Next Article in Journal
Phytotherapeutic Intervention in Monosodium Glutamate-Induced Uterine Dysfunction: Efficacy of Lepidium sativum, Prunus armeniaca, Stachys palustris, and Solenostemma argel
Next Article in Special Issue
K2P Channels as Key Regulators of Cardiovascular and Pulmonary Vascular Function
Previous Article in Journal
Pleiotropic Bioactivity of Caterpillar Fungus, Orange Cordyceps, and Cordycepin: Insight from Integrated Network Pharmacology and Food and Drug Regulatory Framework
Previous Article in Special Issue
ACE Inhibitors Boost Mobility and Muscle Strength by Reducing Intestinal Permeability in Older Adults with Alzheimer’s Disease
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pharmaceuticals
Volume 19
Issue 3
10.3390/ph19030520
pharmaceuticals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Danggui Buxue Decoction and Its Active Constituents Inhibit Drug-Induced Uterine Contractions via L-Type Calcium Channels and the IP3/Ca2+ Pathway

by
Mingming Liu
1,2,†,
Taiping He
1,2,†,
Wenqiao An
1,2,
Pengmei Guo
2,
Tang Zhou
2,
Yufei Chen
3,
Xiaojuan Tian
1,2,
Mingxu Wu
1,2,
Ting Zhang
2,* and
Sanyin Zhang
1,2,*
1
School of Basic Medicine, Chengdu University of Traditional Chinese Medicine, Chengdu 611137, China
2
Innovative Institute of Chinese Medicine and Pharmacy, Chengdu University of Traditional Chinese Medicine, Chengdu 611137, China
3
School of Medical Technology, Chengdu University of Traditional Chinese Medicine, Chengdu 611137, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Pharmaceuticals 2026, 19(3), 520; https://doi.org/10.3390/ph19030520
Submission received: 25 February 2026 / Revised: 18 March 2026 / Accepted: 20 March 2026 / Published: 23 March 2026
(This article belongs to the Special Issue Advances in Smooth Muscle Pharmacology)
Browse Figures
Versions Notes

Abstract

Background/Objectives: Primary dysmenorrhea is a common gynecological disorder characterized by painful uterine contractions. Danggui Buxue Decoction (DBD) is used to treat menstrual irregularities, but its mechanism in primary dysmenorrhea remains unclear. This study investigated the efficacy of DBD against dysmenorrhea and its calcium signaling-related mechanism. Methods: DBD components were analyzed by UPLC–Orbitrap MS. Isolated uterine muscle strips precontracted with oxytocin (OT, 50 ng/mL) or KCl (60 mM) were used to assess the effects of DBD and its active compounds (Quercetin, Formononetin, Ononin, Ferulic acid, Senkyunolide I, Calycosin, Ligustilide, Calycosin-7-O-β-D-glucoside). Ca2+-dependent experiments, intracellular calcium release assays, and inhibitor treatments (Nifedipine, 2-APB) were performed to evaluate the involvement of L-type calcium channels and the IP3R pathway. A primary dysmenorrhea model induced by estradiol benzoate and oxytocin was used to assess the analgesic effects, histopathology, inflammatory factors, and IP3/Ca2+-related proteins and genes following DBD and Quercetin treatment. Results: A total of 161 compounds were identified in DBD. DBD and its eight active constituents relaxed OT (50 ng/mL) or KCl (60 mM)-induced uterine contractions, with Quercetin, Calycosin, and Ligustilide showing particularly prominent relaxant activity. These three compounds suppressed extracellular calcium influx and intracellular calcium release through the blockade of L-type calcium channels and IP3R. In vivo, DBD and Quercetin alleviated pain, reduced inflammation, and decreased uterine Ca2+ and IP3 levels in dysmenorrhea mice. Conclusions: DBD and its active component Quercetin promote uterine relaxation by lowering Ca2+ levels, which is achieved through suppression of L-type calcium channels and the IP3/Ca2+ pathway. This contributes to their therapeutic action against primary dysmenorrhea.

Graphical Abstract

1. Introduction

The pathogenesis of primary dysmenorrhea is closely associated with abnormal uterine contractions [1]. Excessive contraction of uterine muscle results in transient uterine ischemia and hypoxia, thereby inducing pain symptoms [2]. Primary dysmenorrhea is a common gynecological condition involving recurrent, cramping lower abdominal pain during menstruation, despite the absence of detectable pelvic pathology [3]. Systemic symptoms such as nausea, vomiting, cold extremities, and syncope may accompany severe dysmenorrhea, with consequent impairment of patients’ quality of life and work capacity [4,5]. The global prevalence of primary dysmenorrhea was found to be 73% (95% confidence interval [CI]: 68–78%), with higher rates observed in adults (73.3%) and university students (78.4%) [6]. Severe pain affects up to 29% of affected girls with dysmenorrhea [7]. The proportion of adolescents missing school due to dysmenorrhea ranges from 7.7% to 57.8%, and 21.5% of women report disruption to their social activities [8]. Despite the significant impact of menstrual pain on women’s lives, the survey found that 93.2% of sufferers did not seek medical advice, and 82% opted for self-medication [9].
Some evidence indicates that Calcium signaling plays a critical role in regulating uterine contractility [10]. In smooth muscle cells, intracellular Ca2+ is mainly derived from two sources: release from the sarcoplasmic reticulum and influx through L-type calcium channels [11,12]. Oxytocin and PGF2α activate GPCRs, activating PLC to convert PIP2 to IP3 and DAG. IP3 binds IP3Rs on the sarcoplasmic reticulum, releasing Ca2+ from intracellular stores [13]. An increase in intracellular calcium ions enables calcium ions to bind with calmodulin (CaM) and activate myosin light chain kinase (MLCK) [14,15]. MLCK phosphorylates the myosin light chain regulator (MLC20), altering the conformation of the myosin head and facilitating the formation of cross-bridges with actin to generate tension that induces cellular contraction [16].
For the treatment of primary dysmenorrhea, non-steroidal anti-inflammatory drugs (NSAIDs), including aspirin and ibuprofen, represent a first-line therapeutic option. Although NSAIDs can alleviate pain in primary dysmenorrhea patients, they also cause adverse reactions affecting the gastrointestinal and nervous systems, such as nausea, vomiting, indigestion, headaches, and drowsiness [17]. Furthermore, about 18% of primary dysmenorrhea patients experience little to no pain relief from NSAIDs [18]. Traditional Chinese medicinal formulas including Danggui Sini Decoction [19], Wenjing decoction [20], and Ge-gen decoction [21] have shown appreciable efficacy in treating primary dysmenorrhea and relieving pain.
Danggui Buxue Decoction (DBD), a traditional Chinese herbal formula, contains Astragalus membranaceus (AR) and Angelica sinensis (AES) in a 5:1 ratio [22]. First recorded in Li Dongyuan’s Discerning Confusions in Internal and External Injuries, this formula serves as a classic example of a prescription that tonifies qi and promotes blood generation. DBD is commonly used to address symptoms such as fatigue-induced thirst, physical weakness and exhaustion, fever during menstruation or postpartum, and anemia [23]. DBD can enhance energy metabolism, improve hematopoietic function, and exert anti-inflammatory and antioxidant effects [24,25,26,27,28]. Moreover, it inhibits vascular smooth muscle contraction [29,30]. AES alone has been shown to be effective in treating menstrual irregularities and amenorrhea, and providing pain relief [31,32]. These findings collectively suggest DBD’s therapeutic potential for primary dysmenorrhea; however, reports on its specific application in primary dysmenorrhea treatment remain limited.
In this study, UPLC–Orbitrap MS was employed to analyze the chemical constituents of DBD. The uterine smooth muscle relaxant activity of these constituents was evaluated, and the preliminary mechanism of the most effective components was investigated using in vivo and in vitro models. Consequently, this study investigated the mechanism underlying the uterine-relaxant effect of DBD and its active component, and evaluated its efficacy in a mouse model of primary dysmenorrhea.

2. Results

2.1. UPLC–Orbitrap MS Analysis of DBD and Identification of the Main Components

In this study, a sensitive, reliable, and high-throughput UPLC–Orbitrap MS method was established for rapid identification of chemical constituents in DBD. Analysis of DBD extract under both positive and negative ion modes yielded the total ion chromatogram (TIC) shown in Figure 1. Based on mass spectrometry fragmentation patterns and literature data, 161 compounds were tentatively identified, comprising primarily flavonoids, phthalides, and polyphenolic compounds. Specifically, these included 52 flavonoids, 23 phthalides, 21 polyphenols, 9 triterpenoids, and 56 compounds from other structural classes (Table 1).

2.2. DBD, AR and AES Effectively Relaxed OT (50 ng/mL) or KCl (60 mM)-Induced Uterine Contractions

To investigate whether DBD could inhibit uterine contractions, we established an isolated uterine muscle strip contraction model induced by OT (50 ng/mL) or KCl (60 mM) (Figure 2A). DBD, AR, and AES each exhibited concentration-dependent relaxation of uterine muscle strips precontracted by OT (50 ng/mL) or KCl (60 mM), compared with the control group (Figure 2B,C). The EC50 values of DBD, AR, and AES for inhibiting OT (50 ng/mL)-induced uterine contractions were 13.24, 84.8, and 5.788 mg/mL, respectively (Figure 2D). Similarly, their EC50 values against KCl (60 mM)-induced contractions were 48.03, 39.45, and 4.723 mg/mL, respectively (Figure 2E). This verifies that DBD, AES and AR have the potential to inhibit uterine contraction.

2.3. The Eight Active Constituents of DBD-Relaxed OT (50 ng/mL) or KCl (60 mM)-Induced Uterine Contraction

As shown in Figure 3A, all eight components relaxed the uterine contractions induced by OT (50 ng/mL) at concentrations of 5, 10, 20, 40, 80, and 160 μM. In contrast, when uterine contractions were induced by KCl (60 mM), all components except Ononin (which showed relaxation only at 80 and 160 μM) produced relaxing effects (Figure 3B). The uterine smooth muscle relaxant activity varied among the eight compounds, with Quercetin, Calycosin, and Ligustilide displaying the highest potency. Their EC50 values were 35.49, 59.82, and 47.23 μM for OT (50 ng/mL)-induced contractions (Figure 3C, Table 2); and 8.911, 12.10, and 11.15 μM for KCl (60 mM)-induced contractions (Figure 3D, Table 2). These results suggest that the relaxant effect of DBD on female mice uterine contractions may be closely related to three active components.

2.4. DBD, Quercetin, Calycosin and Ligustilide Reduce Ca2+ Levels

Calcium signaling plays a critical role in regulating uterine contractility. An exogenous Ca2+ supplementation experiment using CaCl2 was conducted to determine whether Ca2+ participate in the uterine-relaxing effects of DBD, Quercetin, Calycosin and Ligustilide. The addition of external calcium (0.5–10 mM) restored spontaneous contractions in uterine muscle strips (Figure 4A). However, incubation with DBD, Quercetin, Calycosin or Ligustilide suppressed these restored contractions in a concentration-dependent manner (Figure 4B,C). These findings suggest that the uterine-relaxant effects of DBD, Quercetin, Calycosin and Ligustilide are Ca2+ related.
To investigate the role of Ca2+, cell membranes were depolarized using KCl (60 mM) to permit extracellular calcium influx through L-type calcium channels. Pre-incubation with Nifedipine attenuated the uterine-relaxant effects of DBD, Quercetin, Calycosin and Ligustilide (Figure 4D–G). Among these, Ligustilide was the most strongly inhibited by Nifedipine. These findings demonstrate that DBD, Quercetin, Calycosin and Ligustilide induce uterine relaxation primarily by inhibiting L-type calcium channels.
In the intracellular calcium release experiment, DBD, Quercetin, Calycosin and Ligustilide suppressed OT (50 ng/mL)-elicited contractions in a concentration-dependent fashion (Figure 5A,B). Among the compounds tested, Quercetin exhibited the strongest uterine-relaxant effect. To explore the mechanisms, the IP3R antagonist 2-APB was used to preliminarily validate whether DBD, Quercetin, Calycosin and Ligustilide inhibit intracellular calcium release via this pathway. Pre-incubation with 2-APB attenuated the uterine-relaxant effects of DBD, Quercetin, Calycosin and Ligustilide (Figure 5C–F). Among these, Quercetin exhibited the strongest uterine-relaxant effect, while Calycosin and Ligustilide demonstrated significant uterine-relaxant activity at concentrations ranging from 80 to 160 μM. These results suggest that DBD, Quercetin, Calycosin and Ligustilide exert uterine relaxation primarily via IP3R inhibition, a key event in suppressing the IP3/Ca2+ path.

