Association of Single Nucleotide Polymorphisms from Angiogenesis-Related Genes, ANGPT2, TLR2 and TLR9, with Spontaneous Preterm Labor
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Population
2.2. Blood Sample Processing
2.3. SNP Selection and Genotyping
2.4. Statistical Analysis
3. Results
3.1. Patient Characteristics
3.2. APTT and PLT Parameters in Pregnant Women
3.3. Hardy-Weinberg Equilibrium
3.4. Associations of Genotypes and Alleles with PTL
3.5. Sample Size Calculation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Merced, C.; Goya, M.; Pratcorona, L.; Rodó, C.; Llurba, E.; Higueras, T.; Cabero, L.; Carreras, E. Cervical pessary for preventing preterm birth in twin pregnancies with maternal short cervix after an episode of threatened preterm labor: Randomised controlled trial. Am. J. Obstet. Gynecol. 2019, 221, 55.e1–55.e14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bomba-Opoń, D.A.; Wielgoś, M. Nowoczesna terapia porodu przedwczesnego. In Diagnostyka Prenatalna z Elementami Perinatologii; Wielgoś, M., Ed.; Via Medica: Gdańsk, Poland, 2009; pp. 218–227. [Google Scholar]
- Hamilton, B.E.; Martin, J.A.; Osterman, M.J.; Curtin, S.C.; Matthews, T.J. Births: Final data for 2014. Natl. Vital Stat. Rep. 2015, 64, 1–64. [Google Scholar] [PubMed]
- Treyvaud, K. Parent and family outcomes following very preterm or very low birth weight birth: A review. Semin. Fetal Neonatal Med. 2014, 19, 131–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leijnse, J.E.; de Heus, R.; de Jager, W.; Rodenburg, W.; Peeters, L.L.; Franx, A.; Eijkelkamp, N. First trimester placental vascularization and angiogenetic factors are associated with adverse pregnancy outcome. Pregnancy Hypertens. 2018, 13, 87–94. [Google Scholar] [CrossRef] [Scilit]
- Patni, S.; Bryant, A.H.; Wynen, L.P.; Seager, A.L.; Morgan, G.; Thornton, C.A. Functional activity but not gene expression of toll-like receptors is decreased in the preterm versus term human placenta. Placenta 2015, 36, 1031–1038. [Google Scholar] [CrossRef] [Scilit]
- Umapathy, A.; Chamley, L.W.; James, J.L. Reconciling the distinct roles of angiogenic/anti-angiogenic factors in the placenta and maternal circulation of normal and pathological pregnancies. Angiogenesis 2020, 23, 105–117. [Google Scholar] [CrossRef] [Scilit]
- Alfaidy, N.; Hoffmann, P.; Boufettal, H.; Samouh, N.; Aboussaouira, T.; Benharouga, M.; Feige, J.J.; Brouillet, S. The multiple roles of EG-VEGF/PROK1 in normal and pathological placental angiogenesis. Biomed. Res. Int. 2014, 2014, 451906. [Google Scholar] [CrossRef] [Scilit]
- Pereira, R.D.; De Long, N.E.; Wang, R.C.; Yazdi, F.T.; Holloway, A.C.; Raha, S. Angiogenesis in the placenta: The role of reactive oxygen species signaling. Biomed. Res. Int. 2015, 2015, 814543. [Google Scholar] [CrossRef] [Scilit]
- Brosens, I.; Pijnenborg, R.; Vercruysse, L.; Romero, R. The “Great Obstetrical Syndromes” are associated with disorders of deep placentation. Am. J. Obstet. Gynecol. 2011, 204, 193–201. [Google Scholar] [CrossRef] [Scilit]
- Witzenbichler, B.; Maisonpierre, P.C.; Jones, P.; Yancopoulos, G.D.; Isner, J.M. Chemotactic properties of angiopoietin-1 and -2, ligands for the endothelial-specific receptor tyrosine kinase Tie2. J. Biol. Chem. 1998, 273, 18514–18521. [Google Scholar] [CrossRef] [Scilit]
- Tzepi, I.-M.; Giamarellos-Bourboulis, E.J.; Carrer, D.-P.; Tsaganos, T.; Claus, R.A.; Vaki, I.; Pelekanou, A.; Kotsaki, A.; Tziortzioti, V.; Topouzis, S.; et al. Angiopoietin-2 enhances survival in experimental sepsis induced by multidrug-resistant Pseudomonas aeruginosa. J. Pharmacol. Exp. Ther. 2012, 343, 278–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Polyzou, E.N.; Evangelinakis, N.; Pistiki, A.; Kotsaki, A.; Siristatidis, C.S.; Chrelias, C.G.; Salamalekis, E.; Kassanos, D.P.; Giamarellos-Bourboulis, E.J. Angiopoietin-2 primes infection-induced preterm delivery. PLoS ONE 2014, 9, e86523. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abrahams, V.M.; Mor, G. Toll-like receptors and their role in the trophoblast. Placenta 2005, 26, 540–547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patni, S.; Wynen, L.P.; Seager, A.L.; Morgan, G.; White, J.O.; Thornton, C.A. Expression and activity of Toll-like receptors 1-9 in the human term placenta and changes associated with labor at term. Biol. Reprod. 2009, 80, 243–248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aplin, A.C.; Ligresti, G.; Fogel, E.; Zorzi, P.; Smith, K.; Nicosia, R.F. Regulation of angiogenesis, mural cell recruitment and adventitial macrophage behavior by Toll-like receptors. Angiogenesis 2014, 17, 147–161. [Google Scholar] [CrossRef] [Scilit]
