Increased MAGE-C Family Gene Expression Levels as a Biomarker of Colon Cancer Through the Demethylation Mechanism
Abstract
1. Introduction
2. Results
2.1. Basic Clinical Characteristics of Study Subjects
2.2. Expression Profiles of the MAGE-C1, MAGE-C2, and MAGE-C3 Genes in the Matched CC and NC Tissues
2.3. Detection of the DNMT1 Gene Expression in CC, Breast Cancer (BC), and Normal Breast (NB) Cell Lines
2.4. The Impact of 5-Aza-2′-CdR on the Morphology of the Cancer and Normal Cell Lines
2.5. Effects of 5-Aza-2′-CdR on MAGE-C Gene Expressions in Various Types of Cell Lines
2.6. In Silico Analysis of MAGE-C Protein Family
2.7. Survival Analysis of MAGE-C Genes in a Kaplan–Meier Plotter
3. Discussion
4. Materials and Methods
4.1. Ethical Approval and Sample Collection
4.2. Sources, Culturing Methods, and an Epigenetic Drug (5-Aza-2′-CdR) for Cancer Cell Lines
4.3. Sources, Culturing Methods, and an Epigenetic Drug (5-Aza-2′-CdR) for NB Cell Lines
4.4. Extraction of RNA from NC, CC, and Cultured Cells
4.5. Synthesis of cDNA
4.6. Designing RT-PCR Primers, Setting Up RT-PCR Reactions, and Performing Agarose Gel Electrophoresis of the Products
4.7. Designing qRT-PCR Primers and Setting Up qRT-PCR Reactions
4.8. Statistical Analysis
4.9. In Silico Analysis
4.10. Survival Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Alrubie, T.M.; Alamri, A.M.; Almutairi, B.O.; Alrefaei, A.F.; Arafah, M.M.; Alanazi, M.; Semlali, A.; Almutairi, M.H. Higher Expression Levels of SSX1 and SSX2 in Patients with Colon Cancer: Regulated In Vitro by the Inhibition of Methylation and Histone Deacetylation. Medicina 2023, 59, 988. [Google Scholar] [CrossRef] [PubMed]
- Kanojia, D.; Garg, M.; Gupta, S.; Gupta, A.; Suri, A. Sperm-associated antigen 9 is a novel biomarker for colorectal cancer and is involved in tumor growth and tumorigenicity. Am. J. Pathol. 2011, 178, 1009–1020. [Google Scholar] [CrossRef] [PubMed]
- Alsanea, N.; Abduljabbar, A.S.; Alhomoud, S.; Ashari, L.H.; Hibbert, D.; Bazarbashi, S. Colorectal cancer in Saudi Arabia: Incidence, survival, demographics and implications for national policies. Ann. Saudi Med. 2015, 35, 196–202. [Google Scholar] [CrossRef] [PubMed]
- Rasool, M.; Natesan Pushparaj, P.; Karim, S. Overexpression of CXCL8 gene in Saudi colon cancer patients. Saudi J. Biol. Sci. 2021, 28, 6045–6049. [Google Scholar] [CrossRef] [PubMed]
- Alyabsi, M.; Alhumaid, A.; Allah-Bakhsh, H.; Alkelya, M.; Aziz, M.A. Colorectal cancer in Saudi Arabia as the proof-of-principle model for implementing strategies of predictive, preventive, and personalized medicine in healthcare. EPMA J. 2020, 11, 119–131. [Google Scholar] [CrossRef]
- Almutairi, M.H.; Alrubie, T.M.; Almutairi, B.O.; Alamri, A.M.; Alrefaei, A.F.; Arafah, M.M.; Alanazi, M.; Semlali, A. The Expression Patterns of Human Cancer-Testis Genes Are Induced through Epigenetic Drugs in Colon Cancer Cells. Pharmaceuticals 2022, 15, 1319. [Google Scholar] [CrossRef]
