Unraveling the Hippocampal Molecular and Cellular Alterations behind Tramadol and Tapentadol Neurobehavioral Toxicity
Abstract
1. Introduction
2. Results
2.1. Repeated Exposure to Tramadol and Tapentadol Causes Oxidative Stress at the Systemic and Hippocampal Levels
2.2. Repeated Exposure to Tramadol and Tapentadol Affects Neurotoxicity and Neuromodulation Pathways
3. Discussion
4. Materials and Methods
4.1. Experimental Models and Design
4.2. Sample Collection and Processing
4.3. Quantification of Serum Oxidative Damage Parameters
4.4. Quantification of Oxidative Damage Parameters in Hippocampal DNA Samples
4.5. Quantification of Serum Biochemical Parameters
4.6. Gene Expression Analysis in the Hippocampal Formation through qRT-PCR
4.7. GFAP and CD11b Immunohistochemistry in Hippocampal Formation Sections
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Barbosa, J.; Faria, J.; Queiros, O.; Moreira, R.; Carvalho, F.; Dinis-Oliveira, R.J. Comparative metabolism of tramadol and tapentadol: A toxicological perspective. Drug Metab. Rev. 2016, 48, 577–592. [Google Scholar] [CrossRef] [Scilit]
- Trescot, A.M.; Datta, S.; Lee, M.; Hansen, H. Opioid pharmacology. Pain Physician 2008, 11, S133–S153. [Google Scholar] [CrossRef] [Scilit]
- DePriest, A.Z.; Puet, B.L.; Holt, A.C.; Roberts, A.; Cone, E.J. Metabolism and Disposition of Prescription Opioids: A Review. Forensic Sci. Rev. 2015, 27, 115–145. [Google Scholar]
- Pathan, H.; Williams, J. Basic opioid pharmacology: An update. Br. J. Pain 2012, 6, 11–16. [Google Scholar] [CrossRef] [Scilit]
- Faria, J.; Barbosa, J.; Moreira, R.; Queiros, O.; Carvalho, F.; Dinis-Oliveira, R.J. Comparative pharmacology and toxicology of tramadol and tapentadol. Eur. J. Pain 2018, 22, 827–844. [Google Scholar] [CrossRef] [Scilit]
- Alshehri, F.S. Tapentadol: A Review of Experimental Pharmacology Studies, Clinical Trials, and Recent Findings. Drug Des. Dev. Ther. 2023, 17, 851–861. [Google Scholar] [CrossRef] [Scilit]
- Grond, S.; Sablotzki, A. Clinical pharmacology of tramadol. Clin. Pharmacokinet. 2004, 43, 879–923. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barbosa, J.; Faria, J.; Leal, S.; Afonso, L.P.; Lobo, J.; Queiros, O.; Moreira, R.; Carvalho, F.; Dinis-Oliveira, R.J. Acute administration of tramadol and tapentadol at effective analgesic and maximum tolerated doses causes hepato- and nephrotoxic effects in Wistar rats. Toxicology 2017, 389, 118–129. [Google Scholar] [CrossRef] [Scilit]
- Barbosa, J.; Faria, J.; Garcez, F.; Leal, S.; Afonso, L.P.; Nascimento, A.V.; Moreira, R.; Queiros, O.; Carvalho, F.; Dinis-Oliveira, R.J. Repeated Administration of Clinical Doses of Tramadol and Tapentadol Causes Hepato- and Nephrotoxic Effects in Wistar Rats. Pharmaceuticals 2020, 13, 149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leppert, W. Tramadol as an analgesic for mild to moderate cancer pain. Pharmacol. Rep. 2009, 61, 978–992. [Google Scholar] [CrossRef] [Scilit]
- Hartrick, C.T.; Rozek, R.J. Tapentadol in pain management: A mu-opioid receptor agonist and noradrenaline reuptake inhibitor. CNS Drugs 2011, 25, 359–370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roulet, L.; Rollason, V.; Desmeules, J.; Piguet, V. Tapentadol Versus Tramadol: A Narrative and Comparative Review of Their Pharmacological, Efficacy and Safety Profiles in Adult Patients. Drugs 2021, 81, 1257–1272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barbosa, J.; Faria, J.; Garcez, F.; Leal, S.; Afonso, L.P.; Nascimento, A.V.; Moreira, R.; Pereira, F.C.; Queiros, O.; Carvalho, F.; et al. Repeated Administration of Clinically Relevant Doses of the Prescription Opioids Tramadol and Tapentadol Causes Lung, Cardiac, and Brain Toxicity in Wistar Rats. Pharmaceuticals 2021, 14, 97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Faria, J.; Barbosa, J.; Leal, S.; Afonso, L.P.; Lobo, J.; Moreira, R.; Queiros, O.; Carvalho, F.; Dinis-Oliveira, R.J. Effective analgesic doses of tramadol or tapentadol induce brain, lung and heart toxicity in Wistar rats. Toxicology 2017, 385, 38–47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghoneim, F.M.; Khalaf, H.A.; Elsamanoudy, A.Z.; Helaly, A.N. Effect of chronic usage of tramadol on motor cerebral cortex and testicular tissues of adult male albino rats and the effect of its withdrawal: Histological, immunohistochemical and biochemical study. Int. J. Clin. Exp. Pathol. 2014, 7, 7323–7341. [Google Scholar] [PubMed]
