Lycopene and Garcinia cambogia Induce White-to-Brown Adipose Differentiation: An Innovative Strategy to Curb Obesity
Abstract
1. Introduction
2. Results
2.1. LYC and GE Do Not Affect Cell Viability
2.2. LYC and GE Stimulate Trans-Differentiation from White to Brown Adipocytes
2.3. LYC and GE Stimulate the Browning Process
2.4. LYC and GE Effects on Zucker Rats Body Weight Gain and Food Intake
2.5. LYC and GE Stimulate the In Vivo Trans-Differentiation from White to Brown Adipocytes
3. Discussion
4. Material and Methods
4.1. 3T3-L1 Pre-Adipocytes Cell Differentiation and Treatments
4.2. Trypan Blue Exclusion Test of Cell Viability
4.3. MTT Assay
4.4. Oil Red O Lipid Staining and Lipid Accumulation
4.5. Real-Time Quantitative PCR Amplification
4.6. Western Blot
4.7. Experimental In Vivo Model
4.8. Morphological Analysis
4.9. Immunofluorescence Analysis
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Abdelaal, M.; Le Roux, C.W.; Docherty, N.G. Morbidity and mortality associated with obesity. Ann. Transl. Med. 2017, 5, 161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McCracken, E.; Monaghan, M.; Sreenivasan, S. Pathophysiology of the metabolic syndrome. Clin. Dermatol. 2018, 36, 14–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Susca, N.; Leone, P.; Prete, M.; Cozzio, S.; Racanelli, V. Adipose failure through adipocyte overload and autoimmunity. Autoimmun. Rev. 2023, 23, 103502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pineda, E.; Sanchez-Romero, L.M.; Brown, M.; Jaccard, A.; Jewell, J.; Galea, G.; Webber, L.; Breda, J. Forecasting Future Trends in Obesity across Europe: The Value of Improving Surveillance. Obes. Facts 2018, 11, 360–371. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Obesity and the Economics of Prevention: Fit not Fat—Italy Key Facts. 2020. Available online: https://www.oecd.org/italy/obesityandtheeconomicsofpreventionfitnotfat-italykeyfacts.htm (accessed on 6 July 2020).
- Wadden, T.A.; Tronieri, J.S.; Butryn, M.L. Lifestyle modification approaches for the treatment of obesity in adults. Am. Psychol. 2020, 75, 235–251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perdomo, C.M.; Cohen, R.V.; Sumithran, P.; Clément, K.; Frühbeck, G. Contemporary medical, device, and surgical therapies for obesity in adults. Lancet 2023, 9, 1116–1130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Müller, T.D.; Blüher, M.; Tschöp, M.H.; DiMarchi, R.D. Anti-obesity drug discovery: Advances and challenges. Nat. Rev. Drug Discov. 2022, 21, 201–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Idrees, Z.; Cancarevic, I.; Huang, L. FDA-Approved Pharmacotherapy for Weight Loss Over the Last Decade. Cureus 2022, 14, e29262. [Google Scholar] [CrossRef] [Scilit]
- Karri, S.; Sharma, S.; Hatware, K.; Patil, K. Natural anti-obesity agents and their therapeutic role in management of obesity: A future trend perspective. Biomed. Pharmacother. 2019, 110, 224–238. [Google Scholar] [CrossRef] [Scilit]
- Anilkumar, A.T.; Manoharan, S.; Balasubramanian, S.; Perumal, E. Garcinia gummi-gutta: Phytochemicals and pharmacological applications. Biofactors 2023, 49, 584–599. [Google Scholar] [CrossRef] [Scilit]
