Modulation of FOXP3 Gene Expression in OVCAR3 Cells Following Rosmarinic Acid and Doxorubicin Exposure
Abstract
1. Introduction
2. Results
2.1. Cell Viability and Inhibitory Concentration
2.2. Cell Migration Findings
2.3. Apoptotic Findings
2.4. qRT-PCR (FOXP3, CASP3) Findings
2.5. PPI Analysis Findings
2.6. KEGG Enrichment Analysis
2.7. GO Functional Enrichment Analysis Findings
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Cell Viability
4.3. Cell Migration
4.4. Apoptotic Staining
4.5. Gene Expression
- FOXP3: F: GTGGCCCGGATGTGAGAAG, R: GGAGCCCTTGTCGGATGATG
- CASP3: F: GGTATTGAGACAGACAGTGG, R: CATGGGATCTGTTTCTTTGC
- β-Actin: F: CCTCTGAACCCTAAGGCCAAC, R: TGCCACAGGATTCCATACCC
- GAPDH; F: CGGAGTCAACGGATTTGGTCGTAT, R: GCCTTCTCCATGGTGGTGAAGAC
4.6. Protein–Protein Interaction (PPI)
4.7. Enrichment Analysis
4.8. Gene Ontologies (GOs)
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kuroki, L.; Guntupalli, S.R. Treatment of Epithelial Ovarian Cancer. BMJ 2020, 371, m3773. [Google Scholar] [CrossRef] [PubMed]
- Barani, M.; Bilal, M.; Sabir, F.; Rahdar, A.; Kyzas, G.Z. Nanotechnology in Ovarian Cancer: Diagnosis and Treatment. Life Sci. 2021, 266, 118914. [Google Scholar] [CrossRef] [PubMed]
- Rojas, V.; Hirshfield, K.M.; Ganesan, S.; Rodriguez-Rodriguez, L. Molecular Characterization of Epithelial Ovarian Cancer: Implications for Diagnosis and Treatment. Int. J. Mol. Sci. 2016, 17, 2113. [Google Scholar] [CrossRef]
- Chen, S.N.; Chang, R.; Lin, L.T.; Chern, C.U.; Tsai, H.W.; Wen, Z.H.; Li, Y.H.; Li, C.J.; Tsui, K.H. MicroRNA in Ovarian Cancer: Biology, Pathogenesis, and Therapeutic Opportunities. Int. J. Environ. Res. Public Health 2019, 16, 1510. [Google Scholar] [CrossRef] [PubMed]
- Tarhriz, V.; Bandehpour, M.; Dastmalchi, S.; Ouladsahebmadarek, E.; Zarredar, H.; Eyvazi, S. Overview of CD24 as a New Molecular Marker in Ovarian Cancer. J. Cell Physiol. 2019, 234, 2134–2142. [Google Scholar] [CrossRef]
- Moradi, S.; Fazlali, A.; Hamedi, H. Microwave-Assisted Hydro-Distillation of Essential Oil from Rosemary: Comparison with Traditional Distillation. Avicenna J. Med. Biotechnol. 2018, 10, 22–28. [Google Scholar] [PubMed]
- Hyun Jin, C.; Yang, H.S.; Choi, D.S.; Byun, M.W.; Kim, W.G.; Jeong, Y. Rosmarinic Acid Attenuated SIN-1-induced Cytotoxicity in HepG2 Cells through the HO-1 Induction and Radical Scavenging Activity. Food Sci. Biotechnol. 2013, 22, 549–556. [Google Scholar] [CrossRef]
- Furtado, R.A.; de Araújo, F.R.; Resende, F.A.; Cunha, W.R.; Tavares, D.C. Protective Effect of Rosmarinic acid on V79 Cells Evaluated by the Micronucleus and Comet Assays. J. Appl. Toxicol. 2010, 30, 254–259. [Google Scholar] [CrossRef] [PubMed]
- Brummelman, J.; Pilipow, K.; Lugli, E. The Single-Cell Phenotypic Identity of Human CD8+ and CD4+ T Cells. Int. Rev. Cell Mol. Biol. 2018, 341, 63–124. [Google Scholar] [PubMed]