- Hussein, O.A.; Abdel Mola, A.F.; Rateb, A. Tramadol administration induced hippocampal cells apoptosis, astrogliosis, and microgliosis in juvenile and adult male mice, histological and immunohistochemical study. Ultrastruct. Pathol. 2020, 44, 81–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ali, H.A.; Afifi, M.; Saber, T.M.; Makki, A.A.; Keshta, A.T.; Baeshen, M.; Al-Farga, A. Neurotoxic, Hepatotoxic and Nephrotoxic Effects of Tramadol Administration in Rats. J. Mol. Neurosci. 2020, 70, 1934–1942. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khatmi, A.; Eskandarian Boroujeni, M.; Ezi, S.; Mirbehbahani, S.H.; Aghajanpour, F.; Soltani, R.; Meftahi, G.H.; Abdollahifar, M.A.; Hassani Moghaddam, M.; Toreyhi, H.; et al. Combined molecular, structural and memory data unravel the destructive effect of tramadol on hippocampus. Neurosci. Lett. 2022, 771, 136418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kader, G.A.; Ibrahim, M.A.; Khalifa, A.M.; Mirza, U.; Rashwan, E.K.; Abdel-Hady, Z. Evaluation of vitamin C protective effect on the cerebrocortical antioxidant defense, histopathological, pro-apoptotic p53 and anti-apoptotic Bcl2 expressions against tramadol neurotoxicity in rats. J. Chem. Neuroanat. 2021, 112, 101893. [Google Scholar] [CrossRef] [Scilit]
- Elsukary, A.E.; Helaly, A.; El Bakary, A.A.; Moustafa, M.E.; El-Kattan, M.A. Comparative Study of the Neurotoxic Effects of Pregabalin Versus Tramadol in Rats. Neurotox. Res. 2022, 40, 1427–1439. [Google Scholar] [CrossRef] [Scilit]
- Ezi, S.; Boroujeni, M.E.; Khatmi, A.; Vakili, K.; Fathi, M.; Abdollahifar, M.A.; Aghajanpour, F.; Soltani, R.; Mirbehbahani, S.H.; Khodagholi, F.; et al. Chronic Exposure to Tramadol Induces Neurodegeneration in the Cerebellum of Adult Male Rats. Neurotox. Res. 2021, 39, 1134–1147. [Google Scholar] [CrossRef] [Scilit]
- Soltani, R.; Boroujeni, M.E.; Aghajanpour, F.; Khatmi, A.; Ezi, S.; Mirbehbahani, S.H.; Abdollahifar, M.A.; Akhlaghpasand, M.; Aliaghaei, A.; Heidari, M.H. Tramadol exposure upregulated apoptosis, inflammation and autophagy in PC12 cells and rat’s striatum: An in vitro- in vivo approach. J. Chem. Neuroanat. 2020, 109, 101820. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raoofi, A.; Delbari, A.; Nasiry, D.; Golmohammadi, R.; Javadinia, S.S.; Sadrzadeh, R.; Mojadadi, M.S.; Rustamzadeh, A.; Mousavi Khaneghah, A.; Ebrahimi, V.; et al. Caffeine modulates apoptosis, oxidative stress, and inflammation damage induced by tramadol in cerebellum of male rats. J. Chem. Neuroanat. 2022, 123, 102116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taha, R.M. Histological and Immunohistochemical study on the effect of long term treatment with amadol (Tramadol Hydrochloride) on the lingual. Egypt. Dent. J. 2017, 63, 499–508. [Google Scholar] [CrossRef] [Scilit]
- Nafea, O.E.; EIKhishin, I.A.; Awad, O.A.; Mohamed, D.A. A study of the neurotoxic effects of tramadol and cannabis in adolescent male albino rats. Int. J. Sci. Rep. 2016, 2, 143–154. [Google Scholar] [CrossRef] [Scilit]
- Samaka, R.M.; Girgis, N.F.; Shams, T.M. Acute toxicity and dependence of tramadol in albino rats: Relationship of Nestin and 1255 Notch 1 as stem cell markers. J. Am. Sci. 2012, 8, 313–327. [Google Scholar]
- Atici, S.; Cinel, I.; Cinel, L.; Doruk, N.; Eskandari, G.; Oral, U. Liver and kidney toxicity in chronic use of opioids: An experimental long term treatment model. J. Biosci. 2005, 30, 245–252. [Google Scholar] [CrossRef] [Scilit]
- Awadalla, E.A.; Salah-Eldin, A.E. Molecular and histological changes in cerebral cortex and lung tissues under the effect of tramadol treatment. Biomed. Pharmacother. 2016, 82, 269–280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raj, K.; Chawla, P.; Singh, S. Neurobehavioral Consequences Associated with Long Term Tramadol Utilization and Pathological Mechanisms. CNS Neurol. Disord. Drug Targets 2019, 18, 758–768. [Google Scholar] [CrossRef] [Scilit]
- Bassiony, M.M.; Salah El-Deen, G.M.; Yousef, U.; Raya, Y.; Abdel-Ghani, M.M.; El-Gohari, H.; Atwa, S.A. Adolescent tramadol use and abuse in Egypt. Am. J. Drug Alcohol. Abuse 2015, 41, 206–211. [Google Scholar] [CrossRef] [Scilit]
