Kaempferol Mitigates Pseudomonas aeruginosa-Induced Acute Lung Inflammation Through Suppressing GSK3β/JNK/c-Jun Signaling Pathway and NF-κB Activation
Abstract
1. Introduction
2. Results
2.1. Network Pharmacology-Based Prediction of the Mechanisms of KP in the Treatment of P. aeruginosa Pneumonia
2.2. KP Reduces the Mortality but Has a Limited Effect on Bacterial Clearance in the Lungs of Mice
2.3. KP Dampens the P. aeruginosa-Induced Acute Lung Injury and Impairs Neutrophil Recruitment
2.4. KP Inhibits the P. aeruginosa-Induced Proinflammatory Cytokine Production in Lungs
2.5. Binding Activity of KP with GSK3β, JNK1, c-Jun, and NF-κB p65
2.6. KP Suppresses GSK3β/JNK/c-Jun Signaling Pathway and NF-κB Activation In Vivo
2.7. KP Reduces the Expression of Proinflammatory Cytokines in Macrophages During P. aeruginosa Infection
2.8. KP Inhibits the Activation of GSK3β, JNK, c-Jun, and NF-κB in Macrophages During P. aeruginosa Infection
3. Discussion
4. Materials and Methods
4.1. Target Gene Analysis of KP
4.2. Target Gene Analysis of P. aeruginosa Pneumonia
4.3. PPI Network
4.4. GO and KEGG Pathway Enrichment Analysis
4.5. Molecular Docking
4.6. Reagents
4.7. Determination of KP Content
4.8. Bacterial Culture
4.9. Animals and Drug Treatment
4.10. Lung Infection and Tissue Processing
4.11. Survival Study and Disease Scores
4.12. Histological Assessment
4.13. Protein Concentration Assay
4.14. MPO Assay
4.15. Macrophage Culture and Infection
4.16. Cell Viability Assay
4.17. Cytokine Analysis
4.18. Real-Time Quantitative PCR (RT-qPCR)
4.19. Western Blotting
4.20. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Qin, S.; Xiao, W.; Zhou, C.; Pu, Q.; Deng, X.; Lan, L.; Liang, H.; Song, X.; Wu, M. Pseudomonas aeruginosa: Pathogenesis, virulence factors, antibiotic resistance, interaction with host, technology advances and emerging therapeutics. Signal Transduct. Target. Ther. 2022, 7, 199. [Google Scholar] [CrossRef]
- Deshpande, R.; Zou, C. Pseudomonas aeruginosa Induced Cell Death in Acute Lung Injury and Acute Respiratory Distress Syndrome. Int. J. Mol. Sci. 2020, 21, 5356. [Google Scholar] [CrossRef] [PubMed]
- Jurado-Martín, I.; Sainz-Mejías, M.; McClean, S. Pseudomonas aeruginosa: An Audacious Pathogen with an Adaptable Arsenal of Virulence Factors. Int. J. Mol. Sci. 2021, 22, 3128. [Google Scholar] [CrossRef] [PubMed]
- Gonçalves-de-Albuquerque, C.F.; Silva, A.R.; Burth, P.; Rocco, P.R.; Castro-Faria, M.V.; Castro-Faria-Neto, H.C. Possible mechanisms of Pseudomonas aeruginosa-associated lung disease. Int. J. Med. Microbiol. IJMM 2016, 306, 20–28. [Google Scholar] [CrossRef] [PubMed]
- El Solh, A.A.; Alhajhusain, A. Update on the treatment of Pseudomonas aeruginosa pneumonia. J. Antimicrob. Chemother. 2009, 64, 229–238. [Google Scholar] [CrossRef]
- Bassetti, M.; Vena, A.; Russo, A.; Croxatto, A.; Calandra, T.; Guery, B. Rational approach in the management of Pseudomonas aeruginosa infections. Curr. Opin. Infect. Dis. 2018, 31, 578–586. [Google Scholar] [CrossRef]
- Pang, Z.; Raudonis, R.; Glick, B.R.; Lin, T.J.; Cheng, Z. Antibiotic resistance in Pseudomonas aeruginosa: Mechanisms and alternative therapeutic strategies. Biotechnol. Adv. 2019, 37, 177–192. [Google Scholar] [CrossRef] [PubMed]