- Grote, K.; Schuett, H.; Salguero, G.; Grothusen, C.; Jagielska, J.; Drexler, H.; Mühlradt, P.F.; Schieffer, B. Toll-like receptor 2/6 stimulation promotes angiogenesis via GM-CSF as a potential strategy for immune defense and tissue regeneration. Blood 2010, 115, 2543–2552. [Google Scholar] [CrossRef] [Scilit]
- Grote, K.; Petri, M.; Liu, C.; Jehn, P.; Spalthoff, S.; Kokemüller, H.; Luchtefeld, M.; Tschernig, T.; Krettek, C.; Haasper, C.; et al. Toll-like receptor 2/6-dependent stimulation of mesenchymal stem cells promotes angiogenesis by paracrine factors. Eur. Cell Mater. 2013, 26, 66–79. [Google Scholar] [CrossRef] [Scilit]
- Hilbert, T.; Dornbusch, K.; Baumgarten, G.; Hoeft, A.; Frede, S.; Klaschik, S. Pulmonary vascular inflammation: Effect of TLR signalling on angiopoietin/TIE regulation. Clin. Exp. Pharmacol. Physiol. 2017, 44, 123–131. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.; Su, W.; Powner, M.B.; Liu, J.; Copland, D.A.; Fruttiger, M.; Madeddu, P.; Dick, A.D.; Liu, L. Pleiotropic action of CpG-ODN on endothelium and macrophages attenuates angiogenesis through distinct pathways. Sci. Rep. 2016, 6, 31873. [Google Scholar] [CrossRef] [Scilit]
- Srinivas, S.K.; Morrison, A.C.; Andrela, C.M.; Elovitz, M.A. Allelic variations in angiogenic pathway genes are associated with preeclampsia. Am. J. Obstet. Gynecol. 2010, 202, 445.e1–445.e11. [Google Scholar] [CrossRef] [Scilit]
- Valenzuela, F.J.; Perez-Sepulveda, A.; Torres, M.J.; Correa, P.; Repetto, G.M.; Illanes, S.E. Pathogenesis of preeclampsia: The genetic component. J. Pregnancy 2012, 2012, 632732. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ajabi, N.; Mashayekhi, F.; Osalou, M.A. Angiopoietin-2 1087G > A rs3020221 gene polymorphism is associated with in vitro fertilization and embryo transfer outcome. Middle East Fertil. Soc. J. 2017, 22, 336–339. [Google Scholar] [CrossRef] [Scilit]
- Konac, E.; Onen, H.I.; Metindir, J.; Alp, E.; Biri, A.A.; Ekmekci, A. Lack of association between −460 C/T and 936 C/T of the vascular endothelial growth factor and angiopoietin-2 exon 4 G/A polymorphisms and ovarian, cervical, and endometrial cancers. DNA Cell Biol. 2007, 26, 453–463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pietrowski, D.; Tempfer, C.; Bettendorf, H.; Bürkle, B.; Nagele, F.; Unfried, G.; Keck, C. Angiopoietin-2 polymorphism in women with idiopathic recurrent miscarriage. Fertil. Steril. 2003, 80, 1026–1029. [Google Scholar] [CrossRef] [Scilit]
- Mirkamandar, E.; Nemati, M.; Hayatbakhsh, M.M.; Bassagh, A.; Khosravimashizi, A.; Jafarzadeh, A. Association of a single nucleotide polymorphism in the TLR2 gene (rs3804099), but not in the TLR4 gene (rs4986790), with Helicobacter pylori infection and peptic ulcer. Turk. J. Gastroenterol. 2018, 29, 283–291. [Google Scholar] [CrossRef] [Scilit]
- Zhang, P.; Zhang, N.; Liu, L.; Zheng, K.; Zhu, L.; Zhu, J.; Cao, L.; Jiang, Y.; Liu, G.; He, Q. Polymorphisms of toll-like receptors 2 and 9 and severity and prognosis of bacterial meningitis in Chinese children. Sci. Rep. 2017, 7, 42796. [Google Scholar] [CrossRef] [Scilit]
- Randhawa, A.K.; Shey, M.; Keyser, A.; Peixoto, B.; Wells, R.D.; De Kock, M.; Lerumo, L.; Hughes, J.; Hussey, G.; Hawkridge, A.; et al. South African Tuberculosis Vaccine Initiative Team. Association of human TLR1 and TLR6 deficiency with altered immune responses to BCG vaccination in South African infants. PLoS Pathog. 2011, 7, e1002174. [Google Scholar] [CrossRef] [Scilit]
- Schurz, H.; Daya, M.; Moller, M.; Hoal, E.G.; Salie, M. TLR1, 2, 4, 6 and 9 Variants Associated with Tuberculosis Susceptibility: A Systematic Review and Meta-Analysis. PLoS ONE 2015, 10, e0139711. [Google Scholar] [CrossRef] [Scilit]
- Shey, M.; Randhawa, A.K.; Bowmaker, M.; Smith, E.; Scriba, T.; De Kock, M.; Mahomed, H.; Hussey, G.; Hawn, T.R.; Hanekom, W.A. Single nucleotide polymorphisms in toll-like receptor 6 are associated with altered lipopeptide- and mycobacteria-induced interleukin-6 secretion. Genes Immun. 2010, 11, 561–572. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.G.; Zhang, M.M.; Wang, Y.; Wu, S.Q.; Zhang, M.; He, J.Q. Association of TLR8 and TLR9 polymorphisms with tuberculosis in a Chinese Han population: A case-control study. BMC Infect. Dis. 2018, 18, 561. [Google Scholar] [CrossRef] [Scilit]