- Basu, A.; Mahadevan, J.; Ithal, D.; Selvaraj, S.; Chand, P.K.; Murthy, P. Is tapentadol a potential Trojan horse in the postdextropropoxyphene era in India? Indian J. Pharmacol. 2018, 50, 44–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kathiresan, P.; Pakhre, A.; Kattula, D.; Sarkar, S. Tapentadol Dependence: A Case Series. Prim. Care Companion CNS Disord. 2019, 21, 23400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barbosa, J.; Leal, S.; Pereira, F.C.; Dinis-Oliveira, R.J.; Faria, J. Tramadol and Tapentadol Induce Conditioned Place Preference with a Differential Impact on Rewarding Memory and Incubation of Craving. Pharmaceuticals 2023, 16, 86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klenowski, P.; Morgan, M.; Bartlett, S.E. The role of delta-opioid receptors in learning and memory underlying the development of addiction. Br. J. Pharmacol. 2015, 172, 297–310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chalangal, J.; Mazid, S.; Windisch, K.; Milner, T.A. Sex differences in the rodent hippocampal opioid system following stress and oxycodone associated learning processes. Pharmacol. Biochem. Behav. 2022, 212, 173294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Borjkhani, M.; Bahrami, F.; Janahmadi, M. Computational modeling of opioid-induced synaptic plasticity in hippocampus. PLoS ONE 2018, 13, e0193410. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, H.; Dong, Z.; Jia, Y.; Mao, R.; Zhou, Q.; Yang, Y.; Wang, L.; Xu, L.; Cao, J. Opioid addiction and withdrawal differentially drive long-term depression of inhibitory synaptic transmission in the hippocampus. Sci. Rep. 2015, 5, 9666. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salter, M.W.; Stevens, B. Microglia emerge as central players in brain disease. Nat. Med. 2017, 23, 1018–1027. [Google Scholar] [CrossRef] [Scilit]
- Corkrum, M.; Araque, A. Astrocyte-neuron signaling in the mesolimbic dopamine system: The hidden stars of dopamine signaling. Neuropsychopharmacology 2021, 46, 1864–1872. [Google Scholar] [CrossRef] [Scilit]
- Lawrence, J.M.; Schardien, K.; Wigdahl, B.; Nonnemacher, M.R. Roles of neuropathology-associated reactive astrocytes: A systematic review. Acta Neuropathol. Commun. 2023, 11, 42. [Google Scholar] [CrossRef] [Scilit]
- Ghazavi, A.; Mosayebi, G.; Solhi, H.; Rafiei, M.; Moazzeni, S.M. Serum markers of inflammation and oxidative stress in chronic opium (Taryak) smokers. Immunol. Lett. 2013, 153, 22–26. [Google Scholar] [CrossRef] [Scilit]
- Tobore, T.O. Towards a Comprehensive Theory of Non-Cancer Acute and Chronic Pain Management: The Critical Role of Reactive Oxygen and Nitrogen Species in Pain, and Opioid Dependence, Addiction, Hyperalgesia, and Tolerance. Adv. Redox Res. 2021, 2, 100003. [Google Scholar] [CrossRef] [Scilit]
- Skrabalova, J.; Drastichova, Z.; Novotny, J. Morphine as a Potential Oxidative Stress-Causing Agent. Mini-Rev. Org. Chem. 2013, 10, 367–372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salarian, A.; Kadkhodaee, M.; Zahmatkesh, M.; Seifi, B.; Bakhshi, E.; Akhondzadeh, S.; Adeli, S.; Askari, H.; Arbabi, M. Opioid Use Disorder Induces Oxidative Stress and Inflammation: The Attenuating Effect of Methadone Maintenance Treatment. Iran. J. Psychiatry 2018, 13, 46–54. [Google Scholar] [PubMed]
- Rullo, L.; Caputi, F.F.; Losapio, L.M.; Morosini, C.; Posa, L.; Canistro, D.; Vivarelli, F.; Romualdi, P.; Candeletti, S. Effects of Different Opioid Drugs on Oxidative Status and Proteasome Activity in SH-SY5Y Cells. Molecules 2022, 27, 8321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chiang, F.F.; Chao, T.H.; Huang, S.C.; Cheng, C.H.; Tseng, Y.Y.; Huang, Y.C. Cysteine Regulates Oxidative Stress and Glutathione-Related Antioxidative Capacity before and after Colorectal Tumor Resection. Int. J. Mol. Sci. 2022, 23, 9581. [Google Scholar] [CrossRef] [Scilit]
- Perna, A.F.; Ingrosso, D.; De Santo, N.G. Homocysteine and oxidative stress. Amino Acids 2003, 25, 409–417. [Google Scholar] [CrossRef] [Scilit]
- Meiser, J.; Weindl, D.; Hiller, K. Complexity of dopamine metabolism. Cell Commun. Signal. 2013, 11, 34. [Google Scholar] [CrossRef] [Scilit]