- Thi, M.T.T.; Wibowo, D.; Rehm, B.H.A. Pseudomonas aeruginosa Biofilms. Int. J. Mol. Sci. 2020, 21, 8671. [Google Scholar] [CrossRef] [PubMed]
- Lorusso, A.B.; Carrara, J.A.; Barroso, C.D.N.; Tuon, F.F.; Faoro, H. Role of Efflux Pumps on Antimicrobial Resistance in Pseudomonas aeruginosa. Int. J. Mol. Sci. 2022, 23, 15779. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Barat, L.; Ferrer, M.; De Rosa, F.; Gabarrús, A.; Esperatti, M.; Terraneo, S.; Rinaudo, M.; Li Bassi, G.; Torres, A. Intensive care unit-acquired pneumonia due to Pseudomonas aeruginosa with and without multidrug resistance. J. Infect. 2017, 74, 142–152. [Google Scholar] [CrossRef]
- Pang, Z.; Zhu, Q. Traditional Chinese Medicine is an Alternative Therapeutic Option for Treatment of Pseudomonas aeruginosa Infections. Front. Pharmacol. 2021, 12, 737252. [Google Scholar] [CrossRef] [PubMed]
- He, Y.Q.; Zhou, C.C.; Yu, L.Y.; Wang, L.; Deng, J.L.; Tao, Y.L.; Zhang, F.; Chen, W.S. Natural product derived phytochemicals in managing acute lung injury by multiple mechanisms. Pharmacol. Res. 2021, 163, 105224. [Google Scholar] [CrossRef]
- Alam, W.; Khan, H.; Shah, M.A.; Cauli, O.; Saso, L. Kaempferol as a Dietary Anti-Inflammatory Agent: Current Therapeutic Standing. Molecules 2020, 25, 4073. [Google Scholar] [CrossRef]
- Ren, J.; Lu, Y.; Qian, Y.; Chen, B.; Wu, T.; Ji, G. Recent progress regarding kaempferol for the treatment of various diseases. Exp. Ther. Med. 2019, 18, 2759–2776. [Google Scholar] [CrossRef]
- Imran, M.; Rauf, A.; Shah, Z.A.; Saeed, F.; Imran, A.; Arshad, M.U.; Ahmad, B.; Bawazeer, S.; Atif, M.; Peters, D.G.; et al. Chemo-preventive and therapeutic effect of the dietary flavonoid kaempferol: A comprehensive review. Phytother. Res. PTR 2019, 33, 263–275. [Google Scholar] [CrossRef] [PubMed]
- Rajendran, P.; Rengarajan, T.; Nandakumar, N.; Palaniswami, R.; Nishigaki, Y.; Nishigaki, I. Kaempferol, a potential cytostatic and cure for inflammatory disorders. Eur. J. Med. Chem. 2014, 86, 103–112. [Google Scholar] [CrossRef] [PubMed]
- Bian, Y.; Lei, J.; Zhong, J.; Wang, B.; Wan, Y.; Li, J.; Liao, C.; He, Y.; Liu, Z.; Ito, K.; et al. Kaempferol reduces obesity, prevents intestinal inflammation, and modulates gut microbiota in high-fat diet mice. J. Nutr. Biochem. 2022, 99, 108840. [Google Scholar] [CrossRef] [PubMed]
- Gong, J.H.; Shin, D.; Han, S.Y.; Kim, J.L.; Kang, Y.H. Kaempferol suppresses eosionphil infiltration and airway inflammation in airway epithelial cells and in mice with allergic asthma. J. Nutr. 2012, 142, 47–56. [Google Scholar] [CrossRef]
- Liu, Z.; Yao, X.; Sun, B.; Jiang, W.; Liao, C.; Dai, X.; Chen, Y.; Chen, J.; Ding, R. Pretreatment with kaempferol attenuates microglia-mediate neuroinflammation by inhibiting MAPKs-NF-κB signaling pathway and pyroptosis after secondary spinal cord injury. Free. Radic. Biol. Med. 2021, 168, 142–154. [Google Scholar] [CrossRef]