- Zhu, R.; Chen, B.; Bai, Y.; Miao, T.; Rui, L.; Zhang, H.; Xia, B.; Li, Y.; Gao, S.; Wang, X.D.; et al. Lycopene in protection against obesity and diabetes: A mechanistic review. Pharmacol. Res. 2020, 159, 104966. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Suo, Y.; Zhang, J.; Zou, Q.; Tan, X.; Yuan, T.; Liu, Z.; Liu, X. Lycopene supplementation attenuates western diet-induced body weight gain through increasing the expressions of thermogenic/mitochondrial functional genes and improving insulin resistance in the adipose tissue of obese mice. J. Nutr. Biochem. 2019, 69, 63–72. [Google Scholar] [CrossRef] [Scilit]
- Newman, D.J.; Cragg, G.M. Natural Products as Sources of New Drugs over the Nearly Four Decades from 01/1981 to 09/2019. J. Nat. Prod. 2020, 83, 770–803. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baz, L.; Algarni, S.; Al-Thepyani, M.; Aldairi, A.; Gashlan, H. Lycopene Improves Metabolic Disorders and Liver Injury Induced by a Hight-Fat Diet in Obese Rats. Molecules 2022, 27, 7736. [Google Scholar] [CrossRef] [Scilit]
- Kang, Y.G.; Lee, T.; Ro, J.; Oh, S.; Kwak, J.H.; Kim, A.R. Combination of Lactobacillus plantarum HAC03 and Garcinia cambogia Has a Significant Anti-Obesity Effect in Diet-Induced Obesity Mice. Nutrients 2023, 15, 1859. [Google Scholar] [CrossRef] [Scilit]
- Gómez-García, I.; Trepiana, J.; Fernández-Quintela, A.; Giralt, M.; Portillo, M.P. Sexual Dimorphism in Brown Adipose Tissue Activation and White Adipose Tissue Browning. Int. J. Mol. Sci. 2022, 23, 8250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lhamyani, S.; Gentile, A.M.; Mengual-Mesa, M.; Grueso, E.; Giráldez-Pérez, R.M.; Fernandez-Garcia, J.C.; Vega-Rioja, A.; Clemente-Postigo, M.; Pearson, J.R.; González-Mariscal, I.; et al. Au@16-pH-16/miR-21 mimic nanosystem: An efficient treatment for obesity through browning and thermogenesis induction. Biomed. Pharmacother. 2024, 171, 116104. [Google Scholar] [CrossRef] [Scilit]
- Di Maio, G.; Alessio, N.; Peluso, G.; Perrotta, S.; Monda, M.; Di Bernardo, G. Molecular and Physiological Effects of Browning Agents on White Adipocytes from Bone Marrow Mesenchymal Stromal Cells. Int. J. Mol. Sci. 2022, 23, 12151. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Yang, D.; Xiang, J.; Zhou, J.; Cao, H.; Che, Q.; Bai, Y.; Guo, J.; Su, Z. Non-shivering Thermogenesis Signalling Regulation and Potential Therapeutic Applications of Brown Adipose Tissue. Int. J. Biol. Sci. 2021, 17, 2853–2870. [Google Scholar] [CrossRef] [Scilit]
- Huang, J.; Zhang, Y.; Zhou, X.; Song, J.; Feng, Y.; Qiu, T.; Sheng, S.; Zhang, M.; Zhang, X.; Hao, J.; et al. Foxj3 regulates thermogenesis of brown and beige fat via induction of PGC-1α. Diabetes 2023, 73, 178–196. [Google Scholar] [CrossRef] [Scilit]
- Scheel, A.K.; Espelage, L.; Chadt, A. Many Ways to Rome: Exercise, Cold Exposure and Diet-Do They All Affect BAT Activation and WAT Browning in the Same Manner? Int. J. Mol. Sci. 2022, 23, 4759. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sui, W.; Li, H.; Yang, Y.; Jing, X.; Xue, F.; Cheng, J.; Dong, M.; Zhang, M.; Pan, H.; Chen, Y.; et al. Bladder drug mirabegron exacerbates atherosclerosis through activation of brown fat-mediated lipolysis. Proc. Natl. Acad. Sci. USA 2019, 116, 10937–10942. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krishnan, V.; Baskaran, P.; Thyagarajan, B. Troglitazone activates TRPV1 and causes deacetylation of PPARγ in 3T3-L1 cells. Biochim. Et Biophys. Acta (BBA)-Mol. Basis Dis. 2019, 1865, 445–453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Senkus, K.E.; Zhang, Y.; Wang, H.; Tan, L.; Crowe-White, K.M. Lycopene supplementation of maternal and weanling high-fat diets influences adipose tissue development and metabolic outcomes of Sprague-Dawley offspring. J. Nutr. Sci. 2021, 10, 96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, Z.; Chen, J.; Chen, C.; Feng, L.; Wang, R.; Zhu, J.; Lou, R.; Liu, J.; Ye, Y.; Lin, L. Bioactivity-based molecular networking-guided identification of guttiferone J from Garcinia cambogia as an anti-obesity candidate. Br. J. Pharmacol. 2023, 180, 589–608. [Google Scholar] [CrossRef] [Scilit]
- Zhu, R.; Wei, J.; Liu, H.; Liu, C.; Wang, L.; Chen, B.; Li, L.; Jia, Q.; Tian, Y.; Li, R.; et al. Lycopene attenuates body weight gain through induction of browning via regulation of peroxisome proliferator-activated receptor γ in high-fat diet-induced obese mice. J. Nutr. Biochem. 2020, 78, 108335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiao, Y.; Liu, L.; Gu, H.; Liang, X.; Meng, X.; Gao, J.; Xu, Y.; Nuermaimaiti, N.; Guan, Y. Ad36 promotes differentiation of hADSCs into brown adipocytes by up-regulating LncRNA ROR. Life Sci. 2021, 265, 118762. [Google Scholar] [CrossRef] [Scilit]
- Jena, B.S.; Jayaprakasha, G.K.; Singh, R.P.; Sakariah, K.K. Chemistry and biochemistry of (-)-hydroxycitric acid from Garcinia. J. Agric. Food Chem. 2002, 50, 10–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saunders, K.H.; Umashanker, D.; Igel, L.I.; Kumar, R.B.; Aronne, L.J. Obesity Pharmacotherapy. Med. Clin. 2018, 102, 135–148. [Google Scholar] [CrossRef] [Scilit]
- Ferreira-Hermosillo, A.; de Miguel Ibañez, R.; Pérez-Dionisio, E.K.; Villalobos-Mata, K.A. Obesity as a Neuroendocrine Disorder. Arch. Med. Res. 2023, 54, 102896. [Google Scholar] [CrossRef] [Scilit]
- Asghar, M.; Monjok, E.; Kouamou, G.; Ohia, S.E.; Bagchi, D.; Lokhandwala, M.F. Super CitriMax (HCA-SX) attenuates increases in oxidative stress, inflammation, insulin resistance, and body weight in developing obese Zucker rats. Mol. Cell Biochem. 2007, 304, 93–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vasques, C.A.; Schneider, R.; Klein-Júnior, L.C.; Falavigna, A.; Piazza, I.; Rossetto, S. Hypolipemic effect of Garcinia cambogia in obese women. Phytother. Res. 2014, 28, 887–891. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yao, N.; Yan, S.; Guo, Y.; Wang, H.; Li, X.; Wang, L.; Hu, W.; Li, B.; Cui, W. The association between carotenoids and subjects with overweight or obesity: A systematic review and meta-analysis. Food Funct. 2021, 12, 4768–4782. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Piacentini, N.; Trifiró, G.; Tari, M.; Moretti, S.; Arcoraci, V.; UVEC Group. Statin-macrolide interaction risk: A population-based study throughout a general practice database. Eur. J. Clin. Pharmacol. 2005, 61, 615–620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iwata, A.; Matsubara, S.; Miyazaki, K. Beneficial effects of a beta-cryptoxanthin-containing beverage on body mass index and visceral fat in pre-obese men: Double-blind, placebo-controlled parallel trials. J. Funct. Foods. 2018, 41, 250–257. [Google Scholar] [CrossRef] [Scilit]