- Fischer, J.; Weber, A.; Böhm, S.; Dickhöfer, S.; El Maadidi, S.; Deichsel, D.; Knop, V.; Klinker, H.; Möller, B.; Rasenack, J.; et al. Sex-specific effects of TLR9 promoter variants on spontaneous clearance of HCV infection. Gut 2017, 66, 1829–1837. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ambrocio-Ortiz, E.; Pérez-Rubio, G.; Abarca-Rojano, E.; Montaño, M.; Ramos, C.; Hernández-Zenteno, R.D.; Del Angel-Pablo, A.D.; Reséndiz-Hernández, J.M.; Ramírez-Venegas, A.; Falfán-Valencia, R. Influence of proinflammatory cytokine gene polymorphisms on the risk of COPD and the levels of plasma protein. Cytokine 2018, 111, 364–370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keren-Politansky, A.; Breizman, T.; Brenner, B.; Sarig, G.; Drugan, A. The coagulation profile of preterm delivery. Thromb. Res. 2014, 133, 585–589. [Google Scholar] [CrossRef] [Scilit]
- Bremme, K.A. Haemostatic changes in pregnancy. Best Pr. Res. Clin. Haematol. 2003, 16, 153–168. [Google Scholar] [CrossRef] [Scilit]
- Cerneca, F.; Ricci, G.; Simeone, R.; Malisano, M.; Alberico, S.; Guaschino, S. Coagulation and fibrinolysis changes in normal pregnancy. Increased levels of procoagulants and reduced levels of inhibitors during pregnancy induce a hypercoagulable state, combined with a reactive fibrinolysis. Eur. J. Obstet. Gynecol. Reprod. Biol. 1997, 73, 31–36. [Google Scholar] [CrossRef] [Scilit]
- Hellgren, M. Hemostasis during normal pregnancy and puerperium. Semin. Thromb. Hemost. 2003, 29, 125–130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaiworapongsa, T.; Espinoza, J.; Yoshimatsu, J.; Kim, Y.M.; Bujold, E.; Edwin, S.; Yoon, B.H.; Romero, R. Activation of coagulation system in preterm labor and preterm premature rupture of membranes. J. Matern. Fetal Neonatal Med. 2002, 11, 368–373. [Google Scholar] [CrossRef] [PubMed]
- Elovitz, M.A.; Baron, J.; Phillippe, M. The role of thrombin in preterm parturition. Am. J. Obstet. Gynecol. 2001, 185, 1059–1063. [Google Scholar] [CrossRef] [Scilit]
- Magee, L.A.; Pels, A.; Helewa, M.; Rey, E.; von Dadelszen, P.; Canadian Hypertensive Disorders of Pregnancy Working Group. Diagnosis, evaluation, and management of the hypertensive disorders of pregnancy: Executive summary. J. Obstet. Gynaecol. Can. 2014, 36, 416–441. [Google Scholar] [CrossRef] [Scilit]
- SNP Database (dbSNP) of the National Center for Biotechnology Information (NCBI). Available online: https://www.ncbi.nlm.nih.gov/snp/ (accessed on 22 February 2022).
- Amin-Beidokhti, M.; Gholami, M.; Abedin-Do, A.; Pirjani, R.; Sadeghi, H.; Karamoddin, F.; Yassaee, V.R.; Mirfakhraie, R. An intron variant in the FLT1 gene increases the risk of preeclampsia in Iranian women. Clin. Exp. Hypertens. 2019, 41, 697–701. [Google Scholar] [CrossRef] [Scilit]
- Denschlag, D.; Bettendorf, H.; Watermann, D.; Keck, C.; Tempfer, C.; Pietrowski, D. Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma. Fertil. Steril. 2005, 84, 162–166. [Google Scholar] [CrossRef] [Scilit]
- Elloumi, N.; Fakhfakh, R.; Abida, O.; Ayadi, L.; Marzouk, S.; Hachicha, H.; Fourati, M.; Bahloul, Z.; Mhiri, M.N.; Kammoun, K.; et al. Relevant genetic polymorphisms and kidney expression of Toll-like receptor (TLR)-5 and TLR-9 in lupus nephritis. Clin. Exp. Immunol. 2017, 190, 328–339. [Google Scholar] [CrossRef] [Scilit]
- Meena, N.K.; Ahuja, V.; Meena, K.; Paul, J. Association of TLR5 gene polymorphisms in ulcerative colitis patients of north India and their role in cytokine homeostasis. PLoS ONE 2015, 10, e0120697. [Google Scholar] [CrossRef] [Scilit]
- Saeki, H.; Tsunemi, Y.; Asano, N.; Nakamura, K.; Sekiya, T.; Hirai, K.; Kakinuma, T.; Fujita, H.; Kagami, S.; Tamaki, K. Analysis of GM-CSF gene polymorphisms (3606T/C and 3928C/T) in Japanese patients with atopic dermatitis. Clin. Exp. Dermatol. 2006, 31, 278–280. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Bu, H.; Hong, K.; Yin, H.; Zou, Y.-L.; Geng, S.-J.; Zheng, M.-M.; He, J.-Y. Genetic polymorphisms of CCL1 rs2072069 G/A and TLR2 rs3804099 T/C in pulmonary or meningeal tuberculosis patients. Int. J. Clin. Exp. Pathol. 2015, 8, 12608–12620. [Google Scholar]
- SNPStats Software. Available online: https://www.snpstats.net/start.htm (accessed on 22 February 2022).