- Cheng, X.; Yang, Y.L.; Yang, H.; Wang, Y.H.; Du, G.H. Kaempferol alleviates LPS-induced neuroinflammation and BBB dysfunction in mice via inhibiting HMGB1 release and down-regulating TLR4/MyD88 pathway. Int. Immunopharmacol. 2018, 56, 29–35. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.; Wu, Q.; Ren, Z.; Chen, B.; Wang, D.; Yuan, T.; Ding, H.; Wang, Y.; Yuan, G.; Wang, Y.; et al. Kaempferol attenuates wear particle-induced inflammatory osteolysis via JNK and p38-MAPK signaling pathways. J. Ethnopharmacol. 2024, 318, 117019. [Google Scholar] [CrossRef] [PubMed]
- Yao, H.; Sun, J.; Wei, J.; Zhang, X.; Chen, B.; Lin, Y. Kaempferol Protects Blood Vessels From Damage Induced by Oxidative Stress and Inflammation in Association with the Nrf2/HO-1 Signaling Pathway. Front. Pharmacol. 2020, 11, 1118. [Google Scholar] [CrossRef]
- Qian, J.; Chen, X.; Chen, X.; Sun, C.; Jiang, Y.; Qian, Y.; Zhang, Y.; Khan, Z.; Zhou, J.; Liang, G.; et al. Kaempferol reduces K63-linked polyubiquitination to inhibit nuclear factor-κB and inflammatory responses in acute lung injury in mice. Toxicol. Lett. 2019, 306, 53–60. [Google Scholar] [CrossRef]
- Zhang, R.; Ai, X.; Duan, Y.; Xue, M.; He, W.; Wang, C.; Xu, T.; Xu, M.; Liu, B.; Li, C.; et al. Kaempferol ameliorates H9N2 swine influenza virus-induced acute lung injury by inactivation of TLR4/MyD88-mediated NF-κB and MAPK signaling pathways. Biomed. Pharmacother. = Biomed. Pharmacother. 2017, 89, 660–672. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Yang, X.; Liu, T.; Guan, M.; Feng, X.; Dong, W.; Chu, X.; Liu, J.; Tian, X.; Ci, X.; et al. Kaempferol regulates MAPKs and NF-κB signaling pathways to attenuate LPS-induced acute lung injury in mice. Int. Immunopharmacol. 2012, 14, 209–216. [Google Scholar] [CrossRef]
- Xu, L.; Fang, J.; Ou, D.; Xu, J.; Deng, X.; Chi, G.; Feng, H.; Wang, J. Therapeutic potential of kaempferol on Streptococcus pneumoniae infection. Microbes Infect. 2023, 25, 105058. [Google Scholar] [CrossRef]
- Periferakis, A.; Periferakis, K.; Badarau, I.A.; Petran, E.M.; Popa, D.C.; Caruntu, A.; Costache, R.S.; Scheau, C.; Caruntu, C.; Costache, D.O. Kaempferol: Antimicrobial Properties, Sources, Clinical, and Traditional Applications. Int. J. Mol. Sci. 2022, 23, 15054. [Google Scholar] [CrossRef]
- Yin, N.; Yang, X.; Wang, L.; Zhang, C.; Guan, J.; Tao, Y.; Guo, X.; Zhao, Y.; Song, W.; Wang, B.; et al. Kaempferol inhibits the expression of α-hemolysin and protects mice from methicillin-resistant Staphylococcus aureus-induced lethal pneumonia. Microb. Pathog. 2022, 162, 105336. [Google Scholar] [CrossRef] [PubMed]
- Cortés-Vieyra, R.; Silva-García, O.; Gómez-García, A.; Gutiérrez-Castellanos, S.; Álvarez-Aguilar, C.; Baizabal-Aguirre, V.M. Glycogen Synthase Kinase 3β Modulates the Inflammatory Response Activated by Bacteria, Viruses, and Parasites. Front. Immunol. 2021, 12, 675751. [Google Scholar] [CrossRef]
- Takada, Y.; Fang, X.; Jamaluddin, M.S.; Boyd, D.D.; Aggarwal, B.B. Genetic deletion of glycogen synthase kinase-3beta abrogates activation of IkappaBalpha kinase, JNK, Akt, and p44/p42 MAPK but potentiates apoptosis induced by tumor necrosis factor. J. Biol. Chem. 2004, 279, 39541–39554. [Google Scholar] [CrossRef]