- Lu, L.; Barbi, J.; Pan, F. The Regulation of Immune Tolerance by FOXP3. Nat. Rev. Immunol. 2017, 17, 703–717. [Google Scholar] [CrossRef] [PubMed]
- Plitas, G.; Rudensky, A.Y. Regulatory T Cells in Cancer. Annu. Rev. Cancer Biol. 2020, 4, 459–477. [Google Scholar] [CrossRef]
- Grisham, R.N.; Hyman, D.M.; Iyer, G. Targeted Therapies For Treatment of Recurrent Ovarian Cancer. Clin. Adv. Hematol. Oncol. 2014, 12, 158–162. [Google Scholar] [PubMed]
- Alemzadeh, E.; Allahqoli, L.; Mazidimoradi, A.; Alemzadeh, E.; Ghasemi, F.; Salehiniya, H.; Alkatout, I. Deciphering Resistance Mechanisms and Novel Strategies to Overcome Drug Resistance in Ovarian Cancer: A Comprehensive Review. Oncol. Res. 2024, 32, 831–847. [Google Scholar] [CrossRef]
- Kossaï, M.; Leary, A.; Scoazec, J.Y.; Genestie, C. Ovarian Cancer: A Heterogeneous Disease. Pathobiology 2018, 85, 41–49. [Google Scholar] [CrossRef]
- Cortez, A.J.; Tudrej, P.; Kujawa, K.A.; Lisowska, K.M. Advances in Ovarian Cancer Therapy. Cancer Chemother. Pharmacol. 2018, 81, 17–38. [Google Scholar] [CrossRef] [PubMed]
- Ediriweera, M.K.; Tennekoon, K.H.; Samarakoon, S.R. Role of the PI3K/AKT/mTOR Signaling Pathway in Ovarian Cancer: Biological and Therapeutic Significance. Semin. Cancer Biol. 2019, 59, 147–160. [Google Scholar] [CrossRef] [PubMed]
- Hitl, M.; Kladar, N.; Gavarić, N.; Božin, B. Rosmarinic Acid-Human Pharmacokinetics and Health Benefits. Planta Med. 2021, 87, 273–282. [Google Scholar] [CrossRef]
- Ko, Y.H.; Kim, S.K.; Lee, S.Y.; Jang, C.G. Flavonoids as Therapeutic Candidates for Emotional Disorders Such as Anxiety and Depression. Arch. Pharm. Res. 2020, 43, 1128–1143. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Chen, J.; Quan, J.; Xiang, D. Rosmarinic Acid Inhibits Proliferation and Migration, Promotes Apoptosis and Enhances Cisplatin Sensitivity of Melanoma Cells Through Inhibiting ADAM17/EGFR/AKT/GSK3β Axis. Bioengineered 2021, 12, 3065–3076. [Google Scholar] [CrossRef] [PubMed]
- Attia, M.; Essa, E.A.; Zaki, R.M.; Elkordy, A.A. An Overview of the Antioxidant Effects of Ascorbic Acid and Alpha Lipoic Acid (in Liposomal Forms) as Adjuvant in Cancer Treatment. Antioxidants 2020, 9, 359. [Google Scholar] [CrossRef] [PubMed]
- Jia, B.; Shang, J.; Zeng, H.; Wang, X.; Fang, M.; Xu, L.; Liu, X.; Wu, K.; Gong, Z.; Yang, Q. Hepatoprotective Effects of Rosmarinic Acid on Ovalbumin-Induced Intestinal Food Allergy Mouse Model. Molecules 2023, 28, 788. [Google Scholar] [CrossRef] [PubMed]
- Kim, G.D.; Park, Y.S.; Jin, Y.H.; Park, C.S. Production and Applications of Rosmarinic Acid and Structurally Related Compounds. Appl. Microbiol. Biotechnol. 2015, 99, 2083–2092. [Google Scholar] [CrossRef] [PubMed]
- Swamy, M.K.; Sinniah, U.R.; Ghasemzadeh, A. Anticancer Potential of Rosmarinic Acid and Its Improved Production Through Biotechnological Interventions and Functional Genomics. Appl. Microbiol. Biotechnol. 2018, 102, 7775–7793. [Google Scholar] [CrossRef] [PubMed]