2.5. DBD Alleviates Pain and Uterine Inflammation in Dysmenorrhea Mice

To assess the therapeutic effects of DBD and Quercetin against dysmenorrhea, an OT-induced dysmenorrhea model was employed in female mice (Figure 6A). Successful establishment of the dysmenorrhea model was confirmed by significant changes in uterine organ index, writhing latency, and writhing times in model female mice compared with the control group (Figures S2 and S3). After DBD pretreatment, DBD administration reduced the uterine organ index, prolonged the writhing latency, and decreased the writhing frequency (maximum inhibition rates of 70.8%, 79.2%, 87.5%, and 83.3%) (Figure 6B–D). In female mice uterine tissue, mRNA levels of Tnfa and Il6 were notably increased in the model group relative to controls. Treatment with either DBD or TJB significantly reduced the expression of these pro-inflammatory genes (Figure 6E,F). Compared with the control group, the model group exhibited structural disorganization, increased glandular secretion, and marked inflammatory infiltration with edema; conversely, DBD treatment reduced inflammatory cell influx and alleviated tissue edema. (Figure 6G). These results demonstrate that DBD alleviates pain symptoms, inflammation, and pathological changes in dysmenorrhea female mice.

2.6. DBD and Quercetin Alleviate Dysmenorrhea by Reducing Ca2+ Levels

To determine whether Ca2+ signaling mediates the anti-dysmenorrhea effect of DBD, we assessed intracellular Ca2+ concentrations in uterine tissue. Dysmenorrhea female mice exhibited elevated Ca2+ levels compared with those from control mice. Conversely, these increased levels were significantly reduced by treatment with either DBD or TJB (Figure 7A). PLC and IP3 levels were elevated, whereas both DBD and TJB treatments effectively lowered their concentrations in uterine tissue (Figure 7B,C). RT-qPCR was performed to measure the expression of Pgf2a and its receptor Ptgfr. DBD or TJB treatment suppressed the upregulation of Pgf2a and Ptgfr mRNA in model female mice (Figure 7D,E).
Molecular docking analysis revealed favorable binding affinities for all eight active components with PTGFR (binding energies < −5.0 kcal/mol), particularly Quercetin (binding energies −8.4 kcal/mol), which exhibited the lowest binding energy (Figure S4, Table S1). Experimental results of Quercetin treatment for dysmenorrhea indicate that, compared with the model group, Quercetin reduced writhing times, prolonged the writhing latency, and decreased Ca2+ and IP3 levels (Figure 7F,G). The findings presented above suggest that DBD and Quercetin may alleviate dysmenorrhea by lowering calcium ion levels through the IP3/Ca2+ pathway.

3. Discussion

In the present study, we evaluated the uterine-relaxant effects of DBD and its active components, as well as their efficacy in treating primary dysmenorrhea, by establishing an in vitro uterine contraction model and an in vivo mouse model of dysmenorrhea. Research has revealed that these effects are achieved by inhibiting L-type calcium channels and the IP3/Ca2+ pathway, thereby reducing intracellular calcium ion concentrations within the uterus and consequently exerting a uterine-relaxant effect. These findings provide experimental evidence for the potential use of DBD and its active component, Quercetin, in treating primary dysmenorrhea, demonstrating that their therapeutic mechanism involves the inhibition of calcium pathways to relax uterine smooth muscle.
Currently, DBD is employed in the treatment of female menopausal syndrome due to its estrogenic effects without inducing estrogenic side effects [33]. Combination therapy with DBD and doxorubicin effectively reduces tumor cell proliferation in triple-negative breast cancer [34]. Clinical studies have demonstrated that proprietary Chinese medicines containing AES and AR, such as Wuji Baifeng Pills and Ai Fu Nuan Gong Pills [35,36,37], effectively alleviate pain symptoms in patients with dysmenorrhea without causing serious adverse reactions. According to traditional Chinese medicine theory, therapeutic principles such as tonifying qi and blood, and promoting blood circulation to resolve stasis, play important roles in the treatment of primary dysmenorrhea [38]. DBD is a classic formula for tonifying qi and generating blood, frequently used to alleviate symptoms such as fever and anemia in women during menstruation and the postpartum period [23]. Compared to other formulas for dysmenorrhea, such as Danggui Sini Decoction and Wenjing decoction, DBD offers several advantages. Its simple two-herb composition is associated with potent efficacy, absence of known toxicity, and flexibility for clinical modification. A notable advantage of DBD lies in its organ-selective estrogen-like effects, which occur without the reproductive organ proliferation typically associated with estrogen stimulation [39].
Using UPLC–Orbitrap MS, 161 compounds were identified in DBD, many of which exhibited significant biological activities, including anti-inflammatory, analgesic, and uterine smooth muscle relaxant effects. A study reported that Senkyunolide I, Senkyunolide H, Ligustilide and Z-butylidene phthalide can relax uterine smooth muscle [40]. Quercetin can relax isolated porcine uteri [41]. The highest concentrations of DBD were found in cardiac and uterine tissues, with six compounds, including Formononetin, Ononin, Senkyunolide I, Calycosin, Ligustilide, and Calycosin-7-O-β-D-glucoside, detected in the uterine tissue [42]. Pharmacokinetic investigations revealed that following DBD administration to rats, compounds including calycosin-7-O-β-D-glucoside, Ononin, and Ferulic acid were detectable in plasma [43,44]. Based on the above rationale, the following eight compounds were selected for further investigation: Quercetin, Formononetin, Ononin, Ferulic acid, Senkyunolide I, Calycosin, Ligustilide, and Calycosin-7-O-β-D-glucoside. In experiments involving OT (50 ng/mL) or KCl (60 mM)-induced contractions in isolated uterine tissue, DBD, AES, AR, and the eight compounds were observed to induce relaxation of uterine smooth muscle, albeit to varying degrees. Among these, Quercetin, Calycosin, and Ligustilide tended to exhibit more pronounced effects.
Changes in intracellular Ca2+ concentration in uterine smooth muscle are essential for initiating, sustaining, and modulating the intensity of contractions [45]. Previous studies have demonstrated that Quercetin and Ligustilide induce relaxation of isolated uterine muscle strips through a calcium-mediated mechanism [46,47]. The Ca2+-dependent experimental results showed that uterine muscle strips pre-incubated with DBD, Quercetin, Calycosin or Ligustilide did not effectively recover contractile activity, even after the addition of exogenous CaCl2. Therefore, calcium is involved in the uterine-relaxant effects of DBD and its active constituents. L-type calcium channels are considered the primary ion channels mediating Ca2+ influx into smooth muscle cells [48]. Intracellular IP3 binds to IP3R on the sarcoplasmic reticulum, leading to the release of calcium ions [49]. After pretreatment with the L-type calcium channel blocker Nifedipine or the IP3R inhibitor 2-APB, the uterine-relaxant effects of DBD, Quercetin, Calycosin and Ligustilide were attenuated. These findings indicate that DBD, Quercetin, Calycosin and Ligustilide lower calcium ion levels, probably by suppressing L-type calcium channels and IP3R, leading to uterine relaxation.
Primary dysmenorrhea is also recognized as an inflammatory condition, in which menstrual disturbances trigger the production of leukocytes and inflammatory mediators [50]. Leukocyte infiltration promotes the release of pro-inflammatory cytokines, including TNF-α and IL-6, leading to endometrial edema and hemorrhage [51]. This study showed that DBD effectively reduced the writhing times and prolonged the writhing latency in primary dysmenorrhea female mice. Concurrently, DBD downregulated mRNA expression of inflammation-related genes, including Tnfa and Il6. Histopathological analysis further confirmed that DBD alleviated primary dysmenorrhea-induced inflammation and tissue edema.
Primary dysmenorrhea leads to increased production of PGF2α, which also plays a significant role in inflammatory responses [52]. Moreover, PGF2α may sensitize peripheral nerve endings, lowering the pain threshold [53]. Clinical studies have shown elevated PGF2α levels in patients with primary dysmenorrhea compared to healthy individuals [54,55]. The present study confirms that an OT-induced primary dysmenorrhea model increases PGF2α levels. In contrast, DBD significantly suppressed primary dysmenorrhea-induced PGF2α elevation. PGF2α is the endogenous ligand of PTGFR, and their binding triggers uterine smooth muscle contraction [56]. PTGFR, a member of the GPCR family, is highly expressed in smooth muscle and the uterine myometrium [57]. Upon GPCR activation, calcium ions are released from the sarcoplasmic reticulum via the IP3/Ca2+ pathway [58,59]. Experimental results demonstrate that DBD not only reduces levels of PGF2α and PTGFR but also decreases concentrations of Ca2+ and IP3.
Quercetin, a representative flavonoid, exhibits significant pharmacological effects in the treatment of various gynecological conditions, such as polycystic ovary syndrome, premature ovarian failure, endometriosis, endometrial cancer, and ovarian cancer [60]. Preliminary experiments on isolated uterine tissue indicate that Quercetin exhibits a more potent uterine-relaxant effect compared to other compounds. Among the eight active components, Quercetin exhibited the most favorable binding affinity with PTGFR in molecular docking analysis, with the lowest binding energy. These findings suggest that Quercetin may be the key constituent in DBD responsible for uterine smooth muscle relaxation and the treatment of primary dysmenorrhea. The therapeutic potential of Quercetin was further evaluated in a mouse model of primary dysmenorrhea. Treatment with Quercetin not only alleviated pain symptoms but also reduced Ca2+ and IP3 concentrations. These findings support Quercetin as a key active constituent in DBD for the treatment of primary dysmenorrhea.
Collectively, our findings offer theoretical support for understanding how DBD and its active constituents relax the uterus and treat primary dysmenorrhea. However, several limitations remain. Firstly, experiments were conducted solely at the in vitro tissue and animal levels. To further validate the IP3/Ca2+ pathway mechanism, we will establish PTGFR-overexpressing cell lines to detect alterations in downstream calcium signaling. Although this study demonstrated that eight compounds from DBD possess uterine-relaxant effects, it remains unclear whether these effects are attributable to the dominant action of a specific molecular family or to synergistic interactions among multiple molecules. In subsequent studies, we will employ network pharmacology to predict potential target molecules and integrate multi-omics approaches, such as transcriptomics and metabolomics, to elucidate the synergistic regulatory mechanisms involving multiple targets and pathways at a systemic level. This will offer a more comprehensive theoretical foundation for the application of DBD in the treatment of primary dysmenorrhea.

4. Materials and Methods

4.1. Chemicals and Reagents

Quercetin, Formononetin, Ononin, Ferulic acid, Senkyunolide I, Calycosin, Ligustilide and Calycosin-7-O-β-D-glucoside were purchased from Chengdu Pusi Biotechnology Co., Ltd. (Chengdu, China). AR and AES were provided by the Affiliated Hospital of Chengdu University of Traditional Chinese Medicine (Chengdu, China), and their quality was verified according to the Chinese Pharmacopoeia (2025 edition). Nifedipine was purchased from Shanghai McLean Biochemical Technology Co., Ltd. (Shanghai, China). Oxytocin was purchased from Shenggong Biotechnology (Shanghai) Co., Ltd. (Shanghai, China). 2-APB was purchased from Medchemexpress LLC. (Shanghai, China). Estradiol Benzoate Injection was purchased from Shanghai Quanyu Biotech Animal Pharmaceutical Co., Ltd. (Shanghai, China). The remaining reagents were analytical grade from domestic suppliers.