- Chen, K.; Fu, Q.; Ye, C.; Zhan, X.; Lu, J.; Du, M.; Feng, Y.; Liang, P.; Wang, W. The Regulating Role of SB216763 in Pseudomonas aeruginosa Keratitis. Clin. Lab. 2019, 65, 1829–1835. [Google Scholar] [CrossRef] [PubMed]
- Kwon, Y.J.; Yoon, C.H.; Lee, S.W.; Park, Y.B.; Lee, S.K.; Park, M.C. Inhibition of glycogen synthase kinase-3β suppresses inflammatory responses in rheumatoid arthritis fibroblast-like synoviocytes and collagen-induced arthritis. Jt. Bone Spine 2014, 81, 240–246. [Google Scholar] [CrossRef] [PubMed]
- Dai, J.; Guan, H.; Zhang, L.; Jiang, H.; Su, W.; Wang, J.; Jia, X.; Pang, Z. Fatty Acids Derived from Royal Jelly Exert Anti-Inflammatory and Antibacterial Activities in the Treatment of Pseudomonas aeruginosa-Induced Acute Pneumonia. J. Med. Food 2025, 28, 44–57. [Google Scholar] [CrossRef] [PubMed]
- Gu, M.; Su, W.; Dai, J.; Wang, J.; Jia, X.; Yao, J.; Zhang, G.; Zhu, Q.; Pang, Z. Jingfang granule alleviates Pseudomonas aeruginosa-induced acute lung inflammation through suppression of STAT3/IL-17/NF-κB pathway based on network pharmacology analysis and experimental validation. J. Ethnopharmacol. 2024, 318, 116899. [Google Scholar] [CrossRef]
- Jia, X.; Gu, M.; Dai, J.; Wang, J.; Zhang, Y.; Pang, Z. Quercetin attenuates Pseudomonas aeruginosa-induced acute lung inflammation by inhibiting PI3K/AKT/NF-κB signaling pathway. Inflammopharmacology 2024, 32, 1059–1076. [Google Scholar] [CrossRef] [PubMed]
- Xiao, K.; Cao, Y.; Han, Z.; Zhang, Y.; Luu, L.D.W.; Chen, L.; Yan, P.; Chen, W.; Wang, J.; Liang, Y.; et al. A pan-immune panorama of bacterial pneumonia revealed by a large-scale single-cell transcriptome atlas. Signal Transduct. Target. Ther. 2025, 10, 5. [Google Scholar] [CrossRef] [PubMed]
- Moser, C.; Jensen, P.; Thomsen, K.; Kolpen, M.; Rybtke, M.; Lauland, A.S.; Trøstrup, H.; Tolker-Nielsen, T. Immune Responses to Pseudomonas aeruginosa Biofilm Infections. Front. Immunol. 2021, 12, 625597. [Google Scholar] [CrossRef]
- McClellan, S.A.; Huang, X.; Barrett, R.P.; Lighvani, S.; Zhang, Y.; Richiert, D.; Hazlett, L.D. Matrix metalloproteinase-9 amplifies the immune response to Pseudomonas aeruginosa corneal infection. Investig. Ophthalmol. Vis. Sci. 2006, 47, 256–264. [Google Scholar] [CrossRef]
- Abdalla, M.Y.; Hoke, T.; Seravalli, J.; Switzer, B.L.; Bavitz, M.; Fliege, J.D.; Murphy, P.J.; Britigan, B.E. Pseudomonas Quinolone Signal Induces Oxidative Stress and Inhibits Heme Oxygenase-1 Expression in Lung Epithelial Cells. Infect. Immun. 2017, 85, e00176-17. [Google Scholar] [CrossRef] [PubMed]
- Hobden, J.A.; Masinick-McClellan, S.; Barrett, R.P.; Bark, K.S.; Hazlett, L.D. Pseudomonas aeruginosa keratitis in knockout mice deficient in intercellular adhesion molecule 1. Infect. Immun. 1999, 67, 972–975. [Google Scholar] [CrossRef]
- Ferreira, B.L.; Ramirez-Moral, I.; Otto, N.A.; Salomão, R.; de Vos, A.F.; van der Poll, T. The PPAR-γ agonist pioglitazone exerts proinflammatory effects in bronchial epithelial cells during acute Pseudomonas aeruginosa pneumonia. Clin. Exp. Immunol. 2022, 207, 370–377. [Google Scholar] [CrossRef] [PubMed]