- Bagamery, K.; Landau, R.; Kvell, K.; Graham, J. Different platelet activation levels in non-pregnant, normotensive pregnant, pregnancy-induced hypertensive and pre-eclamptic women. A pilot study of flow cytometric analysis. Eur. J. Obstet. Gynecol. Reprod. Biol. 2005, 121, 117–118. [Google Scholar] [CrossRef] [Scilit]
- Erez, O.; Romero, R.; Hoppensteadt, D.; Fareed, J.; Chaiworapongsa, T.; Kusanovic, J.P.; Mazaki-Tovi, S.; Gotsch, F.; Than, N.G.; Vaisbuch, E.; et al. Premature labor: A state of platelet activation? J. Perinat. Med. 2008, 36, 377–387. [Google Scholar] [CrossRef] [Scilit]
- Lok, C.A.R.; Nieuwland, R.; Sturk, A.; Hau, C.M.; Boer, K.; Van Bavel, E.; Vanderpost, J.A.M. Microparticle-associated P-selectin reflects platelet activation in preeclampsia. Platelets 2007, 18, 68–72. [Google Scholar] [CrossRef] [Scilit]
- Missfelder-Lobos, H.; Teran, E.; Lees, C.; Albaiges, G.; Nicolaides, K.H. Platelet changes and subsequent development of pre-eclampsia and fetal growth restriction in women with abnormal uterine artery Doppler screening. Ultrasound Obstet. Gynecol. 2002, 19, 443–448. [Google Scholar] [CrossRef] [Scilit]
- Artunc Ulkumen, B.; Pala, H.G.; Calik, E.; Oruc Koltan, S. Platelet distribution width (PDW): A putative marker for threatened preterm labour. Pak. J. Med. Sci. 2014, 30, 745–748. [Google Scholar] [CrossRef] [Scilit]
- Tygart, S.G.; McRoyan, D.K.; Spinnato, J.A.; McRoyan, C.J.; Kitay, D.Z. Longitudinal study of platelet indices during normal pregnancy. Am. J. Obstet. Gynecol. 1986, 154, 883–887. [Google Scholar] [CrossRef] [Scilit]
- Badfar, G.; Shohani, M.; Soleymani, A.; Azami, M. Maternal anemia during pregnancy and small for gestational age: A systematic review and meta-analysis. J. Matern. Fetal Neonatal Med. 2019, 32, 1728–1734. [Google Scholar] [CrossRef] [Scilit]
- Druk, L.; Hants, Y.; Farkash, R.; Ruchlemer, R.; Samueloff, A.; Grisaru-Granovsky, S. Iron deficiency anemia at admission for labor and delivery is associated with an increased risk for Cesarean section and adverse maternal and neonatal outcomes. Transfusion 2015, 55, 2799–2806. [Google Scholar] [CrossRef] [Scilit]
- Mahmood, T.; Rehman, A.U.; Tserenpil, G.; Siddiqui, F.; Ahmed, M.; Siraj, F.; Kumar, B. The Association between Iron-deficiency Anemia and Adverse Pregnancy Outcomes: A Retrospective Report from Pakistan. Cureus 2019, 11, e5854. [Google Scholar] [CrossRef] [Scilit]
- Parks, S.; Hoffman, M.K.; Goudar, S.S.; Patel, A.; Saleem, S.; Ali, S.A.; Goldenberg, R.L.; Hibberd, P.L.; Moore, J.; Wallace, D.; et al. Maternal anaemia and maternal, fetal, and neonatal outcomes in a prospective cohort study in India and Pakistan. BJOG 2019, 126, 737–743. [Google Scholar] [CrossRef] [Scilit]
- Ronkainen, J.; Lowry, E.; Heiskala, A.; Uusitalo, I.; Koivunen, P.; Kajantie, E.; Vääräsmäki, M.; Järvelin, M.-R.; Sebert, S. Maternal hemoglobin associates with preterm delivery and small for gestational age in two Finnish birth cohorts. Eur. J. Obstet. Gynecol. Reprod. Biol. 2019, 238, 44–48. [Google Scholar] [CrossRef] [Scilit]
- Young, M.F.; Oaks, B.M.; Tandon, S.; Martorell, R.; Dewey, K.G.; Wendt, A.S. Maternal hemoglobin concentrations across pregnancy and maternal and child health: A systematic review and meta-analysis. Ann. N.Y. Acad. Sci. 2019, 1450, 47–68. [Google Scholar] [CrossRef] [Scilit]
- Jung, J.; Rahman, M.; Rahman, S.; Swe, K.T.; Islam, R.; Rahman, O.; Akter, S. Effects of hemoglobin levels during pregnancy on adverse maternal and infant outcomes: A systematic review and meta-analysis. Ann. N.Y. Acad. Sci. 2019, 1450, 69–82. [Google Scholar] [CrossRef] [Scilit]
- Ramaeker, D.M.; Simhan, H.N. Sonographic cervical length, vaginal bleeding, and the risk of preterm birth. Am. J. Obstet. Gynecol. 2012, 206, 224.e1–224.e4. [Google Scholar] [CrossRef] [Scilit]
- Expert Panel on GYN and OB Imaging; Shipp, T.D.; Poder, L.; Feldstein, V.A.; Oliver, E.R.; Promes, S.B.; Strachowski, L.M.; Sussman, B.L.; Wang, E.Y.; Weber, T.M.; et al. ACR Appropriateness Criteria® Second and Third Trimester Vaginal Bleeding. J. Am. Coll. Radiol. 2020, 17, S497–S504. [Google Scholar] [CrossRef] [Scilit]
- Petriglia, G.; Palaia, I.; Musella, A.; Marchetti, C.; Antonilli, M.; Brunelli, R.; Ostuni, R. Threatened abortion and late-pregnancy complications: A case-control study and review of literature. Minerva Ginecol. 2015, 67, 491–497. [Google Scholar]