- Sprague, J.E.; Leifheit, M.; Selken, J.; Milks, M.M.; Kinder, D.H.; Nichols, D.E. In vivo microdialysis and conditioned place preference studies in rats are consistent with abuse potential of tramadol. Synapse 2002, 43, 118–121. [Google Scholar] [CrossRef] [Scilit]
- Faria, J.; Barbosa, J.; Queiros, O.; Moreira, R.; Carvalho, F.; Dinis-Oliveira, R.J. Comparative study of the neurotoxicological effects of tramadol and tapentadol in SH-SY5Y cells. Toxicology 2016, 359–360, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Zhuo, H.Q.; Huang, L.; Huang, H.Q.; Cai, Z. Effects of chronic tramadol exposure on the zebrafish brain: A proteomic study. J. Proteom. 2012, 75, 3351–3364. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, M.A.; Ibrahim, H.M.; Mohamed, A.A.; Tammam, H.G. Vitamin E supplementation ameliorates the hepatotoxicity induced by Tramadol: Toxicological, histological and immunohistochemical study. Toxicol. Mech. Methods 2020, 30, 177–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, J.; Yuan, X.; Qu, H.; Zhang, J.; Wang, D.; Sun, X.; Zheng, Q. The role of reactive oxygen species in morphine addiction of SH-SY5Y cells. Life Sci. 2015, 124, 128–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Samarghandian, S.; Afshari, R.; Farkhondeh, T. Effect of long-term treatment of morphine on enzymes, oxidative stress indices and antioxidant status in male rat liver. Int. J. Clin. Exp. Med. 2014, 7, 1449–1453. [Google Scholar]
- Zhang, Y.T.; Zheng, Q.S.; Pan, J.; Zheng, R.L. Oxidative damage of biomolecules in mouse liver induced by morphine and protected by antioxidants. Basic Clin. Pharmacol. Toxicol. 2004, 95, 53–58. [Google Scholar] [CrossRef] [Scilit]
- Othman, G.Q. Evaluation of Oxidative Markers, Apoptosis and Reproductive Efficiency in Heroin Addicted Rats. IOSR J. Pharm. 2013, 3, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Absinta, M.; Maric, D.; Gharagozloo, M.; Garton, T.; Smith, M.D.; Jin, J.; Fitzgerald, K.C.; Song, A.; Liu, P.; Lin, J.P.; et al. A lymphocyte-microglia-astrocyte axis in chronic active multiple sclerosis. Nature 2021, 597, 709–714. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raghu, G.; Berk, M.; Campochiaro, P.A.; Jaeschke, H.; Marenzi, G.; Richeldi, L.; Wen, F.Q.; Nicoletti, F.; Calverley, P.M.A. The Multifaceted Therapeutic Role of N-Acetylcysteine (NAC) in Disorders Characterized by Oxidative Stress. Curr. Neuropharmacol. 2021, 19, 1202–1224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trivedi, M.; Shah, J.; Hodgson, N.; Byun, H.M.; Deth, R. Morphine induces redox-based changes in global DNA methylation and retrotransposon transcription by inhibition of excitatory amino acid transporter type 3-mediated cysteine uptake. Mol. Pharmacol. 2014, 85, 747–757. [Google Scholar] [CrossRef] [Scilit]
- Jiao, Y.; Ma, S.; Li, J.; Shan, L.; Wang, Y.; Tian, M.; Yang, Y.; Sun, J.; Ban, J.; Chen, J. N-Acetyl Cysteine (NAC)-Directed Detoxification of Methacryloxylethyl Cetyl Ammonium Chloride (DMAE-CB). PLoS ONE 2015, 10, e0135815. [Google Scholar] [CrossRef] [Scilit]
- Asevedo, E.; Mendes, A.C.; Berk, M.; Brietzke, E. Systematic review of N-acetylcysteine in the treatment of addictions. Braz. J. Psychiatry 2014, 36, 168–175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gray, K.M.; Sonne, S.C.; McClure, E.A.; Ghitza, U.E.; Matthews, A.G.; McRae-Clark, A.L.; Carroll, K.M.; Potter, J.S.; Wiest, K.; Mooney, L.J.; et al. A randomized placebo-controlled trial of N-acetylcysteine for cannabis use disorder in adults. Drug Alcohol. Depend. 2017, 177, 249–257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Squeglia, L.M.; Baker, N.L.; McClure, E.A.; Tomko, R.L.; Adisetiyo, V.; Gray, K.M. Alcohol use during a trial of N-acetylcysteine for adolescent marijuana cessation. Addict. Behav. 2016, 63, 172–177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohammadi, N.; Shirian, S.; Gorji, A.; Mohsen, R.; Ahmadi, E.; Nazari, H.; Arezoomandan, R. The potential protective effect of melatonin and N-acetylcysteine alone and in combination on opioid-induced testicular dysfunction and degeneration in rat. Reprod. Toxicol. 