- Sadikot, R.T.; Zeng, H.; Azim, A.C.; Joo, M.; Dey, S.K.; Breyer, R.M.; Peebles, R.S.; Blackwell, T.S.; Christman, J.W. Bacterial clearance of Pseudomonas aeruginosa is enhanced by the inhibition of COX-2. Eur. J. Immunol. 2007, 37, 1001–1009. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Duan, C.; Kuang, Z.; Hao, Y.; Jeffries, J.L.; Lau, G.W. Pseudomonas aeruginosa pyocyanin activates NRF2-ARE-mediated transcriptional response via the ROS-EGFR-PI3K-AKT/MEK-ERK MAP kinase signaling in pulmonary epithelial cells. PLoS ONE 2013, 8, e72528. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.W.; Jiang, Y.Z.; Hsu, C.M.; Chen, L.W. Pseudomonas aeruginosa Ventilator-Associated Pneumonia Induces Lung Injury through TNF-α/c-Jun NH2-Terminal Kinase Pathways. PLoS ONE 2017, 12, e0169267. [Google Scholar] [CrossRef] [PubMed]
- Dukhinova, M.; Kokinos, E.; Kuchur, P.; Komissarov, A.; Shtro, A. Macrophage-derived cytokines in pneumonia: Linking cellular immunology and genetics. Cytokine Growth Factor Rev. 2021, 59, 46–61. [Google Scholar] [CrossRef] [PubMed]
- Wautier, J.L.; Wautier, M.P. Vascular Permeability in Diseases. Int. J. Mol. Sci. 2022, 23, 3645. [Google Scholar] [CrossRef] [PubMed]
- Tsay, T.B.; Jiang, Y.Z.; Hsu, C.M.; Chen, L.W. Pseudomonas aeruginosa colonization enhances ventilator-associated pneumonia-induced lung injury. Respir. Res. 2016, 17, 101. [Google Scholar] [CrossRef]
- Wang, H.; Kumar, A.; Lamont, R.J.; Scott, D.A. GSK3β and the control of infectious bacterial diseases. Trends Microbiol. 2014, 22, 208–217. [Google Scholar] [CrossRef] [PubMed]
- Ko, R.; Lee, S.Y. Glycogen synthase kinase 3β in Toll-like receptor signaling. BMB Rep. 2016, 49, 305–310. [Google Scholar] [CrossRef]
- Wang, Y.M.; Gong, F.C.; Qi, X.; Zheng, Y.J.; Zheng, X.T.; Chen, Y.; Yang, Z.T.; Qing, Y.; Mao, E.Q.; Chen, E.Z. Mucin 1 Inhibits Ferroptosis and Sensitizes Vitamin E to Alleviate Sepsis-Induced Acute Lung Injury through GSK3β/Keap1-Nrf2-GPX4 Pathway. Oxid Med. Cell Longev. 2022, 2022, 2405943. [Google Scholar] [CrossRef]
- Becker, E., Jr.; Husain, M.; Bone, N.; Smith, S.; Morris, P.; Zmijewski, J.W. AMPK activation improves recovery from pneumonia-induced lung injury via reduction of er-stress and apoptosis in alveolar epithelial cells. Respir. Res. 2023, 24, 185. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.W.; Lee, J.E.; Kim, M.J.; Cho, E.G.; Cho, S.G.; Choi, E.J. Glycogen synthase kinase 3 beta is a natural activator of mitogen-activated protein kinase/extracellular signal-regulated kinase kinase kinase 1 (MEKK1). J. Biol. Chem. 2003, 278, 13995–14001. [Google Scholar] [CrossRef]
- Wilson, W., 3rd; Baldwin, A.S. Maintenance of constitutive IkappaB kinase activity by glycogen synthase kinase-3alpha/beta in pancreatic cancer. Cancer Res. 2008, 68, 8156–8163. [Google Scholar] [CrossRef]
- Schwabe, R.F.; Brenner, D.A. Role of glycogen synthase kinase-3 in TNF-alpha-induced NF-kappaB activation and apoptosis in hepatocytes. Am. J. Physiol. Gastrointest Liver Physiol. 2002, 283, G204–G211. [Google Scholar] [CrossRef] [PubMed]
- Farhadi, F.; Khameneh, B.; Iranshahi, M.; Iranshahy, M. Antibacterial activity of flavonoids and their structure-activity relationship: An update review. Phytother. Res. PTR 2019, 33, 13–40. [Google Scholar] [CrossRef] [PubMed]
