glysoja.15G042020Putative glutathione S-transferase
Glysoja.15G042019Putative glutathione S-transferase
Glysoja.15G042017Nicotianamine synthase
Glysoja.15G042016Ubiquitin carboxyl-terminal hydrolase 25
Glysoja.15G042015Putative sugar phosphate/phosphate translocator
Glysoja.15G042014Putative caffeoyl-CoA O-methyltransferase 1
Glysoja.15G042012(S)-2-hydroxy-acid oxidase GLO1(s)
Chr19
rs922217
Glysoja.19G050845Elongation factor 1-alpha
Chr19
rs938638
Glysoja.19G051587Protein resistance to Phytophthora 1, chloroplastic-like
Glysoja.19G051585Sugar transporter ERD6-like 7
Glysoja.19G051583Putative LRR receptor-like serine/threonine protein kinase RKF3
Glysoja.19G051582Putative LRR receptor-like serine/threonine protein kinase RKF3
Glysoja.19G051581Receptor-like cytosolic serine/threonine protein kinase RBK2
Glysoja.19G051580Autophagy-related protein 18 g
Glysoja.19G051579Histidine-containing phosphotransfer protein AHP1
Glysoja.19G051577Pentatricopeptide repeat-containing protein
Glysoja.19G051576Gibberellin receptor GID1B
Glysoja.19G051575Hypothetical protein
Chr19
rs940996
Glysoja.19G052510Receptor-like protein kinase ANXUR2
Glysoja.19G052507Pathogenesis-related protein PR-4A
Glysoja.19G052505Pro-hevein
Glysoja.19G052504Auxin-responsive protein IAA16-like
Glysoja.19G052503Mediator of RNA polymerase II transcription subunit 14RNA
Glysoja.19G052502Sec-independent protein translocase protein TATA, chloroplastic
Glysoja.19G052501Light-inducible protein CPRF2
Glysoja.19G052500GDP-mannose 3,5-epimerase 1
Glysoja.19G052499GDP-mannose 3,5-epimerase 1
Glysoja.19G052497Ammonium transporter 3 member 1
Glysoja.19G052496Calmodulin-like protein 8
Table 8. Candidate genes associated with PRR resistance.
Table 8. Candidate genes associated with PRR resistance.
GENE IDGENE NamePositionSNPSNP Location
Glysoja.15G042021PARC48,129,405–48,131,670rs71874348,076,672
Glysoja.15G042020GST48,126,966–48,129,356
Glysoja.15G042019GST48,099,201–48,101,217
Glysoja.15G042014Omt548,039,247–48,039,770
Glysoja.19G051587PRR141,224,586–41,226,602rs93863841,190,696
Glysoja.19G051583RKF341,197,436–41,199,245
Glysoja.19G051582RKF341,190,378–41,192,993
Glysoja.19G051581RBK241,184,811–41,188,366
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Li, W.; Liu, M.; Lai, Y.-C.; Liu, J.-X.; Fan, C.; Yang, G.; Wang, L.; Liang, W.-W.; Di, S.-F.; Yu, D.-Y.; et al. Genome-Wide Association Study of Partial Resistance to P. sojae in Wild Soybeans from Heilongjiang Province, China. Curr. Issues Mol. Biol. 2022, 44, 3194-3207. https://doi.org/10.3390/cimb44070221

AMA Style

Li W, Liu M, Lai Y-C, Liu J-X, Fan C, Yang G, Wang L, Liang W-W, Di S-F, Yu D-Y, et al. Genome-Wide Association Study of Partial Resistance to P. sojae in Wild Soybeans from Heilongjiang Province, China. Current Issues in Molecular Biology. 2022; 44(7):3194-3207. https://doi.org/10.3390/cimb44070221

Chicago/Turabian Style

Li, Wei, Miao Liu, Yong-Cai Lai, Jian-Xin Liu, Chao Fan, Guang Yang, Ling Wang, Wen-Wei Liang, Shu-Feng Di, De-Yue Yu, and et al. 2022. "Genome-Wide Association Study of Partial Resistance to P. sojae in Wild Soybeans from Heilongjiang Province, China" Current Issues in Molecular Biology 44, no. 7: 3194-3207. https://doi.org/10.3390/cimb44070221

APA Style

Li, W., Liu, M., Lai, Y.-C., Liu, J.-X., Fan, C., Yang, G., Wang, L., Liang, W.-W., Di, S.-F., Yu, D.-Y., & Bi, Y.-D. (2022). Genome-Wide Association Study of Partial Resistance to P. sojae in Wild Soybeans from Heilongjiang Province, China. Current Issues in Molecular Biology, 44(7), 3194-3207. https://doi.org/10.3390/cimb44070221

Article Metrics

Back to TopTop