- Saraswat, L.; Bhattacharya, S.; Maheshwari, A.; Bhattacharya, S. Maternal and perinatal outcome in women with threatened miscarriage in the first trimester: A systematic review. BJOG 2010, 117, 245–257. [Google Scholar] [CrossRef] [Scilit]
- Saber, T.; Veale, D.J.; Balogh, E.; McCormick, J.; NicAnUltaigh, S.; Connolly, M.; Fearon, U. Toll-like receptor 2 induced angiogenesis and invasion is mediated through the Tie2 signalling pathway in rheumatoid arthritis. PLoS ONE 2011, 6, e23540. [Google Scholar] [CrossRef] [Scilit]
- Chen, K.-H.; Gu, W.; Zeng, L.; Jiang, D.-P.; Zhang, L.-Y.; Zhou, J.; Du, D.-Y.; Hu, P.; Liu, Q.; Huang, S.-N.; et al. Identification of haplotype tag SNPs within the entire TLR2 gene and their clinical relevance in patients with major trauma. Shock 2011, 35, 35–41. [Google Scholar] [CrossRef] [Scilit]
- Varzari, A.; Deyneko, I.V.; Vladei, I.; Grallert, H.; Schieck, M.; Tudor, E.; Illig, T. Genetic variation in TLR pathway and the risk of pulmonary tuberculosis in a Moldavian population. Infect. Genet. Evol. 2018, 68, 84–90. [Google Scholar] [CrossRef] [Scilit]
- Ma, X.; Liu, Y.; Gowen, B.B.; Graviss, E.A.; Clark, A.G.; Musser, J.M. Full-exon resequencing reveals toll-like receptor variants contribute to human susceptibility to tuberculosis disease. PLoS ONE 2007, 2, e1318. [Google Scholar] [CrossRef] [Scilit]
- Naderi, M.; Hashemi, M.; Hazire-Yazdi, L.; Taheri, M.; Moazeni-Roodi, A.; Eskandari, E.; Bahari, G. Association between toll-like receptor2 Arg677Trp and 597T/C gene polymorphisms and pulmonary tuberculosis in Zahedan, Southeast Iran. Braz. J. Infect. Dis. 2013, 17, 516–520. [Google Scholar] [CrossRef] [Scilit]
- Xue, X.; Qiu, Y.; Jiang, D.; Jin, T.; Yan, M.; Zhu, X.; Chu, Y. The association analysis of TLR2 and TLR4 gene with tuberculosis in the Tibetan Chinese population. Oncotarget 2017, 8, 113082–113089. [Google Scholar] [CrossRef] [Scilit]
- Junjie, X.; Songyao, J.; Minmin, S.; Yanyan, S.; Baiyong, S.; Xiaxing, D.; Jiabin, J.; Xi, Z.; Hao, C. The association between Toll-like receptor 2 single-nucleotide polymorphisms and hepatocellular carcinoma susceptibility. BMC Cancer 2012, 12, 57. [Google Scholar] [CrossRef] [Scilit]
- Kim, M.K.; Park, S.W.; Kim, S.K.; Park, H.J.; Eun, Y.G.; Kwon, K.H.; Kim, J. Association of Toll-like receptor 2 polymorphisms with papillary thyroid cancer and clinicopathologic features in a Korean population. J. Korean Med. Sci. 2012, 27, 1333–1338. [Google Scholar] [CrossRef] [Scilit]
- Zeng, H.-M.; Pan, K.-F.; Zhang, Y.; Zhang, L.; Ma, J.-L.; Zhou, T.; Su, H.-J.; Li, W.-Q.; Li, J.-Y.; You, W.-C. The correlation between polymorphisms of Toll-like receptor 2 and Toll-like receptor 9 and susceptibility to gastric cancer. Zhonghua Yu Fang Yi Xue Za Zhi 2011, 45, 588–592. [Google Scholar] [CrossRef]
- Semlali, A.; Parine, N.R.; Al-Numair, N.S.; Almutairi, M.; Hawsawi, Y.M.; Al Amri, A.; Aljebreen, A.M.; Arafah, M.; Almadi, M.A.; Azzam, N.A.; et al. Potential role of Toll-like receptor 2 expression and polymorphisms in colon cancer susceptibility in the Saudi Arabian population. OncoTargets Ther. 2018, 11, 8127–8141. [Google Scholar] [CrossRef] [Scilit]
- Oyarzún, C.P.M.; Glembotsky, A.C.; Goette, N.P.; Lev, P.R.; De Luca, G.; Pietto, M.C.B.; Moiraghi, B.; Ríos, M.A.C.; Vicente, A.; Marta, R.F.; et al. Platelet Toll-Like Receptors Mediate Thromboinflammatory Responses in Patients with Essential Thrombocythemia. Front. Immunol. 2020, 11, 705. [Google Scholar] [CrossRef] [Scilit]
- Oluboyo, A.; Chukwu, S.I.; O Oluboyo, B.; Odewusi, O.O. Evaluation of Angiopoietins 1 and 2 in Malaria-Infested Children. J. Environ. Public Health 2020, 2020, 2169763. [Google Scholar] [CrossRef] [Scilit]
- Jäckel, S.; Kiouptsi, K.; Lillich, M.; Hendrikx, T.; Khandagale, A.; Kollar, B.; Hörmann, N.; Reiss, C.; Subramaniam, S.; Wilms, E.; et al. Gut microbiota regulate hepatic von Willebrand factor synthesis and arterial thrombus formation via Toll-like receptor-2. Blood 2017, 130, 542–553. [Google Scholar] [CrossRef] [Scilit]
- Biswas, S.; Zimman, A.; Gao, D.; Byzova, T.V.; Podrez, E.A. TLR2 Plays a Key Role in Platelet Hyperreactivity and Accelerated Thrombosis Associated With Hyperlipidemia. Circ. Res. 2017, 121, 951–962. [Google Scholar] [CrossRef] [Scilit]