4.2. Preparation of DBD

AES (60 g) and AR (300 g) were soaked in 8 volumes of water (w/v) for 30 min and then decocted for 90 min. The decoction was filtered through muslin. The residue was mixed with 6 volumes of water and decocted for another 90 min. The combined filtrates were concentrated on a rotary evaporator at 60 °C. The concentrate was then lyophilized to obtain 136 g of DBD lyophilized powder, yielding 37.8% (1 g of DBD lyophilized powder corresponds to 2.65 g of crude DBD herbal material). The powder was stored at −20 °C until use. AES and AR were prepared separately following the same procedure.

4.3. Animals

Female C57BL/6 mice, aged 6–8 weeks, were purchased from GemPharmatech Co., Ltd. (Nanjing, China) (SCXK (chuan) 2020-0034). Drinking water and standard chow were provided without restriction. The female mice were accommodated in plastic cages under standardized laboratory conditions: humidity 60–80%, temperature 22 ± 2 °C, and a 12 h light/dark cycle. This study was reviewed and approved by the Animal Ethics Committee of Chengdu University of Traditional Chinese Medicine (Approval No. 2024035).

4.4. Qualitive Analysis of Constituents in DBD Extract by UPLC–Orbitrap MS Technology

The DBD was diluted to 0.5 g/mL with methanol, then centrifuged at 12,000 rpm for 10 min. It was then filtered through a 0.22 μm syringe filter. A UHPLC system (Hypersil GOLD column, 100 × 2.1 mm, 1.9 µm; Thermo Scientific, Waltham, MA, USA) was used for compound separation. The mobile phase consisted of water with 0.1% formic acid (A) and acetonitrile (B), flowing at 0.3 mL/min. The column temperature was maintained at 40 °C, the injection volume was 1 µL, and the autosampler temperature was set to 8 °C. The following gradient was applied: 0–0.5 min, 2% B; 0.5–12 min, 2% to 50% B; 12–14 min, 50% to 98% B; 14–16 min, 98% B; 16–16.1 min, 98% to 2% B; 16.1–18 min, 2% B. Data were acquired on an Orbitrap Exploris 120 high-resolution mass spectrometer (Thermo Scientific, USA) using a heated electrospray ionization (H-ESI) source. Prior to analysis, mass calibration was performed using standard solutions delivered by a syringe pump (SKE10, Chemyx, Houston, TX, USA) equipped with a microsyringe (1750RNR 500 µL SYR, Hamilton, Reno, NV, USA), ensuring that mass errors for characteristic ions were below 5 ppm. MS parameters were optimized as follows: spray voltage, +3.2 kV (positive) and −3.0 kV (negative); vaporizer, 350 °C; ion transfer tube, 320 °C; sheath gas flow rate, 40 Arb; auxiliary gas flow rate, 10 Arb. Full MS scans were acquired at a resolution of 60,000 over an m/z range of 70–1050. The RF lens voltage was set to 70%, and the automatic gain control (AGC) target was set to standard mode. Data-dependent MS/MS acquisition was performed at a resolution of 15,000 with stepped HCD collision energies: 20, 40, and 60%. Data processing was performed using Xcalibur software (version 4.6 Thermo Scientific, USA) and compounds were identified by matching the accurate mass-to-charge ratios against local and online chemical databases.

4.5. Preparation of Uterine Muscle Strips

Female C57BL/6 mice were administered estradiol benzoate (10 mg/kg) via intraperitoneal injection for three consecutive days [61,62]. The animals were euthanized by decapitation. Uterine tissues were promptly excised and placed in pre-chilled Krebs-Henseleit (K-H) solution (composition in mM: NaCl 118, KCl 4.7, CaCl2 2.5, KH2PO4 1.2, MgCl2·6H2O 1.2, NaHCO3 25, glucose·H2O 11, HEPES 5), which was continuously aerated with carbogen (95% O2/5% CO2). After carefully removing the surrounding adipose and connective tissues, uterine muscle strips (approximately 0.5 cm in length) were isolated and suspended in bath containing K-H solution maintained at approximately 37 °C and continuously aerated with carbogen (95% O2/5% CO2). The uterine muscle strips were initially stretched to a tension of 0.5 g and then allowed to equilibrate for at least 30 min until stable spontaneous contractions developed [63] (Figure S1A). Following a 30 min equilibration period, uterine muscle strips were first contracted with KCl (60 mM). The uterine muscle strips were then washed three times with K-H solution at 10 min intervals, and a second contraction was induced with KCl (60 mM). Uterine muscle strips exhibiting less than 10% difference in amplitude between the two KCl (60 mM)-induced contractions were used for subsequent experiments. At the end of each experiment, the uterine muscle strips were rinsed three times with K-H solution at 10 min intervals. A final challenge with KCl (60 mM) or OT (50 ng/mL) was then applied. Recurrence of contraction confirmed that the strips remained viable, indicating that any observed reduction in contractility was attributable to drug treatment rather than cytotoxicity [64] (Figure S1B,C). Changes in tension were recorded using a PowerLab multifunctional physiological acquisition system.

4.6. Assessment of Drug-Induced Uterine Contractions

The uterine muscle strips were then exposed to either OT (50 ng/mL) or KCl (60 mM) [65] for approximately 15 min to induce a contractile response. Subsequently, increasing concentrations of DBD, its constituent herbs (AES and AR), or active constituents (Quercetin, Formononetin, Ononin, Ferulic acid, Senkyunolide I, Calycosin, Ligustilide, Calycosin-7-O-β-D-glucoside) were cumulatively added to the organ bath. Each concentration was allowed to act for approximately 10 min before the next addition. Changes in uterine muscle strips tension were continuously recorded throughout the experiment.

4.7. Effect of DBD and Its Active Constituents on Ca2+-Dependent Contractions

Following equilibration for over 30 min to achieve stable contractions, uterine muscle strips were exposed to Ca2+-free K-H solution for 10 min. Subsequently, increasing concentrations of DBD, or active constituents (Quercetin, Calycosin, Ligustilide) were cumulatively added to the organ bath. Following a 10 min incubation, contractility was restored by the cumulative addition of CaCl2 solutions at increasing concentrations (0.5–10 mM) [66,67,68].

4.8. The Effect of DBD and Its Active Constituents on Extracellular Calcium Influx

KCl (60 mM) was used to elicit pre-contraction in uterine muscle strips. After the contraction reached a plateau phase, 5 nM Nifedipine (the KCl-induced response was attenuated without significantly affecting contraction amplitude) was introduced [65]. Following approximately 20 min of incubation with the blocker, increasing concentrations of DBD, Quercetin, Calycosin, or Ligustilide were cumulatively added. Changes in uterine muscle strip tension were subsequently recorded.

4.9. The Effect of DBD and Its Active Constituents on Intracellular Calcium Release

After the uterine muscle strip has equilibrated, the bath solution was replaced with KCl (60 mM) solution. This solution was maintained for 15 min to promote calcium ion transport into the sarcoplasmic reticulum. Following this, the tissue was exposed to a Ca2+-free solution containing EDTA (0.3 mM) for 15 min. Subsequent addition of OT (50 ng/mL) induced contractions of the uterine muscle strips. After the contractile response stabilized, increasing concentrations of DBD, Quercetin, Calycosin, or Ligustilide were cumulatively added. Changes in uterine muscle strip tension were subsequently recorded. Additionally, the mechanism of intracellular calcium release was preliminarily investigated using the IP3R antagonist 10 μM 2-APB [69].

4.10. Oxytocin-Induced Writhing Test

We conducted the oxytocin-induced writhing test based on previously reported methods [70,71,72]. Seven experimental groups of female mice (n = 6 each) were established: a control group, a model group, three groups receiving DBD at low (DBD-L, 3.78 g/kg), medium (DBD-M, 7.56 g/kg), or high (DBD-H, 15.12 g/kg) doses, a positive control group (TJB, 3 g/kg) [73], and a Quercetin group (50 mg/kg) [74]. From the first day of the experiment, mice in the DBD groups, TJB group, and Quercetin group received oral administration once daily for 11 consecutive days; mice in the control and model groups were given an equivalent volume of deionized water. Starting from day 8, all groups except the control received estradiol benzoate (1 mg/kg i.p. for 3 days). One hour after the final oral administration on day 11, all groups except the control were injected intraperitoneally with 2 IU OT per female mouse. Writhes were counted for 30 min post-OT injection. A complete writhing response was characterized by abdominal retraction and concavity, extension of the hind limbs, pressing of the lower abdomen against the cage floor, and elevation of the hindquarters [71].

4.11. Biochemical Analysis

Intracellular Ca2+ levels in uterine tissues were assayed using a commercial kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Quantitative analysis of PLC and IP3 was performed using ELISA kits (Wuhan Elabscience Biotechnology Co., Ltd., Wuhan, China), and all assays were performed in compliance with the manufacturer’s recommendations.

4.12. Histological Analysis

Following fixation in 4% paraformaldehyde (>24 h), uterine tissues were dehydrated and embedded in paraffin. Serial sections, cut at a thickness of 3–5 μm, were prepared and stained with hematoxylin and eosin (HE) according to routine protocols. The stained sections were subsequently imaged using a Pannoramic SCAN II scanner for histomorphological analysis.

4.13. Real-Time qPCR

Total RNA was isolated from uterine tissues by homogenization in TRIzol reagent. Following the manufacturer’s guidelines, the PrimeScript™ FAST RT reagent kit (Takara, Kusatsu, Japan) was employed to reverse transcribe the purified RNA into cDNA. A real-time PCR analysis was conducted on a real-time PCR detection system employing TB Green® Premix Ex Taq™ II (Takara, Kusatsu, Japan), in accordance with the manufacturer’s recommended procedures. Gene expression levels were quantified by the 2−ΔΔCt method, with Actb mRNA serving as the endogenous reference. Primer sequences are shown in Table 3.

4.14. Statistical Data

All values are given as mean ± standard error of the mean (SEM). Statistical evaluation was performed with GraphPad Prism (version 8.0). Relaxant responses were expressed as a percentage of the maximal contractile tension induced by KCl (60 mM) or OT (50 ng/mL), which was set as 100%. The half-maximal effective concentration (EC50) was determined by non-linear regression analysis of cumulative concentration–response curves. EC50 units were used (mg/mL for extracts, μM for compounds). Differences between the two groups were analyzed using Student’s t-test, while comparisons among multiple groups were performed by one-way ANOVA followed by Dunnett’s post hoc test for pairwise comparisons. Statistical significance was set at p < 0.05.

5. Conclusions

DBD and its active constituents relax the uterus by inhibiting L-type calcium channels and the IP3/Ca2+ pathway, thereby treating primary dysmenorrhea.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ph19030520/s1, Figure S1. Typical tension recording profiles of isolated uterine muscle strips. Figure S2. Preliminary experimental data on indicators related to the dysmenorrhea model. Figure S3. Histological images of uterine tissue from primary dysmenorrhea female mice. Figure S4. PTGFR displayed strong binding affinity for all eight compounds (Calycosin, Calycosin-7-O-β-D-glucoside, Ferulic acid, Formononetin, Ligustilide, Ononin, Quercetin, Senkyunolide I). Table S1. Molecular docking results.

Author Contributions

Writing—original draft preparation, M.L. and T.H.; formal analysis, M.L. and T.H.; methodology, M.L., T.H., W.A., P.G., T.Z. (Tang Zhou) and Y.C.; data curation, M.L., T.H., X.T. and M.W.; writing—review and editing, T.Z. (Ting Zhang) and S.Z.; supervision, T.Z. (Ting Zhang) and S.Z.; funding acquisition, S.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (NSFC; Grant No. 82574615), the Key Project of Sichuan Science and Technology Education Joint Fund (Grant No. 2024NSFSC1978).