- Al-Khayri, J.M.; Sahana, G.R.; Nagella, P.; Joseph, B.V.; Alessa, F.M.; Al-Mssallem, M.Q. Flavonoids as Potential Anti-Inflammatory Molecules: A Review. Molecules 2022, 27, 2901. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Cui, H.; Zhang, Y.; Xie, W.; Lin, Y.; Guo, Y.; Huang, T.; Xue, B.; Guo, W.; Huang, Z.; et al. Baicalin ameliorates multidrug-resistant Pseudomonas aeruginosa induced pulmonary inflammation in rat via arginine biosynthesis. Biomed. Pharmacother. = Biomed. Pharmacother. 2023, 162, 114660. [Google Scholar] [CrossRef] [PubMed]
- Ahn, H.I.; Jang, H.J.; Kwon, O.K.; Kim, J.H.; Oh, J.H.; Kim, S.H.; Oh, S.R.; Han, S.B.; Ahn, K.S.; Park, J.W. Quercetin Attenuates the Production of Pro-Inflammatory Cytokines in H292 Human Lung Epithelial Cells Infected with Pseudomonas aeruginosa by Modulating ExoS Production. J. Microbiol. Biotechnol. 2023, 33, 430–440. [Google Scholar] [CrossRef] [PubMed]
- Zhou, M.; Ren, H.; Han, J.; Wang, W.; Zheng, Q.; Wang, D. Protective Effects of Kaempferol against Myocardial Ischemia/Reperfusion Injury in Isolated Rat Heart via Antioxidant Activity and Inhibition of Glycogen Synthase Kinase-3β. Oxid Med. Cell Longev. 2015, 2015, 481405. [Google Scholar] [CrossRef] [PubMed]
- Karin, M.; Liu, Z.; Zandi, E. AP-1 function and regulation. Curr. Opin. Cell Biol. 1997, 9, 240–246. [Google Scholar] [CrossRef]
- Lawrence, T. The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb Perspect. Biol. 2009, 1, a001651. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.K.; Kazmierczak, B.I. Inflammation: A Double-Edged Sword in the Response to Pseudomonas aeruginosa Infection. J. Innate. Immun. 2017, 9, 250–261. [Google Scholar] [CrossRef] [PubMed]
- Jia, Y.; Li, C.; Yin, M.; Lin, J.; Zhang, L.; Li, N.; Jiang, N.; Xu, Q.; Wang, Q.; Gu, L.; et al. Kaempferol ameliorate the prognosis of Aspergillus fumigatus keratitis by reducing fungal load and inhibiting the Dectin-1 and p38 MAPK pathway. Exp. Eye Res. 2022, 216, 108960. [Google Scholar] [CrossRef]
- Li, N.; Chen, S.; Deng, W.; Gong, Z.; Guo, Y.; Zeng, S.; Xu, Q. Kaempferol Attenuates Gouty Arthritis by Regulating the Balance of Th17/Treg Cells and Secretion of IL-17. Inflammation 2023, 46, 1901–1916. [Google Scholar] [CrossRef] [PubMed]
- Wonnenberg, B.; Bischoff, M.; Beisswenger, C.; Dinh, T.; Bals, R.; Singh, B.; Tschernig, T. The role of IL-1β in Pseudomonas aeruginosa in lung infection. Cell Tissue Res. 2016, 364, 225–229. [Google Scholar] [CrossRef] [PubMed]
- Uciechowski, P.; Dempke, W.C.M. Interleukin-6: A Masterplayer in the Cytokine Network. Oncology 2020, 98, 131–137. [Google Scholar] [CrossRef] [PubMed]
- Driscoll, K.E. Macrophage inflammatory proteins: Biology and role in pulmonary inflammation. Exp. Lung Res. 1994, 20, 473–490. [Google Scholar] [CrossRef]
- Zhang, L.; Guo, Z.; Wang, Y.; Geng, J.; Han, S. The protective effect of kaempferol on heart via the regulation of Nrf2, NF-κβ, and PI3K/Akt/GSK-3β signaling pathways in isoproterenol-induced heart failure in diabetic rats. Drug Dev. Res. 2019, 80, 294–309. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Li, J.; Di, L.J. Glycogen synthesis and beyond, a comprehensive review of GSK3 as a key regulator of metabolic pathways and a therapeutic target for treating metabolic diseases. Med. Res. Rev. 2022, 42, 946–982. [Google Scholar] [CrossRef] [PubMed]