- Allam, R.; Anders, H.J. The role of innate immunity in autoimmune tissue injury. Curr. Opin. Rheumatol. 2008, 20, 538–544. [Google Scholar] [CrossRef] [Scilit]
- Brentano, F.; Kyburz, D.; Gay, S. Toll-like receptors and rheumatoid arthritis. Methods Mol. Biol. 2009, 517, 329–343. [Google Scholar] [CrossRef] [Scilit]
- Lampropoulou, V.; Hoehlig, K.; Roch, T.; Neves, P.; Calderón-Gómez, E.; Sweenie, C.H.; Hao, Y.; Freitas, A.A.; Steinhoff, U.; Anderton, S.M.; et al. TLR-activated B cells suppress T cell-mediated autoimmunity. J. Immunol. 2008, 180, 4763–4773. [Google Scholar] [CrossRef] [Scilit]
- Lien, E.; Zipris, D. The role of Toll-like receptor pathways in the mechanism of type 1 diabetes. Curr. Mol. Med. 2009, 9, 52–68. [Google Scholar] [CrossRef] [Scilit]
- Papadimitraki, E.D.; Bertsias, G.K.; Boumpas, D.T. Toll like receptors and autoimmunity: A critical appraisal. J. Autoimmun. 2007, 29, 310–318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wen, L.; Ley, R.E.; Volchkov, P.Y.; Stranges, P.B.; Avanesyan, L.; Stonebraker, A.C.; Hu, C.; Wong, F.S.; Szot, G.L.; Bluestone, J.A.; et al. Innate immunity and intestinal microbiota in the development of Type 1 diabetes. Nature 2008, 455, 1109–1113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tai, N.; Wong, F.S.; Wen, L. TLR9 deficiency promotes CD73 expression in T cells and diabetes protection in nonobese diabetic mice. J. Immunol. 2013, 191, 2926–2937. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wong, F.S.; Hu, C.; Zhang, L.; Du, W.; Alexopoulou, L.; Flavell, R.A.; Wen, L. The role of Toll-like receptors 3 and 9 in the development of autoimmune diabetes in NOD mice. Ann. N.Y. Acad. Sci. 2008, 1150, 146–148. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Lee, A.S.; Shameli, A.; Geng, X.; Finegood, D.; Santamaria, P.; Dutz, J.P. TLR9 blockade inhibits activation of diabetogenic CD8+ T cells and delays autoimmune diabetes. J. Immunol. 2010, 184, 5645–5653. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.; Peng, J.; Tai, N.; Pearson, J.A.; Hu, C.; Guo, J.; Hou, L.; Zhao, H.; Wong, F.S.; Wen, L. Toll-like receptor 9 negatively regulates pancreatic islet beta cell growth and function in a mouse model of type 1 diabetes. Diabetologia 2018, 61, 2333–2343. [Google Scholar] [CrossRef] [Scilit]
- Wifi, M.-N.A.; Assem, M.; Elsherif, R.H.; El-Azab, H.A.-F.; Saif, A. Toll-like receptors-2 and -9 (TLR2 and TLR9) gene polymorphism in patients with type 2 diabetes and diabetic foot. Med. Balt 2017, 96, e6760. [Google Scholar] [CrossRef] [Scilit]
- Alvarez, A.E.; Marson, F.A.L.; Bertuzzo, C.S.; Bastos, J.C.S.; Baracat, E.C.E.; Brandao, M.B.; Tresoldi, A.T.; das Neves Romaneli, M.T.; Almeida, C.C.B.; de Oliveira, T.; et al. Association between single nucleotide polymorphisms in TLR4, TLR2, TLR9, VDR, NOS2 and CCL5 genes with acute viral bronchiolitis. Gene 2018, 645, 7–17. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Wang, S.; Liu, L.; Chen, Z.; Qiang, F.; Kan, Y.; Shen, Y.; Wu, J.; Shen, H.; Hu, Z. A genetic variant in the promoter region of Toll-like receptor 9 and cervical cancer susceptibility. DNA Cell Biol. 2012, 31, 766–771. [Google Scholar] [CrossRef] [Scilit]
- Tian, S.; Zhang, L.; Yang, T.; Wei, X.; Zhang, L.; Yu, Y.; Li, Y.; Cao, D.; Yang, X. The Associations between Toll-Like Receptor 9 Gene Polymorphisms and Cervical Cancer Susceptibility. Mediat. Inflamm. 2018, 2018, 9127146. [Google Scholar] [CrossRef] [Scilit]
- Gębura, K.; Świerkot, J.; Wysoczańska, B.; Korman, L.; Nowak, B.; Wiland, P.; Bogunia-Kubik, K. Polymorphisms within Genes Involved in Regulation of the NF-κB Pathway in Patients with Rheumatoid Arthritis. Int. J. Mol. Sci. 2017, 18, 1432. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chauhan, A.; Pandey, N.; Desai, A.; Raithatha, N.; Patel, P.; Choxi, Y.; Kapadia, R.; Khandelwal, R.; Jain, N. Association of TLR4 and TLR9 gene polymorphisms and haplotypes with cervicitis susceptibility. PLoS ONE 2019, 14, e0220330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hamann, L.; Hamprecht, A.; Gomma, A.; Schumann, R.R. Rapid and inexpensive real-time PCR for genotyping functional polymorphisms within the Toll-like receptor -2, -4, and -9 genes. J. Immunol. Methods 2004, 285, 281–291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bharti, D.; Kumar, A.; Mahla, R.; Kumar, S.; Ingle, H.; Shankar, H.; Joshi, B.; Raut, A.A.; Kumar, H. The role of TLR9 polymorphism in susceptibility to pulmonary tuberculosis. Immunogenetics 2014, 66, 675–681. [Google Scholar] [CrossRef] [Scilit]