Institutional Review Board Statement

The animal study protocol was approved by the Ethics Committee of Chengdu University of Chinese Medicine (protocol code 2024035, approval date: 14 March 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article and Supplementary Materials. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
DBDDanggui Buxue Decoction
OTOxytocin
NSAIDsNon-steroidal anti-inflammatory drugs
AESAngelica sinensis
ARAstragalus membranaceus
K-HKrebs–Henseleit
IP3RInositol trisphosphate receptor
HEHaematoxylin and eosin
PTGFRProstaglandin F receptor
IP3Inositol 1,4,5-trisphosphate
PLCPhospholipase C

References

  1. Dawood, M.Y. Primary dysmenorrhea: Advances in pathogenesis and management. Obstet. Gynecol. 2006, 108, 428–441. [Google Scholar] [CrossRef]
  2. Guimarães, I.; Póvoa, A.M. Primary dysmenorrhea: Assessment and treatment. Rev. Bras. Ginecol. Obs. 2020, 42, 501–507. [Google Scholar] [CrossRef] [PubMed]
  3. Kho, K.A.; Shields, J.K. Diagnosis and management of primary dysmenorrhea. JAMA 2020, 323, 268–269. [Google Scholar] [CrossRef]
  4. Amin, S.M.; El-Sayed, M.M.; El-Monshed, A.H.; Khedr, M.A.; Atta, M.H.R. The hidden link: Dysmenorrhea, emotion regulation, and attitudes toward marriage in female nursing students. BMC Nurs. 2024, 23, 721. [Google Scholar] [CrossRef]
  5. Ferries-Rowe, E.; Corey, E.; Archer, J.S. Primary dysmenorrhea: Diagnosis and therapy. Obstet. Gynecol. 2020, 136, 1047–1058. [Google Scholar] [CrossRef]
  6. de Arruda, G.T.; Barbosa-Silva, J.; Driusso, P.; Pathmanathan, C.; Armijo-Olivo, S.; Avila, M.A. Worldwide prevalence of dysmenorrhea: A systematic review and meta-analysis across 70 countries. Pain 2026, 167, 41–55. [Google Scholar] [CrossRef]
  7. Gutman, G.; Nunez, A.T.; Fisher, M. Dysmenorrhea in adolescents. Curr. Probl. Pediatr. Adolesc. Health Care 2022, 52, 101186. [Google Scholar] [CrossRef]
  8. Schoep, M.E.; Nieboer, T.E.; van der Zanden, M.; Braat, D.D.M.; Nap, A.W. The impact of menstrual symptoms on everyday life: A survey among 42,879 women. Am. J. Obstet. Gynecol. 2019, 220, e561–e569-569.e567. [Google Scholar] [CrossRef]
  9. Wong, C.L. Health-related quality of life among chinese adolescent girls with dysmenorrhoea. Reprod. Health 2018, 15, 80. [Google Scholar] [CrossRef] [PubMed]
  10. Zarei, S.; Mohammad-Alizadeh-Charandabi, S.; Mirghafourvand, M.; Javadzadeh, Y.; Effati-Daryani, F. Effects of calcium-vitamin d and calcium-alone on pain intensity and menstrual blood loss in women with primary dysmenorrhea: A randomized controlled trial. Pain Med. 2017, 18, 3–13. [Google Scholar] [CrossRef] [PubMed]
  11. Hill-Eubanks, D.C.; Werner, M.E.; Heppner, T.J.; Nelson, M.T. Calcium signaling in smooth muscle. Cold Spring Harb. Perspect. Biol. 2011, 3, a004549. [Google Scholar] [CrossRef]
  12. Burdyga, T.; Wray, S.; Noble, K. In situ calcium signaling: No calcium sparks detected in rat myometrium. Ann. N. Y. Acad. Sci. 2007, 1101, 85–96. [Google Scholar] [CrossRef]
  13. Sanborn, B.M. Hormonal signaling and signal pathway crosstalk in the control of myometrial calcium dynamics. Semin. Cell Dev. Biol. 2007, 18, 305–314. [Google Scholar] [CrossRef]
  14. Fang, X.; Bogdanov, V.; Davis, J.P.; Kekenes-Huskey, P.M. Molecular insights into the mlck activation by cam. J. Chem. Inf. Model. 2023, 63, 7487–7498. [Google Scholar] [CrossRef]
  15. Wray, S.; Arrowsmith, S. Uterine excitability and ion channels and their changes with gestation and hormonal environment. Annu. Rev. Physiol. 2021, 83, 331–357. [Google Scholar] [CrossRef]
  16. Wrobel, M.H.; Mlynarczuk, J. Chloroorganic (ddt) and organophosphate (malathion) insecticides impair the motor function of the bovine cervix. Toxicol. Appl. Pharmacol. 2021, 427, 115667. [Google Scholar] [CrossRef] [PubMed]
  17. Marjoribanks, J.; Ayeleke, R.O.; Farquhar, C.; Proctor, M. Nonsteroidal anti-inflammatory drugs for dysmenorrhoea. Cochrane Database Syst. Rev. 2015, 2015, Cd001751. [Google Scholar] [CrossRef]
  18. Oladosu, F.A.; Tu, F.F.; Hellman, K.M. Nonsteroidal antiinflammatory drug resistance in dysmenorrhea: Epidemiology, causes, and treatment. Am. J. Obstet. Gynecol. 2018, 218, 390–400. [Google Scholar] [CrossRef]
  19. Ren, J.; Wang, X.; Sun, Y.; Yang, L.; Sun, H.; Sun, Y.; Kong, L.; Yan, G.; Han, Y.; Wang, X. Integrated metabolomics and lipidomics investigation of the mechanism of danggui sini decoction on improving lipid homeostasis in primary dysmenorrhea. Phytomedicine 2024, 135, 156034. [Google Scholar] [CrossRef] [PubMed]
  20. Li, X.; Wang, X.; Zhou, M.; Liu, J.; Song, X.; Bi, K.; Cheng, X.; Wang, D. Wenjing decoction exerts analgesic effects on cold coagulation and stasis pd through bdnf/trkb/creb pathway. J. Ethnopharmacol. 2025, 352, 120220. [Google Scholar] [CrossRef] [PubMed]
  21. Xie, Y.; Xu, H.; Gu, Z. Ge-gen decoction alleviates primary dysmenorrhoea symptoms in a rat model. J. Obstet. Gynaecol. 2024, 44, 2337691. [Google Scholar] [CrossRef]
  22. Gong, A.G.; Lau, K.M.; Xu, M.L.; Lin, H.Q.; Dong, T.T.; Zheng, K.Y.; Zhao, K.J.; Tsim, K.W. The estrogenic properties of danggui buxue tang, a chinese herbal decoction, are triggered predominantly by calycosin in mcf-7 cells. J. Ethnopharmacol. 2016, 189, 81–89. [Google Scholar] [CrossRef]
  23. Ma, C.C.; Jiang, Y.H.; Wang, Y.; Xu, R.R. The latest research advances of danggui buxue tang as an effective prescription for various diseases: A comprehensive review. Curr. Med. Sci. 2022, 42, 913–924. [Google Scholar] [CrossRef]
  24. Kwan, K.K.L.; Dong, T.T.X.; Tsim, K.W.K. Danggui buxue tang, a chinese herbal decoction containing astragali radix and angelicae sinensis radix, improves mitochrondial bioenergetics in osteoblast. Phytomedicine 2021, 88, 153605. [Google Scholar] [CrossRef]
  25. Shi, X.Q.; Zhu, Z.H.; Yue, S.J.; Tang, Y.P.; Chen, Y.Y.; Pu, Z.J.; Tao, H.J.; Zhou, G.S.; Yang, Y.; Guo, M.J.; et al. Integration of organ metabolomics and proteomics in exploring the blood enriching mechanism of danggui buxue decoction in hemorrhagic anemia rats. J. Ethnopharmacol. 2020, 261, 113000. [Google Scholar] [CrossRef]
  26. Li, C.; Zhu, F.; Xu, C.; Xiao, P.; Wen, J.; Zhang, X.; Wu, B. Dangguibuxue decoction abolishes abnormal accumulation of erythroid progenitor cells induced by melanoma. J. Ethnopharmacol. 2019, 242, 112035. [Google Scholar] [CrossRef]
  27. Hua, Y.L.; Ma, Q.; Yuan, Z.W.; Zhang, X.S.; Yao, W.L.; Ji, P.; Hu, J.J.; Wei, Y.M. A novel approach based on metabolomics coupled with network pharmacology to explain the effect mechanisms of danggui buxue tang in anaemia. Chin. J. Nat. Med. 2019, 17, 275–290. [Google Scholar] [CrossRef]
  28. Wang, J.; Cheng, C.; Gao, Y.; Li, Y.; Zhang, X.; Yao, D.; Zhang, Y. Danggui buxue decoction alleviates inflammation and oxidative stress in mice with escherichia coli-induced mastitis. Vet. Sci. 2025, 12, 227. [Google Scholar] [CrossRef] [PubMed]
  29. An, W.; Tian, Q.; Guo, P.; Chen, M.; Zhang, T.; Yang, P.; Zhang, S. Danggui buxue decoction and its components dilate coronary artery through activating the inward rectification k(+) channels pathway. J. Ethnopharmacol. 2025, 338, 119064. [Google Scholar] [CrossRef] [PubMed]
  30. Guo, Y.; Zhang, Y.; Hou, Y.; Guo, P.; Wang, X.; Zhang, S.; Yang, P. Anticonstriction effect of mca in rats by danggui buxue decoction. Front. Pharmacol. 2021, 12, 749915. [Google Scholar] [CrossRef] [PubMed]
  31. Wei, W.L.; Zeng, R.; Gu, C.M.; Qu, Y.; Huang, L.F. Angelica sinensis in china-a review of botanical profile, ethnopharmacology, phytochemistry and chemical analysis. J. Ethnopharmacol. 2016, 190, 116–141. [Google Scholar] [CrossRef] [PubMed]
  32. Ma, J.; Huang, J.; Hua, S.; Zhang, Y.; Zhang, Y.; Li, T.; Dong, L.; Gao, Q.; Fu, X. The ethnopharmacology, phytochemistry and pharmacology of angelica biserrata—A review. J. Ethnopharmacol. 2019, 231, 152–169. [Google Scholar] [CrossRef]
  33. Lin, H.Q.; Gong, A.G.; Wang, H.Y.; Duan, R.; Dong, T.T.; Zhao, K.J.; Tsim, K.W. Danggui buxue tang (astragali radix and angelicae sinensis radix) for menopausal symptoms: A review. J. Ethnopharmacol. 2017, 199, 205–210. [Google Scholar] [CrossRef]
  34. Gong, G.; Ganesan, K.; Liu, Y.; Huang, Y.; Luo, Y.; Wang, X.; Zhang, Z.; Zheng, Y. Danggui buxue tang improves therapeutic efficacy of doxorubicin in triple negative breast cancer via ferroptosis. J. Ethnopharmacol. 2024, 323, 117655. [Google Scholar] [CrossRef]
  35. Duan, S.; Niu, L.; Yin, T.; Li, L.; Gao, S.; Yuan, D.; Hu, M. A novel strategy for screening bioavailable quality markers of traditional chinese medicine by integrating intestinal absorption and network pharmacology: Application to wu ji bai feng pill. Phytomedicine 2020, 76, 153226. [Google Scholar] [CrossRef]
  36. Duan, S.N.; Qi, W.; Zhang, S.W.; Huang, K.K.; Yuan, D. Simultaneous quantification combined with multivariate statistical analysis of multiple chemical markers of wu ji bai feng pill by uhplc-ms/ms. J. Food Drug Anal. 2019, 27, 275–283. [Google Scholar] [CrossRef]
  37. Li, B.F.; Hui, J.R.; Liu, Z.B. Tcm master guo chengjie’s experience in treating primary dysmenorrhea by combining ai fu nuan gong wan with acupuncture. Lishizhen Med. Mater. Medica Res. 2022, 33, 3011–3012. [Google Scholar]
  38. Su, K.H.; Su, S.Y.; Ko, C.Y.; Cheng, Y.C.; Huang, S.S.; Chao, J. Ethnopharmacological survey of traditional chinese medicine pharmacy prescriptions for dysmenorrhea. Front. Pharmacol. 2021, 12, 746777. [Google Scholar] [CrossRef] [PubMed]
  39. Zierau, O.; Zheng, K.Y.; Papke, A.; Dong, T.T.; Tsim, K.W.; Vollmer, G. Functions of danggui buxue tang, a chinese herbal decoction containing astragali radix and angelicae sinensis radix, in uterus and liver are both estrogen receptor-dependent and -independent. Evid.-Based Complement. Altern. Med. 2014, 2014, 438531. [Google Scholar] [CrossRef]
  40. Liu, J.; Feng, R.; Dai, O.; Ni, H.; Liu, L.S.; Shu, H.Z.; Lu, Y.; Peng, C.; Xiong, L. Isoindolines and phthalides from the rhizomes of ligusticum chuanxiong and their relaxant effects on the uterine smooth muscle. Phytochemistry 2022, 198, 113159. [Google Scholar] [CrossRef] [PubMed]
  41. Zygmuntowicz, A.; Markiewicz, W.; Grabowski, T.; Burmańczuk, A.; Vyniarska, A.; Jaroszewski, J.J. Quercetin affects uterine smooth muscle contractile activity in gilts. PLoS ONE 2021, 16, e0252438. [Google Scholar] [CrossRef]
  42. Zhao, H.; Qi, M.; Gong, Y.; Chen, H.; Wang, D.; Fan, J.; Wang, Y.; Wang, J. Danggui buxue decoction: Comparative pharmacokinetic research on six bio-active components in different states by ultra-performance liquid chromatography-tandem mass spectrometry after oral administration. J. Sep. Sci. 2023, 46, e2200794. [Google Scholar] [CrossRef]
