The Expression and Prognostic Significance of VEGF and CXCR4 in Gastric Cancer: Correlation with Angiogenesis, Lymphangiogenesis and Progression
Abstract
1. Introduction
2. Material and Methods
2.1. Patients and Tissue Specimens
2.2. Reverse Transcription and Real-Time Quantitative Polymerase Chain Reaction (RT-PCR)
2.3. Immunohistochemistry
2.4. Histopathological Evaluation
2.5. Statistical Analysis
3. Results
3.1. Patients and Clinicopathological Findings
3.2. The Expression of VEGF and CXCR4 mRNA
3.3. Correlation between Clinicopathological Features and the Expression of VEGF and CXCR4 mRNA in Gastric Cancer Tissue
3.4. Relationship between Depth of Tumor Invasion (pT), Lymph Nodes (pN), Tumor Stage, and the mRNA Expressions of VEGF and CXCR4
3.5. Immunohistochemical Analyses for VEGF and CD34
3.6. Correlation between VEGF mRNA Expression and VEGF Immunostaining
3.7. The VEGF and CXCR4 Expression and Survival
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef]
- Lordick, F.; Allum, W.; Carneiro, F.; Mitry, E.; Tabernero, J.; Tan, P.; Van Cutsem, E.; van de Velde, C.; Cervantes, A. Unmet needs and challenges in gastric cancer: The way forward. Cancer Treat. Rev. 2014, 40, 692–700. [Google Scholar] [CrossRef] [PubMed]
- Miyahara, R.; Niwa, Y.; Matsuura, T.; Maeda, O.; Ando, T.; Ohmiya, N.; Itoh, A.; Hirooka, Y.; Goto, H. Prevalence and prognosis of gastric cancer detected by screening in a large Japanese population: Data from a single institute over 30 years. J. Gastroenterol. Hepatol. 2007, 22, 1435–1442. [Google Scholar] [CrossRef] [PubMed]
- Mizokami, K.; Kakeji, Y.; Oda, S.; Irie, K.; Yonemura, T.; Konishi, F.; Maehara, Y. Clinicopathologic significance of hypoxia-inducible factor 1alpha overexpression in gastric carcinomas. J. Surg. Oncol. 2006, 94, 149–154. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.T.; Huang, C.J.; Wu, M.T.; Yang, S.F.; Su, Y.C.; Chai, C.Y. Hypoxia-inducible factor-1alpha is associated with risk of aggressive behavior and tumor angiogenesis in gastrointestinal stromal tumor. Jpn J. Clin. Oncol. 2005, 35, 207–213. [Google Scholar] [CrossRef]
- Roviello, G.; Petrioli, R.; Marano, L.; Polom, K.; Marrelli, D.; Perrella, A.; Roviello, F. Angiogenesis inhibitors in gastric and gastroesophageal junction cancer. Gastric Cancer 2016, 19, 31–41. [Google Scholar] [CrossRef] [PubMed]
- Ma, D.M.; Luo, D.X.; Zhang, J. SDF-1/CXCR7 axis regulates the proliferation, invasion, adhesion, and angiogenesis of gastric cancer cells. World J. Surg. Oncol. 2016, 14, 256. [Google Scholar] [CrossRef]
- Wang, Y.D.; Wu, P.; Mao, J.D.; Huang, H.; Zhang, F. Relationship between vascular invasion and microvessel density and micrometastasis. World J. Gastroenterol. 2007, 13, 6269–6273. [Google Scholar] [CrossRef]
- Folkman, J.; Shing, Y. Angiogenesis. J. Biol. Chem. 1992, 267, 10931–10934. [Google Scholar] [CrossRef]
- Hicklin, D.J.; Ellis, L.M. Role of the vascular endothelial growth factor pathway in tumor growth and angiogenesis. J. Clin. Oncol. 2005, 23, 1011–1027. [Google Scholar] [CrossRef]
- Pang, L.; Wang, J.; Fan, Y.; Xu, R.; Bai, Y.; Bai, L. Correlations of TNM staging and lymph node metastasis of gastric cancer with MRI features and VEGF expression. Cancer Biomark. 2018, 23, 53–59. [Google Scholar] [CrossRef] [PubMed]