- Messeha, S.S.; Zarmouh, N.O.; Asiri, A.; Soliman, K.F.A. Rosmarinic Acid-Induced Apoptosis and Cell Cycle Arrest in Triple-Negative Breast Cancer Cells. Eur. J. Pharmacol. 2020, 885, 173419. [Google Scholar] [CrossRef]
- Li, F.R.; Fu, Y.Y.; Jiang, D.H.; Wu, Z.; Zhou, Y.J.; Guo, L.; Dong, Z.M.; Wang, Z.Z. Reversal Effect of Rosmarinic Acid On Multidrug Resistance in SGC7901/Adr cell. J. Asian Nat. Prod. Res. 2013, 15, 276–285. [Google Scholar] [CrossRef]
- Liao, X.Z.; Gao, Y.; Sun, L.L.; Liu, J.H.; Chen, H.R.; Yu, L.; Chen, Z.Z.; Chen, W.H.; Lin, L.Z. Rosmarinic Acid Reverses Non-Small Cell Lung Cancer Cisplatin Resistance by Activating the MAPK Signaling Pathway. Phytother. Res. 2020, 34, 1142–1153. [Google Scholar] [CrossRef] [PubMed]
- Lešnik, S.; Furlan, V.; Bren, U. Rosemary (Rosmarinus officinalis L.): Extraction Techniques, Analytical Methods and Health-Promoting Biological Effects. Phytochem. Rev. 2021, 20, 1273–1328. [Google Scholar] [CrossRef]
- Wang, X.; He, Z.; Liu, H.; Yousefi, S.; Simon, H.U. Neutrophil Necroptosis is Triggered by Ligation of Adhesion Molecules Following GM-CSF priming. J. Immunol. 2016, 197, 4090–4100. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.; Heij, L.R.; Czigany, Z.; Dahl, E.; Lang, S.A.; Ulmer, T.F.; Luedde, T.; Neumann, U.P.; Bednarsch, J. The Role of Tumor-Infiltrating Lymphocytes in Cholangiocarcinoma. J. Exp. Clin. Cancer Res. 2022, 41, 127. [Google Scholar] [CrossRef] [PubMed]
- Goeppert, B.; Frauenschuh, L.; Zucknick, M.; Stenzinger, A.; Andrulis, M.; Klauschen, F.; Joehrens, K.; Warth, A.; Renner, M.; Mehrabi, A.; et al. Prognostic Impact of Tumour-Infiltrating Immune Cells on Biliary Tract Cancer. Br. J. Cancer 2013, 109, 2665–2674. [Google Scholar] [CrossRef]
- Asahi, Y.; Hatanaka, K.C.; Hatanaka, Y.; Kamiyama, T.; Orimo, T.; Shimada, S.; Nagatsu, A.; Sakamoto, Y.; Kamachi, H.; Kobayashi, N.; et al. Prognostic Impact of CD8+ T Cell Distribution And its Association with the HLA Class I Expression in Intrahepatic Cholangiocarcinoma. Surg. Today 2020, 50, 931–940. [Google Scholar] [CrossRef]
- Kim, H.D.; Kim, J.H.; Ryu, Y.M.; Kim, D.; Lee, S.; Shin, J.; Hong, S.M.; Kim, K.H.; Jung, D.H.; Song, G.W.; et al. Spatial Distribution and Prognostic Implications of Tumor-Infiltrating FoxP3- CD4+ T Cells in Biliary Tract Cancer. Cancer Res. Treat. 2021, 53, 162–171. [Google Scholar] [CrossRef] [PubMed]
- Zhou, G.; Sprengers, D.; Mancham, S.; Erkens, R.; Boor, P.P.C.; van Beek, A.A.; Doukas, M.; Noordam, L.; Campos Carrascosa, L.; de Ruiter, V.; et al. Reduction of Immunosuppressive Tumor Microenvironment in Cholangiocarcinoma by Ex Vivo Targeting Immune Checkpoint Molecules. J. Hepatol. 2019, 71, 753–762. [Google Scholar] [CrossRef] [PubMed]