- Pourahmadi, Z.; Mahboob, S.; Saedisomeolia, A.; Reykandeh, M.T. The Effect of Tomato Juice Consumption on Antioxidant Status in Overweight and Obese Females. Women Health 2015, 55, 795–804. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nasso, C.; Mecchio, A.; Rottura, M.; Valenzise, M.; Menniti-Ippolito, F.; Cutroneo, P.M.; Squadrito, V.; Squadrito, F.; Pallio, G.; Irrera, N.; et al. A 7-Years Active Pharmacovigilance Study of Adverse Drug Reactions Causing Children Admission to a Pediatric Emergency Department in Sicily. Front Pharmacol. 2020, 11, 1090. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, G.; Collins, J.K.; Perkins-Veazie, P.; Siddiq, M.; Dolan, K.D.; Kelly, K.A.; Heaps, C.L.; Meininger, C.J. Dietary supplementation with watermelon pomace juice enhances arginine availability and ameliorates the metabolic syndrome in Zucker diabetic fatty rats. J. Nutr. 2007, 137, 2680–2685. [Google Scholar] [CrossRef] [Scilit]
- Mannino, F.; Pallio, G.; Bitto, A.; Altavilla, D.; Minutoli, L.; Squadrito, V.; Arcoraci, V.; Giorgi, D.A.; Pirrotta, I.; Squadrito, F.; et al. Targeting Adenosine Receptor by Polydeoxyribonucleotide: An Effective Therapeutic Strategy to Induce White-to-Brown Adipose Differentiation and to Curb Obesity. Pharmaceuticals 2021, 14, 728. [Google Scholar] [CrossRef] [Scilit]
- Mannino, F.; Pallio, G.; Corsaro, R.; Minutoli, L.; Altavilla, D.; Vermiglio, G.; Allegra, A.; Eid, A.H.; Bitto, A.; Squadrito, F.; et al. Beta-Caryophyllene Exhibits Anti-Proliferative Effects through Apoptosis Induction and Cell Cycle Modulation in Multiple Myeloma Cells. Cancers 2021, 13, 5741. [Google Scholar] [CrossRef] [Scilit]
- Ceravolo, I.; Mannino, F.; Irrera, N.; Squadrito, F.; Altavilla, D.; Ceravolo, G.; Pallio, G.; Minutoli, L. Health Potential of Aloe vera against Oxidative Stress Induced Corneal Damage: An "In Vitro" Study. Antioxidants 2021, 10, 318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, Q.; Xi, P.; Tian, D.; Jia, L.; Cao, Y.; Zhan, K.; Sun, T.; Zhang, Y.; Wang, Q. Ginsenoside Rb1 Facilitates Browning by Repressing Wnt/β-Catenin Signaling in 3T3-L1 Adipocytes. Med. Sci. Monit. 2021, 27, e928619. [Google Scholar] [CrossRef] [Scilit]
- Antonuccio, P.; Micali, A.G.; Romeo, C.; Freni, J.; Vermiglio, G.; Puzzolo, D.; Squadrito, F.; Irrera, N.; Marini, H.R.; Rana, R.A.; et al. NLRP3 Inflammasome: A New Pharmacological Target for Reducing Testicular Damage Associated with Varicocele. Int. J. Mol. Sci. 2021, 22, 1319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bitto, A.; Irrera, N.; Pizzino, G.; Pallio, G.; Mannino, F.; Vaccaro, M.; Arcoraci, V.; Aliquò, F.; Minutoli, L.; Colonna, M.R.; et al. Activation of the EPOR-β common receptor complex by cibinetide ameliorates impaired wound healing in mice with genetic diabetes. Biochim. Biophys. Acta Mol. Basis Dis. 2018, 1864, 632–639. [Google Scholar] [CrossRef] [Scilit]
- Antonuccio, P.; Micali, A.; Puzzolo, D.; Romeo, C.; Vermiglio, G.; Squadrito, V.; Freni, J.; Pallio, G.; Trichilo, V.; Righi, M.; et al. Nutraceutical Effects of Lycopene in Experimental Varicocele: An “In Vivo” Model to Study Male Infertility. Nutrients 2020, 12, 1536. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Minutoli, L.; Marini, H.; Rinaldi, M.; Bitto, A.; Irrera, N.; Pizzino, G.; Pallio, G.; Calò, M.; Adamo, E.B.; Trichilo, V.; et al. A dual inhibitor of cyclooxygenase and 5-lipoxygenase protects against kainic acid-induced brain injury. Neuromolecular Med. 2015, 17, 192–201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kilkenny, C.; Browne, W.; Cuthill, I.C.; Emerson, M.; Altman, D.G. NC3Rs Reporting Guidelines Working Group. Animal research: Reporting in vivo experiments: The ARRIVE guidelines. Br. J. Pharmacol. 