- Aoyagi, K.; Kouhuji, K.; Yano, S.; Miyagi, M.; Imaizumi, T.; Takeda, J.; Shirouzu, K. VEGF significance in peritoneal recurrence from gastric cancer. Gastric Cancer 2005, 8, 155–163. [Google Scholar] [CrossRef] [PubMed]
- Iordache, S.; Saftoiu, A.; Georgescu, C.V.; Ramboiu, S.; Gheonea, D.I.; Filip, M.; Schenker, M.; Ciurea, T. Vascular endothelial growth factor expression and microvessel density—Two useful tools for the assessment of prognosis and survival in gastric cancer patients. J. Gastrointest. Liver Dis. 2010, 19, 135–139. [Google Scholar]
- He, M.Q.; He, M.Q.; Wang, J.F.; Zhu, B.L.; Sun, N.; Zhou, X.H.; Yao, R.X. Vascular Endothelial Growth Factor and Cluster of Differentiation 34 for Assessment of Perioperative Bleeding Risk in Gastric Cancer Patients. Chin. Med. J. 2016, 129, 1950–1954. [Google Scholar] [CrossRef] [PubMed]
- Dieu, M.C.; Vanbervliet, B.; Vicari, A.; Bridon, J.M.; Oldham, E.; Aït-Yahia, S.; Brière, F.; Zlotnik, A.; Lebecque, S.; Caux, C. Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites. J. Exp. Med. 1998, 188, 373–386. [Google Scholar] [CrossRef]
- Lombardi, L.; Tavano, F.; Morelli, F.; Latiano, T.P.; Di Sebastiano, P.; Maiello, E. Chemokine receptor CXCR4: Role in gastrointestinal cancer. Crit. Rev. Oncol. Hematol. 2013, 88, 696–705. [Google Scholar] [CrossRef]
- Burger, J.A.; Kipps, T.J. CXCR4: A key receptor in the crosstalk between tumor cells and their microenvironment. Blood 2006, 5, 1761–1767. [Google Scholar] [CrossRef]
- Parker, C.C.; Kim, R.H.; Li, B.D.; Chu, Q.D. The chemokine receptor CXCR4 as a novel independent prognostic marker for node-positive breast cancer patients. J. Surg. Oncol. 2012, 106, 393–398. [Google Scholar] [CrossRef]
- Yoshitake, N.; Fukui, H.; Yamagishi, H.; Sekikawa, A.; Fujii, S.; Tomita, S.; Ichikawa, K.; Imura, J.; Hiraishi, H.; Fujimori, T. Expression of SDF-1 alpha and nuclear CXCR4 predicts lymph node metastasis in colorectal cancer. Br. J. Cancer 2008, 98, 1682–1689. [Google Scholar] [CrossRef]
- Ishikawa, T.; Nakashiro, K.; Klosek, S.K.; Goda, H.; Hara, S.; Uchida, D.; Hamakawa, H. Hypoxia enhances CXCR4 expression by activating HIF-1 in oral squamous cell carcinoma. Oncol. Rep. 2009, 3, 707–712. [Google Scholar]
- Edge, S.B.; Byrd, D.R.; Compton, C.C.; Carducci, M.A.; Fritz, A.G. AJCC Cancer Staging Handbook, 7th ed.; Springer: Berlin/Heidelberg, Germany, 2010; pp. 145–152. [Google Scholar]
- Chomczynski, P.; Sacchi, N. Single-step method of RNA isolation by acid guanidinum thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987, 162, 156–159. [Google Scholar] [CrossRef]
- Weidner, N. Tumoural vascularity as a prognostic factor in cancer patients: The evidence continues to grow. J. Pathol. 1998, 184, 119–122. [Google Scholar] [CrossRef]
- Li, S.G.; Ye, Z.Y.; Zhao, Z.S.; Tao, H.Q.; Wang, Y.Y.; Niu, C.Y. Correlation of integrin beta3 mRNA and vascular endothelial growth factor protein expression profiles with the clinicopathological features and prognosis of gastric carcinoma. World J. Gastroenterol. 2008, 14, 421–427. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Li, T.; Wu, Y.; He, L.; Zhang, L.; Shi, T.; Yi, Z.; Liu, M.; Pang, X. Prognostic significance of vascular endothelial growth factor expression in gastric carcinoma: A meta-analysis. J. Cancer Res. Clin. Oncol. 2011, 137, 1799–1812. [Google Scholar] [CrossRef]