- Lauretti, E.; Dincer, O.; Praticò, D. Glycogen synthase kinase-3 signaling in Alzheimer’s disease. Biochim. Biophys. Acta. Mol. Cell Res. 2020, 1867, 118664. [Google Scholar] [CrossRef]
- Cai, X.; Zhao, Y.; Yang, Y.; Wu, X.; Zhang, L.; Ma, J.A.; Ji, J.; Boström, K.I.; Yao, Y. GSK3β Inhibition Ameliorates Atherosclerotic Calcification. Int. J. Mol. Sci. 2023, 24, 11638. [Google Scholar] [CrossRef] [PubMed]
- Tan, Z.; Boyapati, K.; Tressler, C.M.; Jenkinson, N.M.; Glunde, K. Glutamine transporter SLC38A3 promotes breast cancer metastasis via Gsk3β/β-catenin/EMT pathway. Cancer Lett. 2024, 586, 216653. [Google Scholar] [CrossRef] [PubMed]
- Liao, S.; Wu, J.; Liu, R.; Wang, S.; Luo, J.; Yang, Y.; Qin, Y.; Li, T.; Zheng, X.; Song, J.; et al. A novel compound DBZ ameliorates neuroinflammation in LPS-stimulated microglia and ischemic stroke rats: Role of Akt(Ser473)/GSK3β(Ser9)-mediated Nrf2 activation. Redox Biol. 2020, 36, 101644. [Google Scholar] [CrossRef] [PubMed]
- Matute-Bello, G.; Downey, G.; Moore, B.B.; Groshong, S.D.; Matthay, M.A.; Slutsky, A.S.; Kuebler, W.M. An official American Thoracic Society workshop report: Features and measurements of experimental acute lung injury in animals. Am. J. Respir. Cell Mol. Biol. 2011, 44, 725–738. [Google Scholar] [CrossRef] [PubMed]









| Number | UniProt ID | Target Name | Degree |
|---|---|---|---|
| 1 | P01375 | TNF | 60 |
| 2 | P00533 | EGFR | 52 |
| 3 | P31749 | AKT1 | 51 |
| 4 | P10415 | BCL2 | 50 |
| 5 | P14780 | MMP9 | 49 |
| 6 | P05412 | JUN | 47 |
| 7 | P42574 | CASP3 | 47 |
| 8 | P12931 | SRC | 45 |
| 9 | P35354 | PTGS2 | 45 |
| 10 | P03372 | ESR1 | 44 |
| 11 | P07900 | HSP90AA1 | 43 |
| 12 | P37231 | PPARG | 42 |
| 13 | P49841 | GSK3B | 38 |
| 14 | P05362 | ICAM1 | 36 |
| 15 | P09601 | HMOX1 | 36 |
| 16 | P08238 | HSP90AB1 | 36 |
| 17 | P35968 | KDR | 35 |
| 18 | Q04206 | RELA | 34 |
| 19 | P42224 | STAT1 | 34 |
| 20 | P08253 | MMP2 | 34 |
| 21 | P19320 | VCAM1 | 33 |
| 22 | P45983 | MAPK8 | 31 |
| 23 | P09874 | PARP1 | 30 |
| 24 | P05067 | APP | 29 |
| 25 | P08069 | IGF1R | 29 |
| ID | Description | Gene Ratio | p-Value | Count |
|---|---|---|---|---|
| hsa05200 | Pathways in cancer | 40.54 | 4.91 × 10−18 | 30 |
| hsa05417 | Lipid and atherosclerosis | 28.38 | 9.89 × 10−17 | 21 |
| hsa05418 | Fluid shear stress and atherosclerosis | 27.03 | 4.22 × 10−19 | 20 |
| hsa05022 | Pathways of neurodegeneration—multiple diseases | 21.62 | 3.28 × 10−6 | 16 |
| hsa04933 | AGE-RAGE signaling pathway in diabetic complications | 20.27 | 2.37 × 10−14 | 15 |
| hsa05167 | Kaposi sarcoma-associated herpesvirus infection | 20.27 | 2.33 × 10−10 | 15 |
| hsa04151 | PI3K-Akt signaling pathway | 20.27 | 5.04 × 10−7 | 15 |
| hsa05010 | Alzheimer disease | 20.27 | 1.34 × 10−6 | 15 |
| hsa04657 | IL-17 signaling pathway | 18.92 | 2.58 × 10−13 | 14 |
| hsa05161 | Hepatitis B | 18.92 | 2.96 × 10−10 | 14 |
| hsa05207 | Chemical carcinogenesis—receptor activation | 18.92 | 8.13 × 10−9 | 14 |