2023, 120, 108453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ward, P.; Moss, H.G.; Brown, T.R.; Kalivas, P.; Jenkins, D.D. N-acetylcysteine mitigates acute opioid withdrawal behaviors and CNS oxidative stress in neonatal rats. Pediatr. Res. 2020, 88, 77–84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trivedi, M.S.; Deth, R. Redox-based epigenetic status in drug addiction: A potential contributor to gene priming and a mechanistic rationale for metabolic intervention. Front. Neurosci. 2014, 8, 444. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baghishani, F.; Mohammadipour, A.; Hosseinzadeh, H.; Hosseini, M.; Ebrahimzadeh-Bideskan, A. The effects of tramadol administration on hippocampal cell apoptosis, learning and memory in adult rats and neuroprotective effects of crocin. Metab. Brain Dis. 2018, 33, 907–916. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karolczak, K.; Watala, C. Melatonin as a Reducer of Neuro- and Vasculotoxic Oxidative Stress Induced by Homocysteine. Antioxidants 2021, 10, 1178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cecchini, M.S.; Bourckhardt, G.F.; Jaramillo, M.L.; Ammar, D.; Muller, Y.M.R.; Nazari, E.M. Exposure to homocysteine leads to cell cycle damage and reactive gliosis in the developing brain. Reprod. Toxicol. 2019, 87, 60–69. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.; Dong, Z.; Cheng, M.; Zhao, Y.; Wang, M.; Sai, N.; Wang, X.; Liu, H.; Huang, G.; Zhang, X. Homocysteine exaggerates microglia activation and neuroinflammation through microglia localized STAT3 overactivation following ischemic stroke. J. Neuroinflamm. 2017, 14, 187. [Google Scholar] [CrossRef] [Scilit]
- Elsherbiny, N.M.; Sharma, I.; Kira, D.; Alhusban, S.; Samra, Y.A.; Jadeja, R.; Martin, P.; Al-Shabrawey, M.; Tawfik, A. Homocysteine Induces Inflammation in Retina and Brain. Biomolecules 2020, 10, 393. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zou, C.G.; Zhao, Y.S.; Gao, S.Y.; Li, S.D.; Cao, X.Z.; Zhang, M.; Zhang, K.Q. Homocysteine promotes proliferation and activation of microglia. Neurobiol. Aging 2010, 31, 2069–2079. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alkaissi, H.; McFarlane, S.I. Hyperhomocysteinemia and Accelerated Aging: The Pathogenic Role of Increased Homocysteine in Atherosclerosis, Osteoporosis, and Neurodegeneration. Cureus 2023, 15, e42259. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moretti, R.; Giuffre, M.; Caruso, P.; Gazzin, S.; Tiribelli, C. Homocysteine in Neurology: A Possible Contributing Factor to Small Vessel Disease. Int. J. Mol. Sci. 2021, 22, 2051. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khayati, K.; Antikainen, H.; Bonder, E.M.; Weber, G.F.; Kruger, W.D.; Jakubowski, H.; Dobrowolski, R. The amino acid metabolite homocysteine activates mTORC1 to inhibit autophagy and form abnormal proteins in human neurons and mice. FASEB J. 2017, 31, 598–609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seshadri, S.; Beiser, A.; Selhub, J.; Jacques, P.F.; Rosenberg, I.H.; D’Agostino, R.B.; Wilson, P.W.; Wolf, P.A. Plasma homocysteine as a risk factor for dementia and Alzheimer’s disease. N. Engl. J. Med. 2002, 346, 476–483. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeng, P.; Shi, Y.; Wang, X.M.; Lin, L.; Du, Y.J.; Tang, N.; Wang, Q.; Fang, Y.Y.; Wang, J.Z.; Zhou, X.W.; et al. Emodin Rescued Hyperhomocysteinemia-Induced Dementia and Alzheimer’s Disease-like Features in Rats. Int. J. Neuropsychopharmacol. 2019, 22, 57–70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leon, M.; Sawmiller, D.; Shytle, R.D.; Tan, J. Therapeutic Cocktail Approach for Treatment of Hyperhomocysteinemia in Alzheimer’s Disease. Cell Med. 2018, 10, 2155179017722280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garcia, A.; Zanibbi, K. Homocysteine and cognitive function in elderly people. CMAJ 2004, 171, 897–904. [Google Scholar] [CrossRef] [Scilit]
- Channer, B.; Matt, S.M.; Nickoloff-Bybel, E.A.; Pappa, V.; Agarwal, Y.; Wickman, J.; Gaskill, P.J. Dopamine, Immunity, and Disease. Pharmacol. Rev. 2023, 75, 62–158. [Google Scholar] [CrossRef] [Scilit]
- Turk, A.Z.; Lotfi Marchoubeh, M.; Fritsch, I.; Maguire, G.A.; SheikhBahaei, S. Dopamine, vocalization, and astrocytes. Brain Lang. 2021, 219, 104970. [Google Scholar] [CrossRef] [Scilit]