  43. Shi, X.; Tang, Y.; Zhu, H.; Li, W.; Li, Z.; Li, W.; Duan, J.A. Comparative tissue distribution profiles of five major bioactive components in normal and blood deficiency rats after oral administration of danggui buxue decoction by uplc-tq/ms. J. Pharm. Biomed. Anal. 2014, 88, 207–215. [Google Scholar] [CrossRef]
  44. Wen, X.D.; Qi, L.W.; Li, P.; Bao, K.D.; Yan, X.W.; Yi, L.; Li, C.Y. Simultaneous determination of calycosin-7-o-beta-d-glucoside, ononin, astragaloside iv, astragaloside i and ferulic acid in rat plasma after oral administration of danggui buxue tang extract for their pharmacokinetic studies by liquid chromatography-mass spectrometry. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 2008, 865, 99–105. [Google Scholar] [CrossRef]
  45. Peng, Y.; Zheng, X.; Fan, Z.; Zhou, H.; Zhu, X.; Wang, G.; Liu, Z. Paeonol alleviates primary dysmenorrhea in mice via activating cb2r in the uterus. Phytomedicine 2020, 68, 153151. [Google Scholar] [CrossRef]
  46. Du, J.; Bai, B.; Kuang, X.; Yu, Y.; Wang, C.; Ke, Y.; Xu, Y.; Tzang, A.H.; Qian, Z.M. Ligustilide inhibits spontaneous and agonists- or k+ depolarization-induced contraction of rat uterus. J. Ethnopharmacol. 2006, 108, 54–58. [Google Scholar] [CrossRef] [PubMed]
  47. Wu, C.-H.; Shieh, T.-M.; Wang, K.-L.; Huang, T.-C.; Hsia, S.-M. Quercetin, a main flavonoid in onion, inhibits the pgf2α-induced uterine contraction in vitro and in vivo. J. Funct. Foods 2015, 19, 495–504. [Google Scholar] [CrossRef]
  48. Bi, Y.; Li, H.; Diao, M.; Liu, Q.; Huang, L.; Tao, Y.; Wan, Y.; Lin, X. Piezo1 overexpression in the uterus contributes to myometrium contraction and inflammation-associated preterm birth. J. Transl. Med. 2024, 22, 1140. [Google Scholar] [CrossRef] [PubMed]
  49. Zakrzewski, P.K. Calcium homeostasis machinery in the human uterus—A potential therapeutic target in endometrial cancer. Int. J. Mol. Sci. 2025, 26, 10253. [Google Scholar] [CrossRef] [PubMed]
  50. Azlan, A.; Salamonsen, L.A.; Hutchison, J.; Evans, J. Endometrial inflammasome activation accompanies menstruation and may have implications for systemic inflammatory events of the menstrual cycle. Hum. Reprod. 2020, 35, 1363–1376. [Google Scholar] [CrossRef]
  51. Maybin, J.A.; Critchley, H.O.; Jabbour, H.N. Inflammatory pathways in endometrial disorders. Mol. Cell. Endocrinol. 2011, 335, 42–51. [Google Scholar] [CrossRef]
  52. Kyathanahalli, C.N.; Tu, F.F.; Hellman, K.M. Inflammatory mechanisms of dysmenorrhea: Novel insights from menstrual effluent in an adolescent cohort. BJOG 2025, 132, 1626–1634. [Google Scholar] [CrossRef]
  53. Iacovides, S.; Avidon, I.; Baker, F.C. What we know about primary dysmenorrhea today: A critical review. Hum. Reprod. Update 2015, 21, 762–778. [Google Scholar] [CrossRef]
  54. Jusuf, E.C.; Octaviani, D.; Husain, M.G.; Jumrah. The influence of physical activity, body mass index and urinary levels of prostaglandin (pgf2α) with the incidence of primary dysmenorrhea in adolescents. J. Obstet. Gynaecol. Res. 2024, 50, 909–913. [Google Scholar] [CrossRef] [PubMed]
  55. Tahir, A.; Sinrang, A.W.; Jusuf, E.C.; Syamsuddin, S.; Stang; Arsyad, A. The influence of macronutrient intake, stress and prostaglandin levels (pgf2α) of urine with the incidence of dysmenorrhea in adolescents. Gac. Sanit. 2021, 35, s298–s301. [Google Scholar] [CrossRef] [PubMed]
  56. Ruan, Y.C.; Zhou, W.; Chan, H.C. Regulation of smooth muscle contraction by the epithelium: Role of prostaglandins. Physiology 2011, 26, 156–170. [Google Scholar] [CrossRef]
  57. Lv, X.; Gao, K.; Nie, J.; Zhang, X.; Zhang, S.; Ren, Y.; Sun, X.; Li, Q.; Huang, J.; Liu, L.; et al. Structures of human prostaglandin f(2α) receptor reveal the mechanism of ligand and g protein selectivity. Nat. Commun. 2023, 14, 8136. [Google Scholar] [CrossRef] [PubMed]
  58. Channuwong, P.; Yuan, Y.; Yao, S.; Bauermann, F.V.; Cheng, H.; Suantawee, T.; Adisakwattana, S. Malvidin-3-glucoside induces insulin secretion by activating the plc/ip(3) pathway and enhancing ca(2+) influx in ins-1 pancreatic β-cells. Sci. Rep. 2025, 15, 12529. [Google Scholar] [CrossRef]
  59. Malik, M.; Roh, M.; England, S.K. Uterine contractions in rodent models and humans. Acta Physiol. 2021, 231, e13607. [Google Scholar] [CrossRef]
  60. Jian, X.; Shi, C.; Luo, W.; Zhou, L.; Jiang, L.; Liu, K. Therapeutic effects and molecular mechanisms of quercetin in gynecological disorders. Biomed. Pharmacother. 2024, 173, 116418. [Google Scholar] [CrossRef]
  61. Yang, X.; Tian, Y.; Liu, J.; Kou, Y.; Xie, Y.; Wang, S.; Zhao, Y. Peony pollen protects against primary dysmenorrhea in mice by inhibiting inflammatory response and regulating the cox2/pge2 pathway. Int. J. Mol. Sci. 2023, 24, 17245. [Google Scholar] [CrossRef]
  62. Hong, F.; He, G.; Zhang, M.; Yu, B.; Chai, C. The establishment of a mouse model of recurrent primary dysmenorrhea. Int. J. Mol. Sci. 2022, 23, 6128. [Google Scholar] [CrossRef]
  63. Sun, L.; Liu, L.; Zong, S.; Wang, Z.; Zhou, J.; Xu, Z.; Ding, G.; Xiao, W.; Kou, J. Traditional chinese medicine guizhi fuling capsule used for therapy of dysmenorrhea via attenuating uterus contraction. J. Ethnopharmacol. 2016, 191, 273–279. [Google Scholar] [CrossRef]
  64. Hsia, S.M.; Kuo, Y.H.; Chiang, W.; Wang, P.S. Effects of adlay hull extracts on uterine contraction and ca2+ mobilization in the rat. Am. J. Physiol. Endocrinol. Metab. 2008, 295, E719–E726. [Google Scholar] [CrossRef]
  65. Zizzo, M.G.; Cicio, A.; Bruno, M.; Serio, R. Inhibitory effect and underlying mechanism of essential oil of Prangos ferulacea lindl (L.) on spontaneous and induced uterine contractions in non-pregnant rats. Biomed. Pharmacother. 2023, 167, 115570. [Google Scholar] [CrossRef]
  66. Ma, Q.; Wang, Y.; Zhang, W.; Du, Z.; Tian, Z.; Li, H. The mechanism involved in the inhibition of resveratrol and genistein on the contractility of isolated rat uterus smooth muscle. Nutrients 2024, 16, 3417. [Google Scholar] [CrossRef]
  67. Chiang, Y.F.; Hung, H.C.; Chen, H.Y.; Huang, K.C.; Lin, P.H.; Chang, J.Y.; Huang, T.C.; Hsia, S.M. The inhibitory effect of extra virgin olive oil and its active compound oleocanthal on prostaglandin-induced uterine hypercontraction and pain-ex vivo and in vivo study. Nutrients 2020, 12, 3012. [Google Scholar] [CrossRef]
  68. Wong, J.; Chiang, Y.F.; Shih, Y.H.; Chiu, C.H.; Chen, H.Y.; Shieh, T.M.; Wang, K.L.; Huang, T.C.; Hong, Y.H.; Hsia, S.M. Salvia sclarea l. Essential oil extract and its antioxidative phytochemical sclareol inhibit oxytocin-induced uterine hypercontraction dysmenorrhea model by inhibiting the ca(2+)-mlck-mlc20 signaling cascade: An ex vivo and in vivo study. Antioxidants 2020, 9, 991. [Google Scholar] [CrossRef] [PubMed]
  69. Wang, L.; Jia, C.; Yu, Z.; Liu, X.; Kang, L.; Cong, Y.; Shan, Y.; Zhao, Z.; Ma, B.; Cong, Y. Pennogenin tetraglycoside induces rat myometrial contraction and mlc20 phosphorylation via plc-ip(3) and rhoa/rho kinase signaling pathways. PLoS ONE 2012, 7, e51536. [Google Scholar] [CrossRef]
  70. Yang, L.; Chai, C.Z.; Yue, X.Y.; Yan, Y.; Kou, J.P.; Cao, Z.Y.; Yu, B.Y. Ge-gen decoction attenuates oxytocin-induced uterine contraction and writhing response: Potential application in primary dysmenorrhea therapy. Chin. J. Nat. Med. 2016, 14, 124–132. [Google Scholar] [CrossRef] [PubMed]
  71. Yang, L.; Cao, Z.; Yu, B.; Chai, C. An in vivo mouse model of primary dysmenorrhea. Exp. Anim. 2015, 64, 295–303. [Google Scholar] [CrossRef] [PubMed]
  72. Macêdo, C.A.F.; Paiva, G.O.; Menezes, P.M.N.; Ribeiro, T.F.; Brito, M.C.; Vilela, D.A.D.; Duarte Filho, L.; Ribeiro, F.; Lucchese, A.M.; Lima, J.T.; et al. Lippia origanoides essential oil induces tocolytic effect in virgin rat uterus and inhibits writhing in a dysmenorrhea mouse model. J. Ethnopharmacol. 2022, 290, 115099. [Google Scholar] [CrossRef] [PubMed]
  73. Gao, S.J.; Li, X.L.; Gao, R.; Tan, W.H.; Li, W.; Liu, L. Danggui buxue decoction alleviates primary dysmenorrhea in rats by regulating the mek1/2/erk1/2/nf-κb pathway. Fitoterapia 2025, 180, 106315. [Google Scholar] [CrossRef] [PubMed]
  74. Li, G.; Ren, Y.; Li, E.; Deng, K.; Qu, C.; Zhang, J.; Zhang, L.; Wang, X.; Lian, J.; Zhou, H.; et al. Quercetin inhibits mesothelial-mesenchymal transition and alleviates postoperative peritoneal adhesions by blocking the tgf-β1/pi3k/akt pathway. J. Ethnopharmacol. 2024, 319, 117242. [Google Scholar] [CrossRef]
Pharmaceuticals 19 00520 g001
Figure 1. Representative UPLC–Orbitrap MS chromatograms of DBD: (A) ESI+ mode; (B) ESI− mode.
Figure 1. Representative UPLC–Orbitrap MS chromatograms of DBD: (A) ESI+ mode; (B) ESI− mode.
Pharmaceuticals 19 00520 g001
Pharmaceuticals 19 00520 g002
Figure 2. DBD, AR and AES effectively relaxed OT (50 ng/mL) or KCl (60 mM)-induced uterine contractions: (A) Workflow of the in vitro uterine contraction assay. (B,D) DBD, AR and AES on the uterine relaxation rate and EC50 fitting curves under OT (50 ng/mL) precontracted conditions. (C,E) DBD, AR and AES on the uterine relaxation rate and EC50 fitting curves under KCl (60 mM) precontracted conditions. Data are presented as mean ± SEM (n = 6). n = number of uterine muscle strips (one per mouse).
Figure 2. DBD, AR and AES effectively relaxed OT (50 ng/mL) or KCl (60 mM)-induced uterine contractions: (A) Workflow of the in vitro uterine contraction assay. (B,D) DBD, AR and AES on the uterine relaxation rate and EC50 fitting curves under OT (50 ng/mL) precontracted conditions. (C,E) DBD, AR and AES on the uterine relaxation rate and EC50 fitting curves under KCl (60 mM) precontracted conditions. Data are presented as mean ± SEM (n = 6). n = number of uterine muscle strips (one per mouse).
Pharmaceuticals 19 00520 g002
Pharmaceuticals 19 00520 g003
Figure 3. The eight active constituents of DBD-relaxed OT (50 ng/mL) or KCl (60 mM)-induced uterine contraction: (A,C) Effects of the active constituents of DBD on uterine relaxation rate and EC50 fitting curves under OT (50 ng/mL) precontracted conditions. (B,D) Effects of the active constituents of DBD on uterine relaxation rate and EC50 fitting curves under KCl (60 mM) precontracted conditions. Data are presented as mean ± SEM (n = 6). n = number of uterine muscle strips (one per mouse).
Figure 3. The eight active constituents of DBD-relaxed OT (50 ng/mL) or KCl (60 mM)-induced uterine contraction: (A,C) Effects of the active constituents of DBD on uterine relaxation rate and EC50 fitting curves under OT (50 ng/mL) precontracted conditions. (B,D) Effects of the active constituents of DBD on uterine relaxation rate and EC50 fitting curves under KCl (60 mM) precontracted conditions. Data are presented as mean ± SEM (n = 6). n = number of uterine muscle strips (one per mouse).
Pharmaceuticals 19 00520 g003
Pharmaceuticals 19 00520 g004