| hsa01522 | Endocrine resistance | 17.57 | 1.03 × 10−11 | 13 |
| hsa04668 | TNF signaling pathway | 17.57 | 6.37 × 10−11 | 13 |
| hsa05169 | Epstein–Barr virus infection | 17.57 | 4.67 × 10−8 | 13 |
| hsa05208 | Chemical carcinogenesis—reactive oxygen species | 17.57 | 1.39 × 10−7 | 13 |
| hsa05163 | Human cytomegalovirus infection | 17.57 | 1.53 × 10−7 | 13 |
| hsa04010 | MAPK signaling pathway | 17.57 | 3.53 × 10−6 | 13 |
| hsa04926 | Relaxin signaling pathway | 16.22 | 4.17 × 10−9 | 12 |
| hsa04915 | Estrogen signaling pathway | 16.22 | 8.54 × 10−9 | 12 |
| hsa05152 | Tuberculosis | 16.22 | 1.35 × 10−7 | 12 |
| Target Name | PDB ID | Protein | Binding Energy (kcal/mol) |
|---|---|---|---|
| GSK3B | 1Q5K | GSK3β | −5.44 |
| MAPK8 | 3PZE | JNK1 | −5.03 |
| JUN | 5FV8 | c-Jun | −4.18 |
| RELA | 1IKN | NF-κB p65 | −5.56 |
| Score | 0 | 1 | 2 | 3 |
|---|---|---|---|---|
| Hair feature | Normal | Lack of grooming | Rough | Very obvious rough |
| Body posture | Normal | Hunched sitting position | A hunched stance with the head lying on the ground | Prone and unable to stay in an upright posture |
| Activity/Behavior | Normal | Minor changes in behavior | Decreased activity with increased respiratory rate | Only moves when stimulated |
| Appetite | Normal | Reduced appetite | Not eating food after the last checkpoint | Not eating food for the last two checkpoints |
| Hydration | Normal | Mild dehydration | Moderate dehydration | Severe dehydration |
| Change in weight compared with pre-infection | <5.0% | <10.0% | 10.0–15.0% | >15.0% |
| Body temperature (ventral surface temperature) | 33–34 °C | 28–32.5 °C | 25–27.5 °C | <24.5 °C |
| Name | Primer Sequence (5′ → 3′) |
|---|---|
| GSK3β | F: CCCTCCACATGCTCGGATTCA |
| R: ATTGGTCTGTCCACGGTCTCC | |
| JNK1 | F: AGAAACTGTTCCCCGATGTGC |
| R: GCTGGAGAGCTTCATCTACGGA | |
| c-Jun | F: AAACTCCGAGCTGGCATCCAC |
| R: GCTGCGTTAGCATGAGTTGGC | |
| p65 (RelA) | F: TCGCCACCGGATTGAAGAGAA |
| R: CGGGGTTCAGTTGGTCCATTG | |
| β-actin | F: CATCCGTAAAGACCTCTATGCCAAC |
| R: ATGGAGCCACCGATCCACA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Zhang, L.; Fu, L.; Pang, Z. Kaempferol Mitigates Pseudomonas aeruginosa-Induced Acute Lung Inflammation Through Suppressing GSK3β/JNK/c-Jun Signaling Pathway and NF-κB Activation. Pharmaceuticals 2025, 18, 322. https://doi.org/10.3390/ph18030322
Wang J, Zhang L, Fu L, Pang Z. Kaempferol Mitigates Pseudomonas aeruginosa-Induced Acute Lung Inflammation Through Suppressing GSK3β/JNK/c-Jun Signaling Pathway and NF-κB Activation. Pharmaceuticals. 2025; 18(3):322. https://doi.org/10.3390/ph18030322
Chicago/Turabian StyleWang, Jue, Linlin Zhang, Lu Fu, and Zheng Pang. 2025. "Kaempferol Mitigates Pseudomonas aeruginosa-Induced Acute Lung Inflammation Through Suppressing GSK3β/JNK/c-Jun Signaling Pathway and NF-κB Activation" Pharmaceuticals 18, no. 3: 322. https://doi.org/10.3390/ph18030322
APA StyleWang, J., Zhang, L., Fu, L., & Pang, Z. (2025). Kaempferol Mitigates Pseudomonas aeruginosa-Induced Acute Lung Inflammation Through Suppressing GSK3β/JNK/c-Jun Signaling Pathway and NF-κB Activation. Pharmaceuticals, 18(3), 322. https://doi.org/10.3390/ph18030322