- Pontieri, F.E.; Tanda, G.; Di Chiara, G. Intravenous cocaine, morphine, and amphetamine preferentially increase extracellular dopamine in the “shell” as compared with the “core” of the rat nucleus accumbens. Proc. Natl. Acad. Sci. USA 1995, 92, 12304–12308. [Google Scholar] [CrossRef] [Scilit]
- Volkow, N.D.; Fowler, J.S.; Wang, G.J.; Baler, R.; Telang, F. Imaging dopamine’s role in drug abuse and addiction. Neuropharmacology 2009, 56 (Suppl. 1), 3–8. [Google Scholar] [CrossRef] [Scilit]
- Mazzeo, F.; Meccariello, R.; Guatteo, E. Molecular and Epigenetic Aspects of Opioid Receptors in Drug Addiction and Pain Management in Sport. Int. J. Mol. Sci. 2023, 24, 7831. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Browne, C.J.; Godino, A.; Salery, M.; Nestler, E.J. Epigenetic Mechanisms of Opioid Addiction. Biol. Psychiatry 2020, 87, 22–33. [Google Scholar] [CrossRef] [Scilit]
- Marie-Claire, C.; Jourdaine, C.; Lepine, J.P.; Bellivier, F.; Bloch, V.; Vorspan, F. Pharmacoepigenomics of opiates and methadone maintenance treatment: Current data and perspectives. Pharmacogenomics 2017, 18, 1359–1372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hosseini-Sharifabad, A.; Rabbani, M.; Sharifzadeh, M.; Bagheri, N. Acute and chronic tramadol administration impair spatial memory in rat. Res. Pharm. Sci. 2016, 11, 49–57. [Google Scholar] [PubMed]
- De Deurwaerdere, P.; Di Giovanni, G. Serotonin in Health and Disease. Int. J. Mol. Sci. 2020, 21, 3500. [Google Scholar] [CrossRef] [Scilit]
- Slifirski, G.; Krol, M.; Turlo, J. 5-HT Receptors and the Development of New Antidepressants. Int. J. Mol. Sci. 2021, 22, 9015. [Google Scholar] [CrossRef] [Scilit]
- Jafari-Sabet, M.; Nemati, S.; Torab, M. Cross state-dependency of learning between 5-HT1A and/or 5-HT7 receptor agonists and muscimol in the mouse dorsal hippocampus. J. Psychopharmacol. 2019, 33, 722–736. [Google Scholar] [CrossRef] [Scilit]
- Reichenbach, N.; Delekate, A.; Plescher, M.; Schmitt, F.; Krauss, S.; Blank, N.; Halle, A.; Petzold, G.C. Inhibition of Stat3-mediated astrogliosis ameliorates pathology in an Alzheimer’s disease model. EMBO Mol. Med. 2019, 11, e9665. [Google Scholar] [CrossRef] [Scilit]
- Toral-Rios, D.; Patino-Lopez, G.; Gomez-Lira, G.; Gutierrez, R.; Becerril-Perez, F.; Rosales-Cordova, A.; Leon-Contreras, J.C.; Hernandez-Pando, R.; Leon-Rivera, I.; Soto-Cruz, I.; et al. Activation of STAT3 Regulates Reactive Astrogliosis and Neuronal Death Induced by AbetaO Neurotoxicity. Int. J. Mol. Sci. 2020, 21, 7458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mizuguchi, H.; Kitamura, Y.; Takeda, N.; Fukui, H. Molecular Signaling and Transcriptional Regulation of Histamine H(1) Receptor Gene. Curr. Top. Behav. Neurosci. 2022, 59, 91–110. [Google Scholar] [CrossRef] [Scilit]
- Reid, K.Z.; Lemezis, B.M.; Hou, T.C.; Chen, R. Epigenetic Modulation of Opioid Receptors by Drugs of Abuse. Int. J. Mol. Sci. 2022, 23, 11804. [Google Scholar] [CrossRef] [Scilit]
- Jafari-Sabet, M.; Mofidi, H.; Attarian-Khosroshahi, M.S. NMDA receptors in the dorsal hippocampal area are involved in tramadol state-dependent memory of passive avoidance learning in mice. Can. J. Physiol. Pharmacol. 2018, 96, 45–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palmer, C.B.; Meyrath, M.; Canals, M.; Kostenis, E.; Chevigne, A.; Szpakowska, M. Atypical opioid receptors: Unconventional biology and therapeutic opportunities. Pharmacol. Ther. 2022, 233, 108014. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Edinoff, A.; Sathivadivel, N.; McBride, T.; Parker, A.; Okeagu, C.; Kaye, A.D.; Kaye, A.M.; Kaye, J.S.; Kaye, R.J.; Sheth, M.M.; et al. Chronic Pain Treatment Strategies in Parkinson’s Disease. Neurol. Int. 2020, 12, 61–76. [Google Scholar] [CrossRef] [Scilit]
- Lopez, D.E.; Ballaz, S.J. The Role of Brain Cyclooxygenase-2 (Cox-2) Beyond Neuroinflammation: Neuronal Homeostasis in Memory and Anxiety. Mol. Neurobiol. 2020, 57, 5167–5176. [Google Scholar] [CrossRef] [Scilit]
- Bernal-Chico, A.; Tepavcevic, V.; Manterola, A.; Utrilla, C.; Matute, C.; Mato, S. Endocannabinoid signaling in brain diseases: Emerging relevance of glial cells. Glia 2023, 71, 103–126. [Google Scholar] [CrossRef] [Scilit]
- Hashimotodani, Y.; Ohno-Shosaku, T.; Kano, M. Endocannabinoids and synaptic function in the CNS. Neuroscientist 2007, 13, 127–137. [Google Scholar] [CrossRef] [Scilit]