- Corr, B.R.; Moroney, M.; Sheeder, J.; Eckhardt, S.G.; Sawyer, B.; Behbakht, K.; Diamond, J.R. Survival and Clinical Outcomes of Patients with Ovarian Cancer who were Treated on Phase 1 Clinical Trials. Cancer 2020, 126, 4289–4293. [Google Scholar] [CrossRef]
- Knutson, K.L.; Maurer, M.J.; Preston, C.C.; Moysich, K.B.; Goergen, K.; Hawthorne, K.M.; Cunningham, J.M.; Odunsi, K.; Hartmann, L.C.; Kalli, K.R.; et al. Regulatory T cells, Inherited Variation, and Clinical Outcome in Epithelial Ovarian Cancer. Cancer Immunol. Immunother. 2015, 64, 1495–1504. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, G.M.; Galpin, K.J.C.; McCloskey, C.W.; Vanderhyden, B.C. The Tumor Microenvironment of Epithelial Ovarian Cancer and Its Influence on Response to Immunotherapy. Cancers 2018, 10, 242. [Google Scholar] [CrossRef] [PubMed]
- Paluskievicz, C.M.; Cao, X.; Abdi, R.; Zheng, P.; Liu, Y.; Bromberg, J.S. T Regulatory Cells and Priming the Suppressive Tumor Microenvironment. Front. Immunol. 2019, 10, 2453. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Zhou, X.; Wan, M.; Zeng, X.; Luo, J.; Xu, Y.; Ji, L.; Zhang, J.A.; Fan, P.; Zhong, J.; et al. FoxP3-miR-150-5p/3p Suppresses Ovarian Tumorigenesis via an IGF1R/IRS1 Pathway Feedback Loop. Cell Death Dis. 2021, 12, 275. [Google Scholar] [CrossRef] [PubMed]
- Yue, L.; Ren, Y.; Yue, Q.; Ding, Z.; Wang, K.; Zheng, T.; Chen, G.; Chen, X.; Li, M.; Fan, L. α-Lipoic Acid Targeting PDK1/NRF2 Axis Contributes to the Apoptosis Effect of Lung Cancer Cells. Oxid. Med. Cell Longev. 2021, 2021, 6633419. [Google Scholar] [CrossRef]
- Sarı, U.; Zaman, F. Effects of rosmarinic acid and doxorubicine on an ovarian adenocarsinoma cell line (OVCAR3) via the EGFR pathway. Acta Cir. Bras. 2024, 39, e390524. [Google Scholar] [CrossRef]








Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Toprak, V.; Özdemir, İ.; Öztürk, Ş.; Yanar, O.; Kizildemir, Y.Z.; Tuncer, M.C. Modulation of FOXP3 Gene Expression in OVCAR3 Cells Following Rosmarinic Acid and Doxorubicin Exposure. Pharmaceuticals 2024, 17, 1606. https://doi.org/10.3390/ph17121606
Toprak V, Özdemir İ, Öztürk Ş, Yanar O, Kizildemir YZ, Tuncer MC. Modulation of FOXP3 Gene Expression in OVCAR3 Cells Following Rosmarinic Acid and Doxorubicin Exposure. Pharmaceuticals. 2024; 17(12):1606. https://doi.org/10.3390/ph17121606
Chicago/Turabian StyleToprak, Veysel, İlhan Özdemir, Şamil Öztürk, Orhan Yanar, Yusuf Ziya Kizildemir, and Mehmet Cudi Tuncer. 2024. "Modulation of FOXP3 Gene Expression in OVCAR3 Cells Following Rosmarinic Acid and Doxorubicin Exposure" Pharmaceuticals 17, no. 12: 1606. https://doi.org/10.3390/ph17121606
APA StyleToprak, V., Özdemir, İ., Öztürk, Ş., Yanar, O., Kizildemir, Y. Z., & Tuncer, M. C. (2024). Modulation of FOXP3 Gene Expression in OVCAR3 Cells Following Rosmarinic Acid and Doxorubicin Exposure. Pharmaceuticals, 17(12), 1606. https://doi.org/10.3390/ph17121606