- Park, D.J.; Seo, A.N.; Yoon, C.; Ku, G.Y.; Coit, D.G.; Strong, V.E.; Suh, Y.S.; Lee, H.S.; Yang, H.K.; Kim, H.H.; et al. Serum VEGF-A and Tumor Vessel VEGFR-2 Levels Predict Survival in Caucasian but Not Asian Patients Undergoing Resection for Gastric Adenocarcinoma. Ann. Surg. Oncol. 2015, 3, 1508–1515. [Google Scholar] [CrossRef]
- Tzanakis, N.; Gazouli, M.; Rallis, G.; Giannopoulos, G.; Papaconstantinou, I.; Theodoropoulos, G.; Pikoulis, E.; Tsigris, C.; Karakitsos, P.; Peros, G.; et al. Vascular endothelial growth factor polymorphism in gastric cancer development, prognosis, and survival. J. Surg. Oncol. 2006, 94, 624–630. [Google Scholar] [CrossRef]
- Zhuang, M.; Peng, Z.; Wang, J.; Su, X. Vascular endothelial growth factor gene polymorphisms and gastric cancer risk: A meta-analysis. J. BUON 2017, 22, 714–724. [Google Scholar]
- Kolev, Y.; Uetake, H.; Iida, S.; Ishikawa, T.; Kawano, T.; Sugihara, K. Prognostic significance of VEGF expression in correlation with COX-2 microvassel density, and clinicopathological characteristics in human gastric carcinoma. Ann. Surg. Oncol. 2007, 14, 2738–2747. [Google Scholar] [CrossRef] [PubMed]
- Ji, Y.N.; Wang, Q.; Li, Y.; Wang, Z. Prognostic value of vascular endothelial growth factor A expression in gastric cancer: A meta-analysis. Tumor Biol. 2014, 35, 2787–2793. [Google Scholar] [CrossRef]
- Liu, L.; Ma, X.L.; Xiao, Z.L.; Li, M.; Cheng, S.H.; Wei, Y.Q. Prognostic value of vascular endothelial growth factor expression in resected gastric cancer. Asian Pac. J. Cancer Prev. 2012, 13, 3089–3097. [Google Scholar] [CrossRef]
- Kwak, M.K.; Hur, K.; Park, D.J.; Lee, H.-J.; Lee, H.S.; Kim, W.H.; Lee, K.U.; Choe, K.J.; Yang, H.-K. Expression of chemokine receptors in human gastric cancer. Tumor Biol. 2005, 26, 65–70. [Google Scholar] [CrossRef] [PubMed]
- Arigami, T.; Natsugoe, S.; Uenosono, Y.; Yanagita, S.; Arima, H.; Hirata, M.; Ishigami, S.; Aikou, T. CCR7 expression predicts lymph node status including micrometastasis in gastric cancer. Int. J. Oncol. 2009, 35, 19–24. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Rubie, C.; Kauffels, A.; Kölsch, K.; Glanemann, M.; Justinger, C. CXCL12/CXCR4 display an inverse mRNA expression profile in gastric carcinoma that correlates with tumor progression. Oncol. Lett. 2016, 11, 360–364. [Google Scholar] [CrossRef] [PubMed]
- Ying, J.; Xu, Q.; Zhang, G.; Liu, B.; Zhu, L. The expression of CXCL12 and CXCR4 in gastric cancer and their correlation to lymph node metastasis. Med. Oncol. 2012, 29, 1716–1722. [Google Scholar] [CrossRef]
- He, H.; Wang, C.; Shen, Z.; Fang, Y.; Wang, X.; Chen, W.; Liu, F.; Qin, X.; Sun, Y. Upregulated expression of C-X-C chemokine receptor 4 is an independent prognostic predictor for patients with gastric cancer. PLoS ONE 2013, 8, e71864. [Google Scholar] [CrossRef]
- Xue, L.J.; Mao, X.B.; Ren, L.L.; Chu, X.Y. Inhibition of CXCL12/CXCR4 axis as a potential targeted therapy of advanced gastric carcinoma. Cancer Med. 2017, 6, 1424–1436. [Google Scholar] [CrossRef]