2010, 160, 1577–1579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cai, J.; Huang, J.; Li, D.; Zhang, X.; Shi, B.; Liu, Q.; Fang, C.; Xu, S.; Zhang, Z. Hippo-YAP/TAZ-ROS signaling axis regulates metaflammation induced by SelenoM deficiency in high-fat diet-derived obesity. J. Adv. Res. 2024, 13. [Google Scholar] [CrossRef] [Scilit]
- Scuruchi, M.; Mannino, F.; Imbesi, C.; Pallio, G.; Vermiglio, G.; Bagnato, G.; Minutoli, L.; Bitto, A.; Squadrito, F.; Irrera, N. Biglycan Involvement in Heart Fibrosis: Modulation of Adenosine 2A Receptor Improves Damage in Immortalized Cardiac Fibroblasts. Int. J. Mol. Sci. 2023, 24, 1784. [Google Scholar] [CrossRef] [Scilit]
- Cooper, A.J.; Gupta, S.R.; Moustafa, A.F.; Chao, A.M. Sex/Gender Differences in Obesity Prevalence, Comorbidities, and Treatment. Curr. Obes. Rep. 2021, 10, 458–466. [Google Scholar] [CrossRef] [Scilit]








| Gene | Species | Sequence (5′→3′) | Length | Tm | GC% |
|---|---|---|---|---|---|
| GAPDH | Mouse | F: AAGAGGGATGCTGCCCTTAC | 20 | 59.45 | 55 |
| R: CTCGTGGTTCACACCCATCA | 20 | 59.97 | 55 | ||
| UCP1 | Mouse | F: CACGGGGACCTACAATGCTT | 20 | 60.04 | 55 |
| R: ACAGTAAATGGCAGGGGACG | 20 | 60.04 | 55 | ||
| DIO2 | Mouse | F: AGAAGTCCGAAGTTGGCTGG | 20 | 59.96 | 55 |
| R: TCACACTTGGGAATTCGGGG | 20 | 59.96 | 55 | ||
| CIDEA | Mouse | F: AGAAGGTCCTACTGACCCCC | 20 | 59.96 | 60 |
| R: ACCCGGTGTCCATTTCTGTC | 20 | 59.96 | 55 | ||
| GAPDH | Rat | F: TGTGAACGGGTGAGTTCCAG | 20 | 59.89 | 55 |
| R: TACTTCGGCCACCCTATCCA | 20 | 60.03 | 55 | ||
| UCP1 | Rat | F: ATCAAACCCCGCTACACTGG | 20 | 60.04 | 55 |
| R: GCATAGGAGCCCAGCATAGG | 20 | 60.04 | 60 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mannino, F.; Arcoraci, V.; Vermiglio, G.; Labellarte, D.; Pirrotta, I.; Giorgi, D.A.; Scarfone, A.; Bitto, A.; Minutoli, L.; Vaccaro, M.; et al. Lycopene and Garcinia cambogia Induce White-to-Brown Adipose Differentiation: An Innovative Strategy to Curb Obesity. Pharmaceuticals 2024, 17, 986. https://doi.org/10.3390/ph17080986
Mannino F, Arcoraci V, Vermiglio G, Labellarte D, Pirrotta I, Giorgi DA, Scarfone A, Bitto A, Minutoli L, Vaccaro M, et al. Lycopene and Garcinia cambogia Induce White-to-Brown Adipose Differentiation: An Innovative Strategy to Curb Obesity. Pharmaceuticals. 2024; 17(8):986. https://doi.org/10.3390/ph17080986
Chicago/Turabian StyleMannino, Federica, Vincenzo Arcoraci, Giovanna Vermiglio, Davide Labellarte, Igor Pirrotta, Domenico Antonio Giorgi, Alessandro Scarfone, Alessandra Bitto, Letteria Minutoli, Mario Vaccaro, and et al. 2024. "Lycopene and Garcinia cambogia Induce White-to-Brown Adipose Differentiation: An Innovative Strategy to Curb Obesity" Pharmaceuticals 17, no. 8: 986. https://doi.org/10.3390/ph17080986
APA StyleMannino, F., Arcoraci, V., Vermiglio, G., Labellarte, D., Pirrotta, I., Giorgi, D. A., Scarfone, A., Bitto, A., Minutoli, L., Vaccaro, M., Galeano, M., Pallio, G., & Irrera, N. (2024). Lycopene and Garcinia cambogia Induce White-to-Brown Adipose Differentiation: An Innovative Strategy to Curb Obesity. Pharmaceuticals, 17(8), 986. https://doi.org/10.3390/ph17080986