- Heger, L.A.; Hortmann, M.; Albrecht, M.; Colberg, C.; Peter, K.; Witsch, T.; Stallmann, D.; Zirlik, A.; Bode, C.; Duerschmied, D.; et al. Inflammation in acute coronary syndrome: Expression of TLR2 mRNA is increased in platelets of patients with ACS. PLoS ONE 2019, 14, e0224181. [Google Scholar] [CrossRef] [Scilit]
- Panigrahi, S.; Ma, Y.; Hong, L.; Gao, D.; West, X.Z.; Salomon, R.G.; Byzova, T.V.; Podrez, E.A. Engagement of platelet toll-like receptor 9 by novel endogenous ligands promotes platelet hyperreactivity and thrombosis. Circ. Res. 2013, 112, 103–112. [Google Scholar] [CrossRef] [Scilit]
- Aslam, R.; Speck, E.R.; Kim, M.; Crow, A.R.; Bang, K.W.A.; Nestel, F.P.; Ni, H.; Lazarus, A.; Freedman, J.; Semple, J.W. Platelet Toll-like receptor expression modulates lipopolysaccharide-induced thrombocytopenia and tumor necrosis factor-alpha production in vivo. Blood 2006, 107, 637–641. [Google Scholar] [CrossRef] [Scilit]
- Wujcicka, W.I.; Kacerovsky, M.; Krekora, M.; Kaczmarek, P.; Grzesiak, M. Single Nucleotide Polymorphisms from CSF2, FLT1, TFPI and TLR9 Genes Are Associated with Prelabor Rupture of Membranes. Genes 2021, 12, 1725. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Ke, Z.; Liao, W.; Chen, H.; Wei, S.; Lai, X.; Chen, X. Pregnancy outcomes and superiorities of prophylactic cervical cerclage and therapeutic cervical cerclage in cervical insufficiency pregnant women. Arch. Gynecol. Obstet. 2018, 297, 1503–1508. [Google Scholar] [CrossRef] [Scilit]

| Controls | Cases | p-Value a | ||
|---|---|---|---|---|
| Number | 160 | 160 | ||
| Age (years) | 29.04 ± 4.98 | 27.97 ± 4.83 | 0.052 | |
| Primiparous women, n b (%) | 96 (60.0%) | 97 (60.6%) | 1.000 | |
| Current pregnancy disorders, n (%) | Anemia | 7 (4.4%) | 29 (18.1%) | ≤0.001 |
| GDM c | 12 (7.5%) | 2 (1.3%) | 0.006 | |
| Hypertension | 5 (3.1%) | 0 (0.0%) | 0.024 | |
| Vaginal bleeding | 2 (1.3%) | 11 (6.9%) | 0.011 | |
| Previous pregnancy disorders, n (%) | Threatened miscarriage | 0/123 (0.0%) | 19/128 (14.8%) | ≤0.001 |
| PTL d | 0/123 (0.0%) | 7/125 (5.6%) | 0.008 | |
| APTT (s) e | 22–35 weeks of pregnancy | 27.4 (24.0–32.6) | 27.85 (22.9–36.7) | 0.345 |
| 37–41 weeks of pregnancy | 28.23 ± 2.24 | 27.78 ± 2.20 | 0.089 | |
| Platelet parameters | 22–35 weeks of pregnancy: | |||
| No. [×109/L] f | 240 (164–324) | 220 (125–387) | 0.013 | |
| PDW (fL) g | 12.5 (8.8–16.5) | 12.55 (9.3–20.3) | 0.337 | |
| MPV (fL) h | 10.7 (8.8–12.1) | 10.65 (9.1–14.2) | 0.453 | |
| PCT (%) i | 0.25 (0.16–0.35) | 0.23 (0.14–0.39) | 0.022 | |
| 37–41 weeks of pregnancy: | ||||
| No. [×109/L] | 213 (151–398) | 215 (144–326) | 0.616 | |
| PDW (fL) | 13.7 (9.0–23.7) | 14.1 (9.7–19.3) | 0.070 | |
| MPV (fL) | 11.18 ± 0.96 | 11.38 ± 0.98 | 0.076 | |
| PCT (%) | 0.24 (0.16–0.40) | 0.24 (0.16–0.34) | 0.978 | |
| Delivery | Weeks of pregnancy | 40 (37–41) | 39 (33–41) | 0.004 |
| Vaginal, n (%) | 73 (45.6%) | 33 (47.8%) | 0.759 | |
| C-section j, n (%) | 87 (54.4%) | 36 (52.2%) | ||
| Fetal sex, n (%) | Female | 81 (50.6%) | 25 (36.2%) | 0.045 |
| Male | 79 (49.4%) | 44 (63.8%) | ||
| Newborn data | Weight (percentiles) | 74.5 (10–100) | 66 (5–100) | 0.068 |
| Apgar in 1 min | 10 (7–10) | 10 (6–10) | 0.471 | |
| Apgar in 5 min | 10 (7–10) | 10 (7–10) | 0.854 |
| Gene | SNP a | MAF b | Primer Sequences (5′-3′) | Restriction Enzyme | Genotypes [bp c] | Agarose Gel [%] |
|---|---|---|---|---|---|---|
| ANGPT2 | rs3020221 | 38.5 | F: CATTAGAATAGCCTTCAC | Eco57I | CC: 193, 142 | 2.5 |
| R: GAGTGTTTACTGACTAAAGG | CT: 335, 193, 142 | |||||
| TT: 335 | ||||||
| CSF2 | rs25882 | 20.7 | F: AAACTTCCTGTGCAACCGA | Alw26I | TT: 110, 46 | 3.4 |
| R: TTTCATGAGAGAGCAGCTCCC | TC: 110, 88, 46, 22 | |||||
| CC: 88, 46, 22 | ||||||
| FLT1 | rs722503 | 25.2 | F: TCCGCCTGCATTTTGAACAACTAAGTAG | AvaII | CC: 199, 169 | 2.5 |
| R: GGTCTCCTTGGTATTCAAGCACACGTAA | CT: 368, 199, 169 | |||||
| TT: 368 | ||||||
| TLR2 | rs3804099 | 44.1 | F: TTTATCGTCTTCCTGGTTC | MaeII | TT: 361 | 2.5 |
| R: CAAATCAGTATCTCGCAGTT | TC: 361, 258, 103 | |||||
| CC: 258, 103 | ||||||
| TLR6 | rs5743810 | 41.2 | F: CTAGTTTATTCGCTATCCAAG | AvaII | AA: 309 | 2.5 |