- Zhao, B.C.; Wang, Z.J.; Mao, W.Z.; Ma, H.C.; Han, J.G.; Zhao, B.; Xu, H.M. CXCR4/SDF-1 axis is involved in lymph node metastasis of gastric carcinoma. World J. Gastroenterol. 2011, 17, 2389–2396. [Google Scholar] [CrossRef]
- Tsuboi, K.; Kodera, Y.; Nakanishi, H.; Ito, S.; Mochizuki, Y.; Nakayama, G.; Koike, M.; Fujiwara, M.; Yamamura, Y.; Nakao, A. Expression of CXCL12 and CXCR4 in pT3-stage gastric cancer does not correlate with peritoneal metastasis. Oncol. Rep. 2008, 20, 1117–1123. [Google Scholar]
- Lee, H.J.; Huang, S.M.; Kim, H.Y.; Oh, Y.S.; Hwang, J.Y.; Liang, Z.L.; Min, J.K.; Yun, H.J.; Sul, J.Y.; Kim, S.; et al. Evaluation of the combined expression of chemokine SDF-1α and its receptor CXCR4 as a prognostic marker for gastric cancer. Exp. Ther. Med. 2011, 2, 499–504. [Google Scholar] [CrossRef]
- Nikzaban, M.; Hakhamaneshi, M.S.; Fakhari, S.; Sheikhesmaili, F.; Roshani, D.; Ahsan, B.; Kamali, F.; Jalili, A. The chemokine receptor CXCR4 is associated with the staging of gastric cancer. Adv. Biomed. Res. 2014, 3, 16. [Google Scholar] [CrossRef]
- Satomura, H.; Sasaki, K.; Nakajima, M.; Yamaguchi, S.; Onodera, S.; Otsuka, K.; Takahashi, M.; Muroi, H.; Shida, Y.; Ogata, H.; et al. Can expression of CXCL12 and CXCR4 be used to predict survival of gastric cancer patients? Anticancer Res. 2014, 34, 4051–4057. [Google Scholar] [PubMed]
- Tkacz, M.; Tarnowski, M.; Poniewierska-Baran, A.; Serwin, K.; Madej-Michniewicz, A.; Deskur, A.; Czerny, B.; Starzyńska, T. Impact of Selected Serum Factors on Metastatic Potential of Gastric Cancer Cells. Diagnostics 2022, 12, 700. [Google Scholar] [CrossRef] [PubMed]




| Clinicopathological Factor | N | % | 
|---|---|---|
| Age (years) | ||
| <60 | 9 | 32.0 | 
| 60–69 | 10 | 36.0 | 
| ≥70 | 9 | 32.0 | 
| Mean ± SD | 62.5 ± 12.7 | |
| Median (Range) | 64 (21–79) | |
| Gender | ||
| Male | 20 | 71.4 | 
| Female | 8 | 28.6 | 
| Type of resection | ||
| total gastrectomy | 20 | 71.4 | 
| subtotal gastrectomy | 8 | 28.6 | 
| Lymphadenectomy | ||
| D1 | 12 | 42.9 | 
| D2 | 16 | 57.1 | 
| Tumor location | ||
| upper | 7 | 25 | 
| middle | 5 | 17.8 | 
| lower | 15 | 53.6 | 
| whole stomach | 1 | 3.6 | 
| Tumor size (cm) | ||
| 0.0–3.9 | 9 | 32.2 | 
| 4.0–7.9 | 10 | 35.7 | 
| 8.0–11.9 | 6 | 21.4 | 
| ≥12 | 3 | 10.7 | 
| Lauren classification | ||
| intestinal | 12 | 42.9 | 
| diffuse | 7 | 25 | 
| mixed | 9 | 32.1 | 
| Grading | ||
| G1 | 1 | 3.6 | 
| G2 | 9 | 32.1 | 
| G3 | 18 | 64.3 | 
| pT stage a | ||
| pT1 | 4 | 14.3 | 
| pT1a | 1 | |
| pT1b | 3 | |
| pT2 | 3 | 10.7 | 
| pT3 | 11 | 39.3 | 
| pT4 | 10 | 35.7 | 
| pT4a | 7 | |
| pT4b | 3 | |
| pN stage a | ||
| pN0 | 9 | 32.1 | 
| pN1 | 4 | 14.3 | 
| pN2 | 4 | 14.3 | 
| pN3 | 11 | 39.3 | 
| pN3a | 5 | |
| pN3b | 6 | |
| pTNM stage a | ||
| I | 4 | 14.3 | 
| IA | 3 | |
| IB | 1 | |
| II | 8 | 28.6 | 
| IIA | 5 | |
| IIB | 3 | |
| III | 16 | 57.1 | 
| IIIA | 4 | |
| IIIB | 6 | |
| IIIC | 6 | |
| IV | 0 | 0 | 
| Gene | ENST Number | Starter F (Forward) and R (Reverse) | Product Size (bp) | 
|---|---|---|---|
| VEGF | 00000372055 | F: 5′ GTCACACATCTTCCATCTCC 3′ | 186 | 
| R: 5′ GTGTGCCCCTGATGCGATG 3′ | |||
| CXCR4 | 00000241393 | F: 5′ TTCTTAACTGGCATTGTGGG 3′ | 130 | 
| R: 5′ GAAGCGTGATGACAAAGAGG 3′ | |||