Figure 4. Effects of DBD, Quercetin, Calycosin and Ligustilide on Ca2+: (A) Representative graphs of Ca2+-dependent contraction responses to DBD, Quercetin, Calycosin and Ligustilide. (B,C) Inhibitive effect of DBD, Quercetin, Calycosin and Ligustilide on the mean peak amplitude. (D–G) Nifedipine attenuated the uterine-relaxant effects of DBD, Quercetin, Calycosin and Ligustilide. Compared with the control group, DBD showed * p < 0.05, ** p < 0.01, *** p < 0.001; Quercetin, Calycosin and Ligustilide showed # p < 0.05, ### p < 0.001. Data are presented as mean ± SEM (n = 6). n = number of uterine muscle strips (one per mouse).
Figure 4. Effects of DBD, Quercetin, Calycosin and Ligustilide on Ca2+: (A) Representative graphs of Ca2+-dependent contraction responses to DBD, Quercetin, Calycosin and Ligustilide. (B,C) Inhibitive effect of DBD, Quercetin, Calycosin and Ligustilide on the mean peak amplitude. (D–G) Nifedipine attenuated the uterine-relaxant effects of DBD, Quercetin, Calycosin and Ligustilide. Compared with the control group, DBD showed * p < 0.05, ** p < 0.01, *** p < 0.001; Quercetin, Calycosin and Ligustilide showed # p < 0.05, ### p < 0.001. Data are presented as mean ± SEM (n = 6). n = number of uterine muscle strips (one per mouse).
Pharmaceuticals 19 00520 g004
Pharmaceuticals 19 00520 g005
Figure 5. DBD, Quercetin, Calycosin and Ligustilide inhibit intracellular calcium release: (A,B) DBD, Quercetin, Calycosin and Ligustilide inhibit intracellular calcium release. (C–F) 2-APB attenuated the uterine-relaxant effects of DBD, Quercetin, Calycosin and Ligustilide. Compared with the control group, DBD showed * p < 0.05, ** p < 0.01, *** p < 0.001; Quercetin, Calycosin and Ligustilide showed # p < 0.05, ## p < 0.01, ### p < 0.001. Data are presented as mean ± SEM (n = 6). n = number of uterine muscle strips (one per mouse).
Figure 5. DBD, Quercetin, Calycosin and Ligustilide inhibit intracellular calcium release: (A,B) DBD, Quercetin, Calycosin and Ligustilide inhibit intracellular calcium release. (C–F) 2-APB attenuated the uterine-relaxant effects of DBD, Quercetin, Calycosin and Ligustilide. Compared with the control group, DBD showed * p < 0.05, ** p < 0.01, *** p < 0.001; Quercetin, Calycosin and Ligustilide showed # p < 0.05, ## p < 0.01, ### p < 0.001. Data are presented as mean ± SEM (n = 6). n = number of uterine muscle strips (one per mouse).
Pharmaceuticals 19 00520 g005
Pharmaceuticals 19 00520 g006
Figure 6. Effect of BDB on primary dysmenorrhea female mice: (A) Flowchart of the establishment and treatment protocol for a primary dysmenorrhea mouse model. The uterine organ index (B), writhing latency (C), and writhing times (D) in primary dysmenorrhea model mice. (E,F) Expression of Tnfa and Il6 mRNA in uterine tissue. (G) Uterine HE-stained sections: black arrows indicate glandular hyperplasia and increased secretion within the intrinsic layer; blue arrows indicate interstitial edema. ## p < 0.01, ### p < 0.001 vs. control group, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. model group. Data are presented as mean ± SEM (n = 6).
Figure 6. Effect of BDB on primary dysmenorrhea female mice: (A) Flowchart of the establishment and treatment protocol for a primary dysmenorrhea mouse model. The uterine organ index (B), writhing latency (C), and writhing times (D) in primary dysmenorrhea model mice. (E,F) Expression of Tnfa and Il6 mRNA in uterine tissue. (G) Uterine HE-stained sections: black arrows indicate glandular hyperplasia and increased secretion within the intrinsic layer; blue arrows indicate interstitial edema. ## p < 0.01, ### p < 0.001 vs. control group, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. model group. Data are presented as mean ± SEM (n = 6).
Pharmaceuticals 19 00520 g006
Pharmaceuticals 19 00520 g007
Figure 7. DBD and Quercetin alleviate dysmenorrhea by reducing Ca2+ levels: Changes in Ca2+ (A), PLC (B) and IP3 (C) in uterine tissue homogenates from primary dysmenorrhea female mice. (D,E) Expression of Pgf2a and Ptgfr mRNA in uterine tissue. (F) Writhing times; (G) Writhing latency; Ca2+ levels (H); and IP3 levels (I) in uterine tissue homogenates. ## p < 0.01, ### p < 0.001 vs. control group, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. model group. Data are presented as mean ± SEM (n = 6).
Figure 7. DBD and Quercetin alleviate dysmenorrhea by reducing Ca2+ levels: Changes in Ca2+ (A), PLC (B) and IP3 (C) in uterine tissue homogenates from primary dysmenorrhea female mice. (D,E) Expression of Pgf2a and Ptgfr mRNA in uterine tissue. (F) Writhing times; (G) Writhing latency; Ca2+ levels (H); and IP3 levels (I) in uterine tissue homogenates. ## p < 0.01, ### p < 0.001 vs. control group, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. model group. Data are presented as mean ± SEM (n = 6).
Pharmaceuticals 19 00520 g007
Table 1. Identification of compounds in DBD by UPLC–Orbitrap MS.
Table 1. Identification of compounds in DBD by UPLC–Orbitrap MS.
No.RT (min)CompoundsFormulaIon Modem/zErrorMS/MS Fragment IonsSource
10.73CanavanineC5H12N4O3[M + H]+177.0980−0.49160.0716, 118.0498, 102.0548, 76.0504AR
20.76ArginineC6H14N4O2[M + H]+175.1190−0.07158.0926, 130.0976, 116.0706, 70.0652, 60.0557AES, AR
30.80Aspartic acidC4H7NO4[M − H]−132.0300+1.04115.0037, 88.0403AES, AR
40.86InosineC10H12N4O5[M − H]−267.0720−0.53249.0620, 113.0245, 99.0087AES
50.89RaffinoseC18H32O16[M + H]+505.1770+0.84-AES, AR
[M − H]−503.1620+1.02323.0988, 221.0666, 179.0561, 89.0245AES, AR
60.90Malic acidC4H6O5[M − H]−133.0141+0.96115.0037, 89.0244, 71.0139AES, AR
70.90AdenineC5H5N5[M + H]+136.0618+0.06119.0353AES, AR
80.94SucroseC12H22O11[M + H]+343.1236+0.33163.0604, 145.0497, 127.0391, 97.0286, 85.0285AES, AR
[M − H]−341.1085+0.65179.0561, 119.0350, 101.0244, 89.0244AES, AR
90.96MycoseC12H22O11[M + H]+343.1236+0.24163.0604, 145.0497, 127.0391, 97.0286, 85.0285, 69.0336AES, AR
100.98Citric acidC6H8O7[M + H]+193.0347+2.18-AES, AR
[M − H]−191.0195+0.90129.0194, 111.0088, 87.0088AES, AR
111.31TyrosineC9H11NO3[M + H]+182.0811−0.22165.0547, 147.0442, 136.0758, 123.0441, 91.0452AES, AR
[M − H]−180.0665+0.98163.0401, 119.0503, 93.0346AES, AR
121.32AdenosineC10H13N5O4[M + H]+268.1040.00136.0618AES, AR
131.35GuanosineC10H13N5O5[M + H]+284.09890.00152.0567AES, AR
141.36GuanineC5H5N5O[M + H]+152.0567+0.02135.0301, 110.0347AES, AR
151.56LeucineC6H13NO2[M + H]+132.1019−0.2786.0964AES, AR
[M − H]−130.0872+0.9588.0405AES, AR
161.68XanthosineC10H12N4O6[M + H]+285.0831+0.38-AR
171.69Arg-IleC12H25N5O3[M + H]+288.2030+0.05271.1767, 175.1190, 70.0651AES, AR
182.10Piscidic acidC11H12O7[M + H]+257.0658+0.86-AR
[M − H]−255.0509+0.99193.0502, 179.0349, 165.0557, 149.0604AR
192.65PhenylalanineC9H11NO2[M + H]+166.0862−0.09120.0807AES, AR
203.07PantothenateC9H17NO5[M + H]+220.1180+0.00202.1077, 184.0968, 124.0757, 90.0549AES, AR
213.09SuccinoadenosineC14H17N5O8[M + H]+384.1150+0.00252.0727, 192.0516, 162.0774, 136.0617AES, AR
223.43Pyrocatechuic acidC7H6O4[M − H]−153.0193+1.06-AR
233.95VanillinC8H8O3[M − H]−151.0400+1.01123.0451, 121.0295, 107.0502AES
243.97TryptophanC11H12N2O2[M + H]+205.0971−0.31188.0706, 146.0600, 118.0650AES
253.973-Indoleacrylic acidC11H9NO2[M + H]+188.0705−0.39170.0597, 146.0600, 118.0650AES, AR
263.98Indole-3-carboxaldehydeC9H7NO[M + H]+146.0600+0.00118.0651, 100.0757, 91.0545AES, AR
274.22Pratensein-Glc-GlcC28H32O16[M + H]+625.1766+0.41463.1219, 301.0706AR
284.24ComplanatusideC28H32O16[M + H]+625.1765+0.22301.0706AR
294.464-Hydroxybenzoic acidC7H6O3[M + H]+139.0389−0.22121.0284AR
304.58Chlorogenic acid isomerC16H18O9[M + H]+355.1025+0.51163.0390, 135.0441AES, AR
[M − H]−353.0876+0.88191.0560, 179.0349, 135.0452AES, AR
314.60Chlorogenic acidC16H18O9[M − H]−353.0876+0.84191.056AES, AR
324.61UmbelliferoneC9H6O3[M + H]+163.0390+0.12145.0284, 135.0440, 117.0334AES
334.64GuaiacolC7H8O2[M + H]+125.0597−0.21107.0491, 97.0284AES
[M − H]−123.0451+1.03105.7571, 95.0139AES
344.65Chlorogenic acidC16H18O9[M + H]+355.1024+0.26163.039AES, AR
354.65Sinapic acidC11H12O5[M + H]+225.0757−0.09-AES
364.66Chlorogenic acid isomerC16H18O9[M + H]+355.1024+0.26163.039AES, AR
374.73Chlorogenic acid isomerC16H18O9[M − H]−353.0876+0.91191.0560, 179.0349, 173.0455, 135.0452AES, AR
385.01Phthalic anhydrideC8H4O3[M + H]+149.0233+0.00131.0855, 121.0284, 91.0541, 65.0386AES
395.04Caffeic acidC9H8O4[M + H]+181.0495+0.03135.0918AES, AR
[M − H]−179.0349+0.99135.0452AES, AR
405.19Vanillic acidC8H8O4[M + H]+169.0495+0.09151.0390, 123.0807, 79.0541AES
[M − H]−167.0348+0.91123.0452AES
415.21Icariside F2C18H26O10[M − H]−401.1452+1.00269.1030, 161.0455, 113.0244, 101.0244AES
425.29RiboflavinC17H20N4O6[M + H]+377.1456+0.18234.0875, 216.0767, 172.0868AR
435.55Rhamnocitrin 3-OglucosideC22H22O11[M − H]−461.1091+1.29299.0560, 284.0324, 255.0299AR
445.57Aspartic acidC4H7NO4[M + H]+134.0448−0.11116.0645AES, AR
455.64Pratensein-7-O-β-D-glucosideC22H22O11[M + H]+463.1236+0.31301.0706, 286.0480, 241.0500, 213.0547AR
[M − H]−461.1091+1.23299.0560, 284.0324, 255.0299AR
465.755-Feruoylquinic acidC17H20O9[M − H]−367.1037+1.31191.0560, 173.0454, 134.0373, 93.0346AES
475.96(+) Lariciresinol-4′-O-β-D-Apiofuranosyl-(1-2)-β-D-GlucopyranosylC31H42O15[M − H]−653.2451+1.12623.2345, 329.1394AR
486.07VanillinC8H8O3[M + H]+153.0546+0.06125.0597, 111.0440, 93.0334, 65.0386AES
496.10Sinapic acidC11H12O5[M − H]−223.0611+0.97208.0376, 193.0142, 149.0246AR
506.19Rhamnocitrin 3-neohesperidoside isomerC28H32O15[M + H]+609.1813−0.09285.0758, 270.0523AR
[M − H]−607.1669+1.18413.1089, 283.0605, 193.0505, 137.0244AR
516.25Dimethyl azelateC11H20O4[M + H]+217.1434−0.03-AES
526.35SissotrinC22H22O10[M + H]+447.1284−0.41-AR
536.49LiquiritinC21H22O9[M − H]−417.1192+1.19255.0663, 135.0088, 119.0503AR
546.53Calycosin-7-O-β-D-glucosideC22H22O10[M + H]+447.1285−0.21285.0757, 270.05231, 253.04971, 225.05463, 137.02345AR
556.53Ferulic acidC10H10O4[M − H]−193.0505+0.96178.0272, 149.0609, 134.0374AES, AR
566.54Isoferulic AcidC10H10O4[M − H]−193.0505+0.98178.0272, 149.0609, 134.0374AES, AR
576.56Senkyunolide IC12H16O4[M + H]+225.1121−0.20207.1015, 165.0910AES
586.57N-AcetylphenylalanineC11H13NO3[M + H]+208.0968+0.00-AES, AR
[M − H]−206.0822+1.00164.0717, 147.0452, 91.0554AES, AR
596.577-Methoxycoumarin isomerC10H8O3[M + H]+177.0546−0.06149.0597, 145.0284, 117.0334, 89.0385AES
606.57Dimethyl phthalateC10H10O4[M + H]+195.0652+0.02177.0546, 171.1538, 145.0284, 117.0334AES
[M − H]−193.0505+0.96178.0272, 149.0609, 134.0374AES
616.587-Methoxycoumarin isomerC10H8O3[M + H]+177.0546+0.05149.0597, 145.0284, 117.0334, 89.0385AES
626.69TamarixinC22H22O12[M − H]−477.1039+1.19315.0457, 271.0230AR
636.70N-AcetyltryptophanC13H14N2O3[M − H]−245.0931+0.99203.0827, 116.0353, 98.0248, 74.0248AES, AR