| R: TTGTCAATGCTTTCAATGTCG | AG: 309, 183, 126 | |||||
| GG: 183, 126 | ||||||
| TLR9 | rs187084 | 40.6 | F: CCTGCCTGCCATGATACCAC | AflII | AA: 242, 79 | 2.5 |
| R: TGCTAGCACACCGGATCATT | AG: 321, 242, 79 | |||||
| GG: 321 |
| Polymorphism | Categorical Covariate | Genetic Model | Genotype | Genotype Prevalence, n a (%) | OR b (95 % CI c) | p-Value d | AIC e | ||
|---|---|---|---|---|---|---|---|---|---|
| Controls | Cases | ||||||||
| ANGPT2 | Parameters determined from 22 to 35 weeks of current pregnancy | APTT f | Recessive | GG-GA | 24 (75.0%) | 137 (89.0%) | 1.00 | 0.050 | 172.7 |
| rs3020221 | AA | 8 (25.0%) | 17 (11.0%) | 0.37 (0.14–0.96) | |||||
| PLT g | Recessive | GG-GA | 24 (75.0%) | 143 (89.4%) | 1.00 | 0.042 | 169.7 | ||
| AA | 8 (25.0%) | 17 (10.6%) | 0.35 (0.13–0.93) | ||||||
| PDW h | Recessive | GG-GA | 24 (75.0%) | 141 (89.2%) | 1.00 | 0.042 | 173.7 | ||
| AA | 8 (25.0%) | 17 (10.8%) | 0.36 (0.14–0.92) | ||||||
| MPV i | Recessive | GG-GA | 24 (75.0%) | 141 (89.2%) | 1.00 | 0.037 | 211.9 | ||
| AA | 8 (25.0%) | 17 (10.8%) | 0.25 (0.07–0.92) | ||||||
| PCT j | Recessive | GG-GA | 24 (75.0%) | 141 (89.2%) | 1.00 | 0.050 | 170.6 | ||
| AA | 8 (25.0%) | 17 (10.8%) | 0.37 (0.14–0.96) | ||||||
| PLT + PDW + PCT | Recessive | GG-GA | 24 (75.0%) | 141 (89.2%) | 1.00 | 0.044 | 173 | ||
| AA | 8 (25.0%) | 17 (10.8%) | 0.35 (0.13–0.93) | ||||||
| TLR2 | Current pregnancy disorders | Anemia | Over-dominant | TT-CC | 72 (45.0%) | 88 (55.0%) | 1.00 | 0.046 | 429.5 |
| rs3804099 | TC | 88 (55.0%) | 72 (45.0%) | 0.63 (0.40–0.99) | |||||
| Vaginal bleeding | Over-dominant | TT-CC | 72 (45.0%) | 88 (55.0%) | 1.00 | 0.044 | 438.4 | ||
| TC | 88 (55.0%) | 72 (45.0%) | 0.63 (0.40–0.99) | ||||||
| Previous pregnancy disorders | Threatened miscarriage | Over-dominant | TT-CC | 57 (46.3%) | 74 (57.8%) | 1.00 | 0.043 | 322.7 | |
| TC | 66 (53.7%) | 54 (42.2%) | 0.58 (0.35–0.98) | ||||||
| PTL k | Over-dominant | TT-CC | 57 (46.3%) | 74 (59.2%) | 1.00 | 0.022 | 334.8 | ||
| TC | 66 (53.7%) | 51 (40.8%) | 0.55 (0.33–0.92) | ||||||
| TLR9 | Current pregnancy disorders | Vaginal bleeding + GDM l | Dominant | TT | 37 (23.1%) | 50 (31.2%) | 1.00 | 0.040 | 431.1 |
| rs187084 | TC-CC | 123 (76.9%) | 110 (68.8%) | 0.59 (0.35–0.98) | |||||
| Genetic Model | Genotype | Genotype Prevalence, n a (%) | OR b (95 % CI c) | p-Value d | AIC e | |
|---|---|---|---|---|---|---|
| Controls | Cases | |||||
| Codominant | TT | 37 (30.1%) | 46 (37.1%) | 1.00 | 0.048 | 313.8 |
| TC | 66 (53.7%) | 51 (41.1%) | 0.53 (0.29–0.97) | |||
| CC | 20 (16.3%) | 27 (21.8%) | 1.10 (0.52–2.33) | |||
| Dominant | TT | 37 (30.1%) | 46 (37.1%) | 1.00 | 0.140 | 315.8 |
| TC-CC | 86 (69.9%) | 78 (62.9%) | 0.66 (0.37–1.16) | |||
| Recessive | TT-TC | 103 (83.7%) | 97 (78.2%) | 1.00 | 0.180 | 316.1 |
| CC | 20 (16.3%) | 27 (21.8%) | 1.58 (0.81–3.09) | |||
| Over-dominant | TT-CC | 57 (46.3%) | 73 (58.9%) | 1.00 | 0.014 | 311.9 |
| TC | 66 (53.7%) | 51 (41.1%) | 0.51 (0.30–0.88) | |||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wujcicka, W.I.; Kacerovsky, M.; Krygier, A.; Krekora, M.; Kaczmarek, P.; Grzesiak, M. Association of Single Nucleotide Polymorphisms from Angiogenesis-Related Genes, ANGPT2, TLR2 and TLR9, with Spontaneous Preterm Labor. Curr. Issues Mol. Biol. 2022, 44, 2939-2955. https://doi.org/10.3390/cimb44070203
Wujcicka WI, Kacerovsky M, Krygier A, Krekora M, Kaczmarek P, Grzesiak M. Association of Single Nucleotide Polymorphisms from Angiogenesis-Related Genes, ANGPT2, TLR2 and TLR9, with Spontaneous Preterm Labor. Current Issues in Molecular Biology. 2022; 44(7):2939-2955. https://doi.org/10.3390/cimb44070203
Chicago/Turabian StyleWujcicka, Wioletta Izabela, Marian Kacerovsky, Adrian Krygier, Michał Krekora, Piotr Kaczmarek, and Mariusz Grzesiak. 2022. "Association of Single Nucleotide Polymorphisms from Angiogenesis-Related Genes, ANGPT2, TLR2 and TLR9, with Spontaneous Preterm Labor" Current Issues in Molecular Biology 44, no. 7: 2939-2955. https://doi.org/10.3390/cimb44070203
APA StyleWujcicka, W. I., Kacerovsky, M., Krygier, A., Krekora, M., Kaczmarek, P., & Grzesiak, M. (2022). Association of Single Nucleotide Polymorphisms from Angiogenesis-Related Genes, ANGPT2, TLR2 and TLR9, with Spontaneous Preterm Labor. Current Issues in Molecular Biology, 44(7), 2939-2955. https://doi.org/10.3390/cimb44070203