| PBGD | 00000278715 | F: 5′ GCCAAGGACCAGGACATC 3′ | 160 | 
| R: 5′ TCAGGTACAGTTGCCCATC 3′ | 
| Clinicopathological | VEGF | CXCR4 | |||||
|---|---|---|---|---|---|---|---|
| Features | |||||||
| - | + | p-Value | - | + | p-Value | ||
| N | 8 | 20 | 10 | 18 | |||
| Age (years) | 1.0000 | 0.0113 | |||||
| ≤60 | 10 | 3 | 7 | 7 | 3 | ||
| >60 | 18 | 5 | 13 | 3 | 15 | ||
| Gender | 1.0000 | 0.6692 | |||||
| F | 8 | 2 | 6 | 2 | 6 | ||
| M | 20 | 6 | 14 | 8 | 12 | ||
| Tumor size | 0.1998 | 1.0000 | |||||
| ≤4 cm | 11 | 5 | 6 | 4 | 7 | ||
| >4 cm | 17 | 3 | 14 | 6 | 11 | ||
| Lauren classification | 0.3828 | 0.3771 | |||||
| intestinal | 12 | 2 | 10 | 4 | 8 | ||
| diffuse | 7 | 2 | 5 | 4 | 3 | ||
| mixed | 9 | 4 | 5 | 2 | 7 | ||
| pT stage | 0.1423 | 0.6744 | |||||
| T1-T2 | 7 | 4 | 3 | 3 | 4 | ||
| T3-T4 | 21 | 4 | 17 | 7 | 14 | ||
| pN stage | 0.3715 | 0.0028 | |||||
| N0 | 9 | 4 | 5 | 7 | 2 | ||
| N1-N3 | 19 | 4 | 15 | 3 | 16 | ||
| pTNM | 0.0441 | 0.0054 | |||||
| I-II | 12 | 6 | 6 | 8 | 4 | ||
| III-IV | 16 | 2 | 14 | 2 | 14 | ||
| Grade | 1.0000 | 0.2474 | |||||
| G1/G2 | 10 | 3 | 7 | 2 | 8 | ||
| G3 | 18 | 5 | 13 | 8 | 10 | ||
| Tumor location | 0.6618 | 0.0953 | |||||
| upper | 7 | 1 | 6 | 1 | 6 | ||
| middle | 5 | 1 | 4 | 4 | 1 | ||
| lower | 15 | 6 | 9 | 5 | 10 | ||
| whole stomach | 1 | 0 | 1 | 0 | 1 | ||
| Vascular invasion | 0.2144 | 0.098 | |||||
| negative | 19 | 7 | 12 | 9 | 10 | ||
| positive | 9 | 1 | 8 | 1 | 8 | ||
| n (20) | % | |
|---|---|---|
| VEGF | ||
| + (<10%) | 8 | 40 | 
| ++ (10–50%) | 7 | 35 | 
| +++ (>50%) | 5 | 25 | 
| CD34 | ||
| + | 3 | 15 | 
| ++ | 7 | 35 | 
| +++ | 10 | 50 | 
| VEGF | |||
|---|---|---|---|
| CD34 | + (n = 8) | ++/+++ (n = 12) | * p-Value | 
| + (n = 3) | 3 | 0 | 0.0491 | 
| ++/+++ (n = 17) | 5 | 12 | |
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kruszyna, Ł.; Murawa, D.; Jagodziński, P.P.; Oszkinis, G.; Krasiński, Z. The Expression and Prognostic Significance of VEGF and CXCR4 in Gastric Cancer: Correlation with Angiogenesis, Lymphangiogenesis and Progression. Curr. Issues Mol. Biol. 2022, 44, 3075-3088. https://doi.org/10.3390/cimb44070212
Kruszyna Ł, Murawa D, Jagodziński PP, Oszkinis G, Krasiński Z. The Expression and Prognostic Significance of VEGF and CXCR4 in Gastric Cancer: Correlation with Angiogenesis, Lymphangiogenesis and Progression. Current Issues in Molecular Biology. 2022; 44(7):3075-3088. https://doi.org/10.3390/cimb44070212
Chicago/Turabian StyleKruszyna, Łukasz, Dawid Murawa, Paweł Piotr Jagodziński, Grzegorz Oszkinis, and Zbigniew Krasiński. 2022. "The Expression and Prognostic Significance of VEGF and CXCR4 in Gastric Cancer: Correlation with Angiogenesis, Lymphangiogenesis and Progression" Current Issues in Molecular Biology 44, no. 7: 3075-3088. https://doi.org/10.3390/cimb44070212
APA StyleKruszyna, Ł., Murawa, D., Jagodziński, P. P., Oszkinis, G., & Krasiński, Z. (2022). The Expression and Prognostic Significance of VEGF and CXCR4 in Gastric Cancer: Correlation with Angiogenesis, Lymphangiogenesis and Progression. Current Issues in Molecular Biology, 44(7), 3075-3088. https://doi.org/10.3390/cimb44070212
 
         
                                                

 
       