- Wilson, R.I.; Nicoll, R.A. Endocannabinoid signaling in the brain. Science 2002, 296, 678–682. [Google Scholar] [CrossRef] [Scilit]
- Winters, B.L.; Vaughan, C.W. Mechanisms of endocannabinoid control of synaptic plasticity. Neuropharmacology 2021, 197, 108736. [Google Scholar] [CrossRef] [Scilit]
- Yu, P.C.; Hao, C.Y.; Fan, Y.Z.; Liu, D.; Qiao, Y.F.; Yao, J.B.; Li, C.Z.; Yu, Y. Altered Membrane Expression and Function of CD11b Play a Role in the Immunosuppressive Effects of Morphine on Macrophages at the Nanomolar Level. Pharmaceuticals 2023, 16, 282. [Google Scholar] [CrossRef] [Scilit]
- Shan, F.; Long, Y.; Qiu, W. Autoimmune Glial Fibrillary Acidic Protein Astrocytopathy: A Review of the Literature. Front. Immunol. 2018, 9, 2802. [Google Scholar] [CrossRef] [Scilit]
- Krcevski Skvarc, N.; Morlion, B.; Vowles, K.E.; Bannister, K.; Buchsner, E.; Casale, R.; Chenot, J.F.; Chumbley, G.; Drewes, A.M.; Dom, G.; et al. European clinical practice recommendations on opioids for chronic noncancer pain—Part 2: Special situations. Eur. J. Pain 2021, 25, 969–985. [Google Scholar] [CrossRef] [Scilit]
- Freynhagen, R.; Elling, C.; Radic, T.; Sohns, M.; Liedgens, H.; James, D.; McCool, R.; Edwards, M. Safety of tapentadol compared with other opioids in chronic pain treatment: Network meta-analysis of randomized controlled and withdrawal trials. Curr. Med. Res. Opin. 2021, 37, 89–100. [Google Scholar] [CrossRef] [Scilit]
- Hauser, W.; Morlion, B.; Vowles, K.E.; Bannister, K.; Buchser, E.; Casale, R.; Chenot, J.F.; Chumbley, G.; Drewes, A.M.; Dom, G.; et al. European* clinical practice recommendations on opioids for chronic noncancer pain—Part 1: Role of opioids in the management of chronic noncancer pain. Eur. J. Pain 2021, 25, 949–968. [Google Scholar] [CrossRef] [Scilit]
- Nafziger, A.N.; Barkin, R.L. Opioid Therapy in Acute and Chronic Pain. J. Clin. Pharmacol. 2018, 58, 1111–1122. [Google Scholar] [CrossRef] [Scilit]
- O’Brien, T.; Christrup, L.L.; Drewes, A.M.; Fallon, M.T.; Kress, H.G.; McQuay, H.J.; Mikus, G.; Morlion, B.J.; Perez-Cajaraville, J.; Pogatzki-Zahn, E.; et al. European Pain Federation position paper on appropriate opioid use in chronic pain management. Eur. J. Pain 2017, 21, 3–19. [Google Scholar] [CrossRef] [Scilit]
- Langnaese, K.; John, R.; Schweizer, H.; Ebmeyer, U.; Keilhoff, G. Selection of reference genes for quantitative real-time PCR in a rat asphyxial cardiac arrest model. BMC Mol. Biol. 2008, 9, 53. [Google Scholar] [CrossRef] [Scilit]
- Nergiz, I.; Baseskioglu, B.; Yenilmez, A.; Erkasap, N.; Can, C.; Tosun, M. Effects of rotenone on inducible nitric oxide synthase and cyclooxygenase-2 mRNA levels detected by real-time PCR in a rat bladder ischemia/reperfusion model. Exp. Ther. Med. 2012, 4, 344–348. [Google Scholar] [CrossRef] [Scilit]
- He, X.; Sun, J.; Huang, X. Expression of caspase-3, Bax and Bcl-2 in hippocampus of rats with diabetes and subarachnoid hemorrhage. Exp. Ther. Med. 2018, 15, 873–877. [Google Scholar] [CrossRef] [Scilit]
- Kosuth, J.; Farkasovska, M.; Mochnacky, F.; Daxnerova, Z.; Sevc, J. Selection of Reliable Reference Genes for Analysis of Gene Expression in Spinal Cord during Rat Postnatal Development and after Injury. Brain Sci. 2019, 10, 6. [Google Scholar] [CrossRef] [Scilit]
- Wu, B.; Hand, W.; Alexov, E. Opioid Addiction and Opioid Receptor Dimerization: Structural Modeling of the OPRD1 and OPRM1 Heterodimer and Its Signaling Pathways. Int. J. Mol. Sci. 2021, 22, 10290. [Google Scholar] [CrossRef] [Scilit]
- Tan, L.H.; Li, K.G.; Wu, Y.Y.; Guo, M.W.; Lan, Y.; Wang, S.; Zhu, W.L.; Ren, X.X. Effect of Electroacupuncture at Different Acupoints on the Expression of NMDA Receptors in ACC and Colon in IBS Rats. Evid. Based Complement. Altern. Med. 2019, 2019, 4213928. [Google Scholar] [CrossRef] [Scilit]
- Zhou, L.; Zhou, W.; Zhang, S.; Liu, B.; Leng, Y.; Zhou, R.; Kong, W. Changes in Histamine Receptors (H1, H2, and H3) Expression in Rat Medial Vestibular Nucleus and Flocculus after Unilateral Labyrinthectomy: Histamine Receptors in Vestibular Compensation. PLoS ONE 2013, 8, e66684. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.N.; Sha, H.H.; Wang, Y.W.; Zhou, Q.; Bhuiyan, P.; Li, N.N.; Qian, Y.N.; Dong, H.Q. Histamine 2/3 receptor agonists alleviate perioperative neurocognitive disorders by inhibiting microglia activation through the PI3K/AKT/FoxO1 pathway in aged rats. J. Neuroinflamm. 2020, 17, 217. [Google Scholar] [CrossRef] [Scilit]