646.72Apigenin-7-O-β-D-glucosideC21H20O10[M + H]+433.1131+0.48332.1817, 271.0602AR
[M − H]−431.0982+0.91269.0457, 239.0342, 211.1095AR
656.96Apigenin-5-O-β-D-glucopyranosideC21H20O10[M − H]−431.0986+3.08385.1786, 268.0376, 239.0352, 205.0870AR
667. 001,3- Dicaffeoylquinic acidC25H24O12[M − H]−515.1195+1.11353.0879, 335.0711, 191.0559, 179.0349, 173.0454, 135.0451AES
677.033′-methoxy-5′-hydroxy-isoflavaone-7-O-β-DglucopyranosideC22H22O10[M − H]−445.1140+1.12283.0609, 281.0454, 268.0374, 253.0505, 239.0348AR
687.11(+)-7-epi-Syringaresinol 4′-glucosideC28H36O13[M − H]−579.2081+0.85417.1555, 387.1084, 353.1025, 181.0506, 166.0270, 151.0036AR
697.19GenistinC21H20O10[M − H]−431.0986+1.33268.0376, 239.0352, 205.0870AR
707.199-(2,3-dihydroxypropoxy)-9-oxononanoic acidC12H22O6[M − H]−261.1342+0.96187.0976, 169.0867, 125.0972AR
717.19Isomucronulatol-7,2′-di-glucosideC29H38O15[M − H]−625.2138+1.11463.1611, 301.1082AR
727.19Isomucronulatol-7,2′-di-glucoside isomerC29H38O15[M − H]−625.2138+1.11463.1611, 301.1082AR
737.29Calycosin-7-O-β-Dglucoside-6″-OmalonateC25H24O13[M + H]+533.1290+0.01285.0755, 270.0522AR
747.344′-methoxykaempferol-3-O-β-DglucosideC22H22O11[M + H]+463.1235+0.03301.0706, 286.0473, 241.0498, 213.0542AR
757.39Licoagroside D or isomerC22H24O10[M − H]−447.1299+1.28285.0768, 270.0533AR
767.41Licoagroside D or isomerC22H24O10[M − H]−447.1298+1.22285.0768, 270.0533AR
777.48Hesperetin 7-OglucosideC22H24O11[M − H]−463.1248+1.30301.0721, 191.0349AR
787.561,4-Dicaffeoylquinic acidC25H24O12[M − H]−515.1196+1.17353.0879, 191.0559, 179.0349, 173.0454AES
797.65Azelaic acidC9H16O4[M − H]−187.0974+0.92169.0871, 143.1078, 125.0973AES, AR
807.667-MethoxycoumarinC10H8O3[M − H]−175.0402+1.22160.0167, 132.0218AES
817.69Senkyunolide SC12H16O5[M − H]−239.0924+1.02195.1026, 154.0272, 111.0452, 101.0608AES
827.76Z-6,7-epoxyligustilideC12H14O3[M + H]+207.1015−0.10189.0912, 161.0961, 119.0854AES
837.82Salicylic acidC7H6O3[M − H]−137.0242+0.9393.0346AR
847.824-Hydroxybenzoic acidC7H6O3[M − H]−137.0242+0.9493.0346AR
857.97Calycosin-7-O-β-D-(6″-O-acetyl)-glucosideC24H24O11[M + H]+489.1392+0.11285.0756, 270.0523, 225.0547AR
867.98Ononin-GlcC28H32O14[M + H]+593.1865+0.06269.0809, 254.0567, 213.0916AR
878.00GlycyrosideC27H30O13[M + H]+563.1761+0.31269.0807, 254.0574AR
[M − H]−561.1611+0.86267.0661, 252.0427AR
888.13UnknownC28H34O14[M − H]−593.1877+1.19505.1718, 417.1558, 402.1324, 387.1083,181.0506, 166.0271AR
898.14Senkyunolide FC12H14O3[M + H]+207.1015−0.49189.0912, 161.0961, 119.0854AES
908.17PratenseinC16H12O6[M − H]−299.0561+1.11284.0329, 255.0301AR
918.25OnoninC22H22O9[M + H]+431.1333−0.76269.0807, 254.0573AR
[M − H]−429.1190+1.04-AR
928.32Afrormosin 7-O-glucosideC23H24O10[M + H]+461.1444+0.34299.0912AR
938.33DaidzeinC15H10O4[M + H]+255.0652+0.06199.0753, 137.0232AR
[M − H]−253.0505+0.99225.0552AR
948.393-Hydro-9,10-diMPPen-GlcC28H34O14[M − H]−593.1877+1.19299.0923, 284.0689, 269.0453AR
958.496,7-EpoxyligustilideC12H14O3[M + H]+207.1015−0.54189.0912, 161.0961AES
968.56LiquiritigeninC15H12O4[M + H]+257.0808+0.02147.0441, 137.0233, 119.0493AR
978.71Methylinissolin-3-O-β-D-glucosideC23H26O10[M + H]+463.1599+0.01301.1073, 269.0808, 167.0703AR
988.71MethylnissolinC17H16O5[M + H]+301.1070−0.29269.0811, 167.0703AR
[M − H]−299.0924+0.98284.0691, 269.0455, 241.0508, 158.0572AR
998.76PruninC21H22O10[M − H]−433.1140+1.12271.0611, 256.0375, 243.0663AR
1008.80CalycosinC16H12O5[M + H]+285.0756−0.56270.0525, 253.0498, 225.0544AR
[M − H]-283.0609+0.81268.0377, 211.0401AR
1018.805,7-Dihydroxy-4-methoxyisoflavoneC16H12O5[M + H]+285.0756−0.56270.0525, 253.0498, 225.0544, 137.0231AR
1028.95Isomucronulatol-7-O-β-D-glucosideC23H28O10[M + H]+465.1756+0.10303.1219, 167.0706, 123.0440AR
[M − H]−463.1610+1.17301.1084, 286.0849, 271.0615, 179.0717, 164.0479, 135.0452AR
1039.013,9-dihydroxyligustilideC12H16O4[M − H]−223.0975+1.04179.1077, 137.0972, 95.0503AES
1049.03Formononetin-7-O-β-D-glucoside-6″-OmalonateC25H24O12[M + H]+517.1339−0.28269.0807, 254.0573AR
1059.03Formononetin-7-O-β-D-glucoside-6″-Omalonate isomerC25H24O12[M + H]+517.1339−0.28269.0807, 254.0573AR
1069.033,4-Dicaffeoylquinic acidC25H24O12[M − H]−515.1196+1.23353.0879, 335.0711, 191.0559, 179.0349, 173.0454, 135.0451AES
1079.06Rhamnocitrin 3-OglucosideC22H22O11[M + H]+463.1236+0.18301.0706, 231.0652, 167.0342AR
1089.084′-methoxykaempferol-3-O-β-DglucosideC22H22O11[M − H]−461.1090+1.20299.0562, 165.0193AR
1099.29Senkyunolide H-7-AcetateC14H18O5[M − H]−265.1081+1.07247.1340, 221.1182AES
1109.30DihydrocapsaicinC18H29NO3[M + H]+308.2220−0.00290.2120, 262.2169, 179.1305AR
1119.41Senkyunolide J or isomerC12H18O4[M − H]−225.1131+0.96207.1027, 181.1234, 163.1130AES
1129.55Astragaloside IV, V, VI or VIIC47H78O19[M + H]+947.5213+0.31569.3848, 455.3523, 437.3412, 419.3307, 143.1067AR
1139.59Isomucronulatolacetyl-GlcC25H30O11[M − H]−505.1714+1.01445.1506, 301.1081, 271.0613, 121.0295AR
1149.65glucoside-6″-OmalonateC26H28O13[M + H]+549.1604+0.24301.1077, 167.0704AR
1159.73GenisteinC15H10O5[M + H]+271.0601+0.07229.0858, 153.0182, 121.0284AR
1169.83Senkyunolide DC12H14O4[M − H]−221.0818+0.96177.092AR
1179.87AfrormosinC17H14O5[M + H]+299.0914−0.10283.0600, 266.0573, 255.0655, 237.0546AR
1189.876″-O-acetylononinC24H24O10[M + H]+473.1442−0.05269.0808AR
1199.97PenduloneC17H16O6[M + H]+317.1019−0.11299.0912, 289.1075, 183.0650, 163.0390, 135.0440, 107.0490AR
[M − H]−315.0875+1.18285.0396, 109.0295AR
12010.04KumatakeninC17H14O6[M − H]−313.0719+1.21298.0484, 283.0248, 255.0300, 227.0350AR
12110.16PratenseinC16H12O6[M + H]+301.0707+0.05269.0448, 241.0496, 167.0703AR
12210.179,12,13-Trihydroxyoctadeca-10,15-dienoic acidC18H32O5[M − H]−327.2176+1.02309.2069, 291.1967, 229.1447, 211.1340, 171.1027AR
12310.177-Methyl-kaempferolC16H12O6[M + H]+301.0707+0.05286.0472, 269.0448, 241.0496, 167.0703AR
[M − H]−299.0561+1.11284.0329, 255.0301AR
12410.19Methylnissolin-3-O-β-D-(6′-O-acetyl)-glucosideC25H28O11[M + H]+505.1704−0.06301.1070, 167.0703AR
12510.203,7,8-trihydroxy-4-methoxyisoflavoneC16H12O6[M − H]−299.0561+1.112840329, 267.0291, 256.0370, 255.0307AR
12610.509,10,11-Trihydroxyoctadeca-12,15-dienoic acidC18H32O5[M − H]−327.2177+1.14309.2069, 291.1967, 229.1447, 211.1340, 183.1390, 171.1027AR
12710.799,10,13-trihydroxy-11-octadecenoic acidC18H34O5[M − H]−329.2332+0.97229.1445, 211.1340, 171.1027AR
12810.93(Z)-5,8,11-trihydroxyoctadec-9-enoic acidC18H32O5[M − H]−329.2332+0.93291.1967, 229.1447, 211.1340, 171.1027AR
12910.95FormononetinC16H12O4[M + H]+269.0806−0.88254.0574, 237.0549, 213.0911AR
[M − H]−267.0661+0.89252.0429, 223.0403, 195.0451AR
13011.13Senkyunolide FC12H14O3[M − H]−205.0867+0.81187.0772, 161.0971AR
13111.20ButylphthalideC12H14O2[M + H]+191.1066−0.09173.0959, 163.1118, 149.0597, 145.1012, 135.0441AES
13211.22Senkyunolide KC12H16O3[M − H]−207.1024+0.88163.1128, 159.0817AES
13311.39OdoratinC17H14O6[M − H]−313.0719+1.21298.0452, 193.0506, 134.0374AR
13411.616,7-EpoxyligustilideC12H14O3[M − H]−205.0866+0.69161.0972, 106.0424AR
13511.69Senkyunolide GC12H16O3[M − H]−207.1026+1.03163.1021, 161.0972, 106.0124AES
13611.84Coniferyl ferulateC20H20O6[M − H]−355.1187+1.07311.1292, 267.1392, 223.1486, 189.0918, 167.0352, 123.0453AR
13712.19Senkyunolide E or isomerC12H12O3[M + H]+205.0859−0.15187.0753, 169.0634, 159.0806AES
[M − H]−203.0711+0.87182.9877, 174.0323, 160.0166AR
13812.30Soyasaponin IC48H78O18[M + H]+943.5261−0.03599.3937, 441.3727, 423.3622AR
[M − H]−941.5103−0.19795.1194, 615.3898AR
13912.74Senkyunolide E or isomerC12H12O3[M − H]−203.0712+0.93174.0321, 159.0814AR
14012.90Agroastragaloside IVC49H80O20[M − H]−987.5162+0.25-AR
14113.06Astragaloside IC45H72O16[M + H]+869.4891−0.19653.4056, 455.3528, 437.3419, 419.3309AR
14213.08Senkyunolide AC12H16O2[M + H]+193.1223−0.19175.1118, 147.1168, 137.0597, 105.0698AES
14313.18Astroolesaponins AC48H76O18[M − H]−939.4955+0.69921.4890, 613.3750, 455.3525AR
14413.329-Octadecenedioic acidC18H32O4[M − H]−311.2226+0.91293.2125, 275.2008, 223.1705AR
14513.50Isoastragaloside IC45H72O16[M + H]+869.4888−0.62653.4056, 455.3528, 437.3419, 419.3309, 217.0707, 199.0603AR
14613.80Neoastragaloside IC45H72O16[M + H]+869.4896+0.29653.4056, 455.3528, 437.3419AR
14713.909,10-dihydroxy-12Zoctadecenoic acidC18H34O4[M − H]−313.2383+1.00295.2278, 277.2173, 183.1390AES, AR
14813.9113-Hydroxy-9,11-octadecadienoic acidC18H32O3[M + H]+297.2424−0.17279.2318, 261.2215, 243.2112, 184.0993, 147.1168AES, AR
[M − H]−295.2278+0.98277.2174, 195.1391AR
14914.0510-AngeloylbutylphthalideC17H20O4[M + H]+289.1434−0.02189.0910, 171.0804AES
15014.27Capsidiol or isomerC15H24O2[M − H]−235.1703+1.01214.9946, 191.0714, 163.0767, 145.9308AR
15114.53Tokinolide CC24H28O4[M + H]+381.2061+0.22335.2009, 191.1067, 173.0961AES
15214.78Tokinolide BC24H28O4[M + H]+381.2060−0.04335.2009, 191.1067, 173.0961AES
15314.79RiligustilideC24H28O4[M + H]+381.2060−0.04191.1066, 173.0961AES
15414.79E, E′-3. 3′,8. 8′-isodiligustilideC24H26O4[M + H]+379.1904+0.04361.1801, 191.1066AES
15514.80LigustilideC12H14O2[M + H]+191.1066−0.14173.0961, 163.1118, 145.1012AES
15615.01Levistolide AC24H28O4[M + H]+381.2060−0.12191.1067, 173.0961AES
15715.06AngelicideC24H28O4[M + H]+381.2059−0.44365.9087,191.1067, 173.0961AES
15815.30Linolenic acidC18H30O2[M − H]−277.2173+1.08259.2053, 205.1598AR
15915.56QuercetinC15H10O7[M − H]−301.0356+4.22-AR
16015.57Linoleic acidC18H32O2[M − H]−279.2328+0.96261.2234, 227.1188AES, AR
16115.90Palmitic acidC16H32O2[M − H]−255.2329+1.00154.3097AR
Table 2. EC50 values of eight active compounds from DBD for relaxing uterine smooth muscle precontracted with OT (50 ng/mL) or KCl (60 mM).
Table 2. EC50 values of eight active compounds from DBD for relaxing uterine smooth muscle precontracted with OT (50 ng/mL) or KCl (60 mM).
ComponentsEC50 (μM)
(OT (50 ng/mL))		EC50 (μM)
(KCl (60 mM))
Quercetin35.498.911
Ligustilide47.2311.15
Calycosin59.8212.10
Ferulic acid>16019.80
Senkyunolide I>16081.52
Ononin>16087.73
Formononetin>160>160
Calycosin-7-O-beta-D-glucoside>160>160
EC50 values for compounds without clear concentration-dependent effects (5–160 μM) are rough estimates.
Table 3. Primer sequences.
Table 3. Primer sequences.
NameForward PrimerReverse Primer
Il6CGGAGAGGAGACTTCACAGAGGATTTCCACGATTTCCCAGAGAACA
Pgf2aGCCTTCTTGGGACTGATGCTAGCCTCCGACTTGTGAAGTG
PtgfrCAAACACAACCTGCCAGACGAGCAGAAACGATGCCTTGGA
TnfaCCCTCACACTCAGATCATCTTCTGCTACGACGTGGGCTACAG
ActbGGCTGTATTCCCCTCCATCGCCAGTTGGTAACAATGCCATGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, M.; He, T.; An, W.; Guo, P.; Zhou, T.; Chen, Y.; Tian, X.; Wu, M.; Zhang, T.; Zhang, S. Danggui Buxue Decoction and Its Active Constituents Inhibit Drug-Induced Uterine Contractions via L-Type Calcium Channels and the IP3/Ca2+ Pathway. Pharmaceuticals 2026, 19, 520. https://doi.org/10.3390/ph19030520