- Almutairi, M.H.; Alrubie, T.M.; Alamri, A.M.; Almutairi, B.O.; Alrefaei, A.F.; Arafah, M.M.; Alanazi, M.; Semlali, A. Cancer-Testis Gene Biomarkers Discovered in Colon Cancer Patients. Genes 2022, 13, 807. [Google Scholar] [CrossRef]
- Hofmann, O.; Caballero, O.L.; Stevenson, B.J.; Chen, Y.T.; Cohen, T.; Chua, R.; Maher, C.A.; Panji, S.; Schaefer, U.; Kruger, A.; et al. Genome-wide analysis of cancer/testis gene expression. Proc. Natl. Acad. Sci. USA 2008, 105, 20422–20427. [Google Scholar] [CrossRef]
- Feichtinger, J.; Aldeailej, I.; Anderson, R.; Almutairi, M.; Almatrafi, A.; Alsiwiehri, N.; Griffiths, K.; Stuart, N.; Wakeman, J.A.; Larcombe, L.; et al. Meta-analysis of clinical data using human meiotic genes identifies a novel cohort of highly restricted cancer-specific marker genes. Oncotarget 2012, 3, 843–853. [Google Scholar] [CrossRef]
- Caballero, O.L.; Chen, Y.T. Cancer/testis (CT) antigens: Potential targets for immunotherapy. Cancer Sci. 2009, 100, 2014–2021. [Google Scholar] [CrossRef]
- Almatrafi, A.; Feichtinger, J.; Vernon, E.G.; Escobar, N.G.; Wakeman, J.A.; Larcombe, L.D.; McFarlane, R.J. Identification of a class of human cancer germline genes with transcriptional silencing refractory to the hypomethylating drug 5-aza-2’-deoxycytidine. Oncoscience 2014, 1, 745–750. [Google Scholar] [CrossRef] [PubMed]
- Adair, S.J.; Hogan, K.T. Treatment of ovarian cancer cell lines with 5-aza-2’-deoxycytidine upregulates the expression of cancer-testis antigens and class I major histocompatibility complex-encoded molecules. Cancer Immunol. Immunother. 2009, 58, 589–601. [Google Scholar] [CrossRef] [PubMed]
- Almeida, L.G.; Sakabe, N.J.; deOliveira, A.R.; Silva, M.C.; Mundstein, A.S.; Cohen, T.; Chen, Y.T.; Chua, R.; Gurung, S.; Gnjatic, S.; et al. CTdatabase: A knowledge-base of high-throughput and curated data on cancer-testis antigens. Nucleic Acids Res. 2009, 37, D816–D819. [Google Scholar] [CrossRef]
- Costa, F.F.; Le Blanc, K.; Brodin, B. Concise review: Cancer/testis antigens, stem cells, and cancer. Stem Cells 2007, 25, 707–711. [Google Scholar] [CrossRef] [PubMed]
- Lucas, S.; De Plaen, E.; Boon, T. MAGE-B5, MAGE-B6, MAGE-C2, and MAGE-C3: Four new members of the MAGE family with tumor-specific expression. Int. J. Cancer 2000, 87, 55–60. [Google Scholar] [CrossRef]
- Hou, S.; Sang, M.; Zhao, L.; Hou, R.; Shan, B. The expression of MAGE-C1 and MAGE-C2 in breast cancer and their clinical significance. Am. J. Surg. 2016, 211, 142–151. [Google Scholar] [CrossRef]
- Shires, K.; Wienand, K. Cancer testis antigen MAGE C1 can be used to monitor levels of circulating malignant stem cells in the peripheral blood of multiple myeloma patients. J. Cancer Res. Clin. Oncol. 2016, 142, 2383–2396. [Google Scholar] [CrossRef]
- Curioni-Fontecedro, A.; Knights, A.J.; Tinguely, M.; Nuber, N.; Schneider, C.; Thomson, C.W.; von Boehmer, L.; Bossart, W.; Pahlich, S.; Gehring, H.; et al. MAGE-C1/CT7 is the dominant cancer-testis antigen targeted by humoral immune responses in patients with multiple myeloma. Leukemia 2008, 22, 1646–1648. [Google Scholar] [CrossRef][Green Version]
- Curioni-Fontecedro, A.; Nuber, N.; Mihic-Probst, D.; Seifert, B.; Soldini, D.; Dummer, R.; Knuth, A.; van den Broek, M.; Moch, H. Expression of MAGE-C1/CT7 and MAGE-C2/CT10 predicts lymph node metastasis in melanoma patients. PLoS ONE 2011, 6, e21418. [Google Scholar] [CrossRef]
- Zimmermann, A.K.; Imig, J.; Klar, A.; Renner, C.; Korol, D.; Fink, D.; Stadlmann, S.; Singer, G.; Knuth, A.; Moch, H.; et al. Expression of MAGE-C1/CT7 and selected cancer/testis antigens in ovarian borderline tumours and primary and recurrent ovarian carcinomas. Virchows Arch. 2013, 462, 565–574. [Google Scholar] [CrossRef]
- Wu, Q.; Zhang, W.; Wang, Y.; Min, Q.; Zhang, H.; Dong, D.; Zhan, Q. MAGE-C3 promotes cancer metastasis by inducing epithelial-mesenchymal transition and immunosuppression in esophageal squamous cell carcinoma. Cancer Commun. 2021, 41, 1354–1372. [Google Scholar] [CrossRef] [PubMed]
- Jakobsen, M.K.; Traynor, S.; Staehr, M.; Duijf, P.G.; Nielsen, A.Y.; Terp, M.G.; Pedersen, C.B.; Guldberg, P.; Ditzel, H.J.; Gjerstorff, M.F. The Cancer/Testis Antigen Gene VCX2 Is Rarely Expressed in Malignancies but Can Be Epigenetically Activated Using DNA Methyltransferase and Histone Deacetylase Inhibitors. Front. Oncol. 2020, 10, 584024. [Google Scholar] [CrossRef] [PubMed]
- Almutairi, M.H.; Alotaibi, M.M.; Alonaizan, R.; Alrefaei, A.F.; Almutairi, B.O. Identification of MAGE-A family genes in colon cancer patients and their expression mechanism. J. King Saud. Univ.–Sci. 2022, 34, 102251. [Google Scholar] [CrossRef]
- Tian, Y.; Liang, P.; Zhang, L.; Zhang, X.; Wang, X.; Jin, Y.; Qi, X.; Liu, Y. High expression of MAGE-C1 gene in colorectal cancer is associated with its poor prognosis. J. Gastrointest. Oncol. 2021, 12, 2872–2881. [Google Scholar] [CrossRef]
- Bruggeman, J.W.; Koster, J.; van Pelt, A.M.M.; Speijer, D.; Hamer, G. How germline genes promote malignancy in cancer cells. Bioessays 2022, 45, e2200112. [Google Scholar] [CrossRef]
- Alrubie, T.M.; Shaik, J.P.; Alamri, A.M.; Alanazi, M.; Alshareeda, A.T.; Alqarni, A.; Alawfi, H.G.; Almaiman, S.M.; Almutairi, M.H. FTHL17, PRM2, CABYR, CPXCR1, ADAM29, and CABS1 are highly expressed in colon cancer patients and are regulated in vitro by epigenetic alterations. Heliyon 2024, 10, e23689. [Google Scholar] [CrossRef]
- van Duin, M.; Broyl, A.; de Knegt, Y.; Goldschmidt, H.; Richardson, P.G.; Hop, W.C.; van der Holt, B.; Joseph-Pietras, D.; Mulligan, G.; Neuwirth, R.; et al. Cancer testis antigens in newly diagnosed and relapse multiple myeloma: Prognostic markers and potential targets for immunotherapy. Haematologica 2011, 96, 1662–1669. [Google Scholar] [CrossRef]
- Melo, D.H.; Mamede, R.C.M.; Neder, L.; Silva, W.A., Jr.; Barros-Filho, M.C.; Kowalski, L.P.; Pinto, C.A.L.; Zago, M.A.; Figueiredo, D.L.A.; Jungbluth, A.A. Expression of cancer/testis antigens MAGE-A, MAGE-C1, GAGE and CTAG1B in benign and malignant thyroid diseases. Oncol. Lett. 2017, 14, 6485–6496. [Google Scholar] [CrossRef]
- Chen, X.; Wang, L.; Yue, D.; Liu, J.; Huang, L.; Yang, L.; Cao, L.; Qin, G.; Li, A.; Wang, D.; et al. Correlation between the high expression levels of cancer-germline genes with clinical characteristics in esophageal squamous cell carcinoma. Histol. Histopathol. 2017, 32, 793–803. [Google Scholar] [CrossRef]
- Chitale, D.A.; Jungbluth, A.A.; Marshall, D.S.; Leitao, M.M.; Hedvat, C.V.; Kolb, D.; Spagnoli, G.C.; Iversen, K.; Soslow, R.A. Expression of cancer-testis antigens in endometrial carcinomas using a tissue microarray. Mod. Pathol. 2005, 18, 119–126. [Google Scholar] [CrossRef]
- Kruger, S.; Ola, V.; Feller, A.C.; Fischer, D.; Friedrich, M. Expression of cancer-testis antigen CT7 (MAGE-C1) in breast cancer: An immunohistochemical study with emphasis on prognostic utility. Pathol. Oncol. Res. 2007, 13, 91–96. [Google Scholar] [CrossRef] [PubMed]
- Kurashige, T.; Noguchi, Y.; Saika, T.; Ono, T.; Nagata, Y.; Jungbluth, A.; Ritter, G.; Chen, Y.T.; Stockert, E.; Tsushima, T.; et al. Ny-ESO-1 expression and immunogenicity associated with transitional cell carcinoma: Correlation with tumor grade. Cancer Res. 2001, 61, 4671–4674. [Google Scholar]
- Chen, X.; Wang, L.; Liu, J.; Huang, L.; Yang, L.; Gao, Q.; Shi, X.; Li, J.; Li, F.; Zhang, Z.; et al. Expression and prognostic relevance of MAGE-A3 and MAGE-C2 in non-small cell lung cancer. Oncol. Lett. 2017, 13, 1609–1618. [Google Scholar] [CrossRef] [PubMed]
- Riener, M.O.; Wild, P.J.; Soll, C.; Knuth, A.; Jin, B.; Jungbluth, A.; Hellerbrand, C.; Clavien, P.A.; Moch, H.; Jochum, W. Frequent expression of the novel cancer testis antigen MAGE-C2/CT-10 in hepatocellular carcinoma. Int. J. Cancer 2009, 124, 352–357. [Google Scholar] [CrossRef] [PubMed]
- Ellegate, J., Jr.; Mastri, M.; Isenhart, E.; Krolewski, J.J.; Chatta, G.; Kauffman, E.; Moffitt, M.; Eng, K.H. Loss of MAGEC3 Expression Is Associated with Prognosis in Advanced Ovarian Cancers. Cancers 2022, 14, 731. [Google Scholar] [CrossRef]
- Cannuyer, J.; Loriot, A.; Parvizi, G.K.; De Smet, C. Epigenetic hierarchy within the MAGEA1 cancer-germline gene: Promoter DNA methylation dictates local histone modifications. PLoS ONE 2013, 8, e58743. [Google Scholar] [CrossRef]
- Kim, R.; Kulkarni, P.; Hannenhalli, S. Derepression of Cancer/testis antigens in cancer is associated with distinct patterns of DNA hypomethylation. BMC Cancer 2013, 13, 144. [Google Scholar] [CrossRef]
- Almutairi, M.H.; Alrubie, T.M.; Alshareeda, A.T.; Albarakati, N.; Almotiri, A.; Alamri, A.M.; Almutairi, B.O.; Alanazi, M. Differential expression and regulation of ADAD1, DMRTC2, PRSS54, SYCE1, SYCP1, TEX101, TEX48, and TMPRSS12 gene profiles in colon cancer tissues and their in vitro response to epigenetic drugs. PLoS ONE 2024, 19, e0307724. [Google Scholar] [CrossRef]
- Ko, M.; An, J.; Pastor, W.A.; Koralov, S.B.; Rajewsky, K.; Rao, A. TET proteins and 5-methylcytosine oxidation in hematological cancers. Immunol. Rev. 2015, 263, 6–21. [Google Scholar] [CrossRef]
- Parker, A.C.; Quinteros, B.I.; Piccolo, S.R. The DNA methylation landscape of five pediatric-tumor types. PeerJ 2022, 10, e13516. [Google Scholar] [CrossRef]
- Molnar, B.; Galamb, O.; Peterfia, B.; Wichmann, B.; Csabai, I.; Bodor, A.; Kalmar, A.; Szigeti, K.A.; Bartak, B.K.; Nagy, Z.B.; et al. Gene promoter and exon DNA methylation changes in colon cancer development-mRNA expression and tumor mutation alterations. BMC Cancer 2018, 18, 695. [Google Scholar] [CrossRef] [PubMed]
- Romero-Garcia, S.; Prado-Garcia, H.; Carlos-Reyes, A. Role of DNA Methylation in the Resistance to Therapy in Solid Tumors. Front. Oncol. 2020, 10, 1152. [Google Scholar] [CrossRef] [PubMed]
- Vatolin, S.; Abdullaev, Z.; Pack, S.D.; Flanagan, P.T.; Custer, M.; Loukinov, D.I.; Pugacheva, E.; Hong, J.A.; Morse, H., III; Schrump, D.S.; et al. Conditional expression of the CTCF-paralogous transcriptional factor BORIS in normal cells results in demethylation and derepression of MAGE-A1 and reactivation of other cancer-testis genes. Cancer Res. 2005, 65, 7751–7762. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Ren, J.; Fang, M.; Wang, X. Investigation of fusion gene expression in HCT116 cells. Oncol. Lett. 2017, 14, 6962–6968. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zhao, J.; Wang, Y.; Liang, Q.; Xu, Y.; Sang, J. MAGEA1 inhibits the expression of BORIS via increased promoter methylation. J. Cell Sci. 2019, 132, jcs218628. [Google Scholar] [CrossRef]
- Caponigro, F.; Basile, M.; de Rosa, V.; Normanno, N. New drugs in cancer therapy, National Tumor Institute, Naples, 17–18 June 2004. Anticancer Drugs 2005, 16, 211–221. [Google Scholar] [CrossRef]
- Shukla, H.D. Comprehensive analysis of cancer-proteogenome to identify biomarkers for the early diagnosis and prognosis of cancer. Proteomes 2017, 5, 28. [Google Scholar] [CrossRef]
- Coppedè, F.; Lopomo, A.; Spisni, R.; Migliore, L. Genetic and epigenetic biomarkers for diagnosis, prognosis and treatment of colorectal cancer. World J. Gastroenterol. WJG 2014, 20, 943. [Google Scholar] [CrossRef]
- Cerami, E.; Gao, J.; Dogrusoz, U.; Gross, B.E.; Sumer, S.O.; Aksoy, B.A.; Jacobsen, A.; Byrne, C.J.; Heuer, M.L.; Larsson, E. The cBio cancer genomics portal: An open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2012, 2, 401–404. [Google Scholar] [CrossRef]
- Chandrashekar, D.S.; Karthikeyan, S.K.; Korla, P.K.; Patel, H.; Shovon, A.R.; Athar, M.; Netto, G.J.; Qin, Z.S.; Kumar, S.; Manne, U. UALCAN: An update to the integrated cancer data analysis platform. Neoplasia 2022, 25, 18–27. [Google Scholar] [CrossRef]
- Győrffy, B. Integrated analysis of public datasets for the discovery and validation of survival-associated genes in solid tumors. Innovation 2024, 5, 100625. [Google Scholar] [CrossRef] [PubMed]
- Weinstein, J.N.; Collisson, E.A.; Mills, G.B.; Shaw, K.R.; Ozenberger, B.A.; Ellrott, K.; Shmulevich, I.; Sander, C.; Stuart, J.M. The cancer genome atlas pan-cancer analysis project. Nat. Genet. 2013, 45, 1113–1120. [Google Scholar] [CrossRef] [PubMed]









| Variables | CC (n%) | NC (n%) | ||||
|---|---|---|---|---|---|---|
| Male participants | 20 (100%) | 20 (100%) | ||||
| Mean age (min–max) | 57 (24–79) | 57 (24–79) | ||||
| Below 57 | 8 (40%) | 8 (40%) | ||||
| Above 57 | 12 (60%) | 12 (60%) | ||||
| Female participants | 6 (100%) | 6 (100%) | ||||
| Mean age (min–max) | 59 (30–80) | 59 (30–80) | ||||
| Below 59 | 3 (50%) | 3 (50%) | ||||
| Above 59 | 3 (50%) | 3 (50%) | ||||
| Cancer stage in CC | ||||||
| Stage of CC | I | II | III | |||
| CC patient sample | 2–5, 10, 13, 20 | 6–9, 12, 16–19, 21–26 | 1, 11, 14–15 | |||
| Cell Type | Exposure Duration of Cells to 5-Aza-2′-CdR | ||
|---|---|---|---|
| Day 1 (%) | Day 2 (%) | Day 3 (%) | |
| HCT116 | 98 | 95 | 91 |
| Caco-2 | 98 | 94 | 90 |
| MCF-7 | 96 | 92 | 88 |
| MCF-10A | 99 | 95 | 90 |
| Genes | Accession Number | Category | Primer Sequences (5′→3′) | Ta | Product Size (bp) |
|---|---|---|---|---|---|
| ACTB | NM_001101.5 | Forward Reverse | AGAAAATCTGGCACCACACC AGGAAGGAAGGCTGGAAGAG | 58 °C | 553 |
| MAGE-C1 | NM_005462.5 | Forward Reverse | GTTCCAAGTCTTCCTGAGTG TGGAGAGAAGACTGGAAGTC | 58 °C | 675 |
| MAGE-C2 | NM_016249.4 | Forward Reverse | CATGGAGCTCATTCAGTGAG CCGATACTCCAGGTAATGTC | 58 °C | 539 |
| MAGE-C3 | NM_138702.1 | Forward Reverse | CAGTGAAGAGGAGGATACAG GACACAGCTGCCCTTTATGA | 58 °C | 391 |
| Genes | Category | Primer Sequences (5′→3′) | Ta | Product Size (bp) |
|---|---|---|---|---|
| GAPDH | Forward Reverse | GGGAAGCTTGTCATCAATGG GAGATGATGACCCTTTTGGC | 58 °C | 173 |
| MAGE-C1 | Forward Reverse | CAGATTCCTATGACCTCCTC CAGTAAAGTGGAGGAGAAGG | 58 °C | 144 |
| MAGE-C2 | Forward Reverse | CATGGAGCTCATTCAGTGAG CTGCTTCGTATTTGAGGAGC | 58 °C | 153 |
| MAGE-C3 | Forward Reverse | CAGTGAAGAGGAGGATACAG AGCATCTCTGCCTTTGTGAC | 58 °C | 150 |
| DNMT1 | Forward Reverse | GTAAAGCCTGCAAGGACATG CATCGACTTCCTCATCGTCA | 58 °C | 120 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Almutairi, M.H.; Alsoraie, W.A.; Alrubie, T.M.; Alkhaldi, A.S.; Alhajri, N.S.; Alaujan, M.A.; Almutairi, M.H.; Almutairi, B.O. Increased MAGE-C Family Gene Expression Levels as a Biomarker of Colon Cancer Through the Demethylation Mechanism. Pharmaceuticals 2024, 17, 1447. https://doi.org/10.3390/ph17111447
Almutairi MH, Alsoraie WA, Alrubie TM, Alkhaldi AS, Alhajri NS, Alaujan MA, Almutairi MH, Almutairi BO. Increased MAGE-C Family Gene Expression Levels as a Biomarker of Colon Cancer Through the Demethylation Mechanism. Pharmaceuticals. 2024; 17(11):1447. https://doi.org/10.3390/ph17111447
Chicago/Turabian StyleAlmutairi, Mikhlid H., Waad A. Alsoraie, Turki M. Alrubie, Ahmad S. Alkhaldi, Nada S. Alhajri, Monira A. Alaujan, Manar H. Almutairi, and Bader O. Almutairi. 2024. "Increased MAGE-C Family Gene Expression Levels as a Biomarker of Colon Cancer Through the Demethylation Mechanism" Pharmaceuticals 17, no. 11: 1447. https://doi.org/10.3390/ph17111447
APA StyleAlmutairi, M. H., Alsoraie, W. A., Alrubie, T. M., Alkhaldi, A. S., Alhajri, N. S., Alaujan, M. A., Almutairi, M. H., & Almutairi, B. O. (2024). Increased MAGE-C Family Gene Expression Levels as a Biomarker of Colon Cancer Through the Demethylation Mechanism. Pharmaceuticals, 17(11), 1447. https://doi.org/10.3390/ph17111447