- Leon-Ponte, M.; Ahern, G.P.; O’Connell, P.J. Serotonin provides an accessory signal to enhance T-cell activation by signaling through the 5-HT7 receptor. Blood 2007, 109, 3139–3146. [Google Scholar] [CrossRef] [Scilit]
- Bazwinsky-Wutschke, I.; Zipprich, A.; Dehghani, F. Daytime-Dependent Changes of Cannabinoid Receptor Type 1 and Type 2 Expression in Rat Liver. Int. J. Mol. Sci. 2017, 18, 1844. [Google Scholar] [CrossRef] [Scilit]
- Hafez, M.M.; Al-Harbi, N.O.; Al-Hoshani, A.R.; Al-Hosaini, K.A.; Al Shrari, S.D.; Al Rejaie, S.S.; Sayed-Ahmed, M.M.; Al-Shabanah, O.A. Hepato-protective effect of rutin via IL-6/STAT3 pathway in CCl4-induced hepatotoxicity in rats. Biol. Res. 2015, 48, 30. [Google Scholar] [CrossRef] [Scilit]
- Thomas, K.C.; Zheng, X.F.; Garces Suarez, F.; Raftery, J.M.; Quinlan, K.G.; Yang, N.; North, K.N.; Houweling, P.J. Evidence based selection of commonly used RT-qPCR reference genes for the analysis of mouse skeletal muscle. PLoS ONE 2014, 9, e88653. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zare, M.; Nayebifar, S.; Aminizadeh, S.; Vahidian-Rezazadeh, M. The Effects of Six Weeks of Endurance Training and CGRP Inhibition on Nrf2 and AKT Expression in the Hippocampal Tissue of Male Wistar Rats. Mediat. Inflamm. 2022, 2022, 1610293. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene | Primer | Nucleotide Sequence (5′ → 3′) | References |
|---|---|---|---|
| ITGAM [cluster of differentiation molecule 11b (CD11b)] | Fw | CTGCCTCAGGGATCCGTAAAG | [110] |
| Rev | CCTCTGCCTCAGGAATGACATC | ||
| PTGS2 [cyclooxygenase-2 (COX-2)] | Fw | TGCGATGCTCTTCCGAGCTGTGCT | [111] |
| Rev | TCAGGAAGTTCCTTATTTCCTTTC | ||
| CASP3 (caspase-3) | Fw | GTGGAACTGACGATGATATGGC | [112] |
| Rev | CGCAAAGTGACTGGATGAACC | ||
| GFAP (glial fibrillary acidic protein) | Fw | CACTCAGTACGAGGCAGTGG- | [113] |
| Rev | ACTCAAGGTCGCAGGTCAAG | ||
| OPRM1 (µ-opioid receptor 1) | Fw | AATCGTCAACGTCTGCAACTGG | [114] |
| Rev | GAACGTGAGGGTGCAATCTATGG | ||
| NMDAR1 (N-methyl-d-aspartate receptor subunit 1) | Fw | GCTGTACCTGCTGGACCGCT | [115] |
| Rev | GCAGTGTAGGAAGCCACTATGATC | ||
| HRH1 (histamine H1 receptor) | Fw | CTGGTCACAGTGGGCCTCAA | [116] |
| Rev | CTGCCACAGACAGGCTGACAA | ||
| HTR1A (5-hydroxytryptamine receptor 1A) | Fw | TCCGACGTGACCTTCAGCTA | [117] |
| Rev | GCCAAGGAGCCGATGAGATA | ||
| HTR7 (5-hydroxytryptamine receptor 7) | Fw | CCGTGAGGCAGAATGGGAAATGTAT | [118] |
| Rev | CACTGCGGTGGAGTAGATCGTGTAGC | ||
| CNR1 (cannabinoid receptor 1) | Fw | AGGAGCAAGGACCTGAGACA | [119] |
| Rev | TAACGGTGCTCTTGATGCAG | ||
| STAT3 (signal transducer and activator of transcription protein 3) | Fw | CAAAGAAAACATGGCCGGCA | [120] |
| Rev | GGGGGCTTTGTGCTTAGGAT | ||
| 18S rRNA (18S subunit of ribosomal RNA) | Fw | GCAATTATTCCCCATGAACG | [121,122] |
| Rev | GGCCTCACTAAACCATCCAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Soares-Cardoso, C.; Leal, S.; Sá, S.I.; Dantas-Barros, R.; Dinis-Oliveira, R.J.; Faria, J.; Barbosa, J. Unraveling the Hippocampal Molecular and Cellular Alterations behind Tramadol and Tapentadol Neurobehavioral Toxicity. Pharmaceuticals 2024, 17, 796. https://doi.org/10.3390/ph17060796
Soares-Cardoso C, Leal S, Sá SI, Dantas-Barros R, Dinis-Oliveira RJ, Faria J, Barbosa J. Unraveling the Hippocampal Molecular and Cellular Alterations behind Tramadol and Tapentadol Neurobehavioral Toxicity. Pharmaceuticals. 2024; 17(6):796. https://doi.org/10.3390/ph17060796
Chicago/Turabian StyleSoares-Cardoso, Cristiana, Sandra Leal, Susana I. Sá, Rita Dantas-Barros, Ricardo Jorge Dinis-Oliveira, Juliana Faria, and Joana Barbosa. 2024. "Unraveling the Hippocampal Molecular and Cellular Alterations behind Tramadol and Tapentadol Neurobehavioral Toxicity" Pharmaceuticals 17, no. 6: 796. https://doi.org/10.3390/ph17060796
APA StyleSoares-Cardoso, C., Leal, S., Sá, S. I., Dantas-Barros, R., Dinis-Oliveira, R. J., Faria, J., & Barbosa, J. (2024). Unraveling the Hippocampal Molecular and Cellular Alterations behind Tramadol and Tapentadol Neurobehavioral Toxicity. Pharmaceuticals, 17(6), 796. https://doi.org/10.3390/ph17060796