AMA Style

Liu M, He T, An W, Guo P, Zhou T, Chen Y, Tian X, Wu M, Zhang T, Zhang S. Danggui Buxue Decoction and Its Active Constituents Inhibit Drug-Induced Uterine Contractions via L-Type Calcium Channels and the IP3/Ca2+ Pathway. Pharmaceuticals. 2026; 19(3):520. https://doi.org/10.3390/ph19030520

Chicago/Turabian Style

Liu, Mingming, Taiping He, Wenqiao An, Pengmei Guo, Tang Zhou, Yufei Chen, Xiaojuan Tian, Mingxu Wu, Ting Zhang, and Sanyin Zhang. 2026. "Danggui Buxue Decoction and Its Active Constituents Inhibit Drug-Induced Uterine Contractions via L-Type Calcium Channels and the IP3/Ca2+ Pathway" Pharmaceuticals 19, no. 3: 520. https://doi.org/10.3390/ph19030520

APA Style

Liu, M., He, T., An, W., Guo, P., Zhou, T., Chen, Y., Tian, X., Wu, M., Zhang, T., & Zhang, S. (2026). Danggui Buxue Decoction and Its Active Constituents Inhibit Drug-Induced Uterine Contractions via L-Type Calcium Channels and the IP3/Ca2+ Pathway. Pharmaceuticals, 19(3), 520. https://doi.org/10.3390/ph19030520

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop