Therapeutic Potential of Hydrogen-Rich Water on Muscle Atrophy Caused by Immobilization in a Mouse Model
Abstract
1. Introduction
2. Results
2.1. Morphological Changes and Weight of Muscles
2.2. Four-Limb Grip Strength
2.3. Histological Findings
2.4. Biochemical Measurements
2.5. Gene Expression Analysis
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Animals
4.3. Immobilization Atrophy and Muscle Recovery
4.4. Animal Groups and Experimental Design
4.5. Limb Strength Grip Test
4.6. Sample Collection
4.7. Histological Evaluation
4.8. Serum and Tissue Measurements
4.9. Extraction of RNA and Quantitative Real-Time RT-PCR
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bodine, S.C. Disuse-induced muscle wasting. Int. J. Biochem. Cell Biol. 2013, 45, 2200–2208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cohen, S.; Nathan, J.A.; Goldberg, A.L. Muscle wasting in disease: Molecular mechanisms and promising therapies. Nat. Rev. Drug Discov. 2015, 14, 58–74. [Google Scholar] [CrossRef] [Scilit]
- Huang, L.; Li, M.; Deng, C.; Qiu, J.; Wang, K.; Chang, M.; Zhou, S.; Gu, Y.; Shen, Y.; Wang, W.; et al. Potential Therapeutic Strategies for Skeletal Muscle Atrophy. Antioxidants 2022, 12, 44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Powers, S.K.; Kavazis, A.N.; McClung, J.M. Oxidative stress and disuse muscle atrophy. J. Appl. Physiol. (1985) 2007, 102, 2389–2397. [Google Scholar] [CrossRef] [Scilit]
- Kondo, H. Oxidative stress in skeletal muscle atrophied by immobilization. Acta Physiol. Scand. 1991, 142, 527–528. [Google Scholar] [CrossRef] [Scilit]
- Libera, L.D.; Ravara, B.; Gobbo, V.; Tarricone, E.; Vitadello, M.; Biolo, G.; Vescovo, G.; Gorza, L. A transient antioxidant stress response accompanies the onset of disuse atrophy in human skeletal muscle. J. Appl. Physiol. 2009, 107, 549–557. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Powers, S.K.; Kavazis, A.N.; DeRuisseau, K.C. Mechanisms of disuse muscle atrophy: Role of oxidative stress. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2005, 288, R337–R344. [Google Scholar] [CrossRef] [Scilit]
- Slezak, J.; Kura, B.; LeBaron, T.W.; Singal, P.K.; Buday, J.; Barancik, M. Oxidative Stress and Pathways of Molecular Hydrogen Effects in Medicine. Curr. Pharm. Des. 2021, 27, 610–625. [Google Scholar] [CrossRef] [Scilit]
- Artamonov, M.Y.; Martusevich, A.K.; Pyatakovich, F.A.; Minenko, I.A.; Dlin, S.V.; LeBaron, T.W. Molecular Hydrogen: From Molecular Effects to Stem Cells Management and Tissue Regeneration. Antioxidants 2023, 12, 636. [Google Scholar] [CrossRef] [Scilit]
- Dixon, B.J.; Tang, J.; Zhang, J.H. The evolution of molecular hydrogen: A noteworthy potential therapy with clinical significance. Med. Gas Res. 2013, 3, 10. [Google Scholar] [CrossRef] [Scilit]
- Iida, A.; Nosaka, N.; Yumoto, T.; Knaup, E.; Naito, H.; Nishiyama, C.; Yamakawa, Y.; Tsukahara, K.; Terado, M.; Sato, K.; et al. The Clinical Application of Hydrogen as a Medical Treatment. Acta Med. Okayama 2016, 70, 331–337. [Google Scholar] [PubMed]
- Yuan, T.; Zhao, J.N.; Bao, N.R. Hydrogen applications: Advances in the field of medical therapy. Med. Gas Res. 2023, 13, 99–107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Botek, M.; Krejčí, J.; McKune, A.; Valenta, M.; Sládečková, B. Hydrogen Rich Water Consumption Positively Affects Muscle Performance, Lactate Response, and Alleviates Delayed Onset of Muscle Soreness After Resistance Training. J. Strength Cond. Res. 2022, 36, 2792–2799. [Google Scholar] [CrossRef] [Scilit]
- Yuan, J.; Wang, D.; Liu, Y.; Chen, X.; Zhang, H.; Shen, F.; Liu, X.; Fu, J. Hydrogen-rich water attenuates oxidative stress in rats with traumatic brain injury via Nrf2 pathway. J. Surg. Res. 2018, 228, 238–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- LeBaron, T.W.; Laher, I.; Kura, B.; Slezak, J. Hydrogen gas: From clinical medicine to an emerging ergogenic molecule for sports athletes (1). Can. J. Physiol. Pharmacol. 2019, 97, 797–807. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nikolaou, P.K.; Macdonald, B.L.; Glisson, R.R.; Seaber, A.V.; Garrett, W.E., Jr. Biomechanical and histological evaluation of muscle after controlled strain injury. Am. J. Sports Med. 1987, 15, 9–14. [Google Scholar] [CrossRef] [Scilit]
- Trensz, F.; Haroun, S.; Cloutier, A.; Richter, M.V.; Grenier, G. A muscle resident cell population promotes fibrosis in hindlimb skeletal muscles of mdx mice through the Wnt canonical pathway. Am. J. Physiol. Cell Physiol. 2010, 299, C939–C947. [Google Scholar] [CrossRef] [Scilit]
- Kakutani, N.; Takada, S.; Nambu, H.; Maekawa, S.; Hagiwara, H.; Yamanashi, K.; Obata, Y.; Nakano, I.; Fumoto, Y.; Hata, S.; et al. Angiotensin-converting enzyme inhibitor prevents skeletal muscle fibrosis in diabetic mice. Exp. Physiol. 2021, 106, 1785–1793. [Google Scholar] [CrossRef] [Scilit]
- Todorovic, N.; Javorac, D.; Stajer, V.; Ostojic, S.M. The Effects of Supersaturated Hydrogen-Rich Water Bathing on Biomarkers of Muscular Damage and Soreness Perception in Young Men Subjected to High-Intensity Eccentric Exercise. J. Sports Med. 2020, 2020, 8836070. [Google Scholar] [CrossRef] [Scilit]
- Nogueira, J.E.; Amorim, M.R.; Pinto, A.P.; da Rocha, A.L.; da Silva, A.S.R.; Branco, L.G.S. Molecular hydrogen downregulates acute exhaustive exercise-induced skeletal muscle damage. Can. J. Physiol. Pharmacol. 2021, 99, 812–820. [Google Scholar] [CrossRef] [Scilit]
- Tian, Y.; Zhang, Y.; Wang, Y.; Chen, Y.; Fan, W.; Zhou, J.; Qiao, J.; Wei, Y. Hydrogen, a Novel Therapeutic Molecule, Regulates Oxidative Stress, Inflammation, and Apoptosis. Front. Physiol. 2021, 12, 789507. [Google Scholar] [CrossRef] [Scilit]
- Barancik, M.; Kura, B.; LeBaron, T.W.; Bolli, R.; Buday, J.; Slezak, J. Molecular and Cellular Mechanisms Associated with Effects of Molecular Hydrogen in Cardiovascular and Central Nervous Systems. Antioxidants 2020, 9, 1281. [Google Scholar] [CrossRef] [Scilit]
- Powers, S.K. Can antioxidants protect against disuse muscle atrophy? Sports Med. 2014, 44, 155–165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, Z.; Zhao, P.; Gong, W.; Ding, W.; He, Q. Fe-porphyrin: A redox-related biosensor of hydrogen molecule. Nano Res. 2023, 16, 2020–2025. [Google Scholar] [CrossRef] [Scilit]
- Aoki, K.; Nakao, A.; Adachi, T.; Matsui, Y.; Miyakawa, S. Pilot study: Effects of drinking hydrogen-rich water on muscle fatigue caused by acute exercise in elite athletes. Med. Gas Res. 2012, 2, 12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, K.; Liu, M.; Wang, Y.; Liu, H.; Manor, B.; Bao, D.; Zhang, L.; Zhou, J. Effects of molecular hydrogen supplementation on fatigue and aerobic capacity in healthy adults: A systematic review and meta-analysis. Front. Nutr. 2023, 10, 1094767. [Google Scholar] [CrossRef] [Scilit]
- Chaoqun, L.; Yuqi, Z.; Shi, Z.; Zhenghui, Y.; Li, W. A Comparison of the Antioxidant Effects Between Hydrogen Gas Inhalation and Vitamin C Supplementation in Response to a 60-Min Treadmill Exercise in Rat Gastrocnemius Muscle. Front. Physiol. 2021, 12, 745194. [Google Scholar] [CrossRef] [Scilit]
- Nogueira, J.E.; Passaglia, P.; Mota, C.M.D.; Santos, B.M.; Batalhao, M.E.; Carnio, E.C.; Branco, L.G.S. Molecular hydrogen reduces acute exercise-induced inflammatory and oxidative stress status. Free Radic. Biol. Med. 2018, 129, 186–193. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.J.; Tian, H.; Zhuang, B.X.; Wu, H.J. Effects of intraperitoneal hydrogen injection on nitric oxide synthase mRNA and malondialdehyde following limb ischemia-reperfusion in rabbits. Acta Orthop. Traumatol. Turc. 2015, 49, 558–564. [Google Scholar] [CrossRef] [Scilit]
- Thoma, A.; Lightfoot, A.P. NF-κB and Inflammatory Cytokine Signalling: Role in Skeletal Muscle Atrophy. Adv. Exp. Med. Biol. 2018, 1088, 267–279. [Google Scholar] [CrossRef] [Scilit]
- Argiles, J.M.; Busquets, S.; Lopez-Soriano, F.J. The pivotal role of cytokines in muscle wasting during cancer. Int. J. Biochem. Cell Biol. 2005, 37, 1609–1619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dogra, C.; Changotra, H.; Wedhas, N.; Qin, X.; Wergedal, J.E.; Kumar, A. TNF-related weak inducer of apoptosis (TWEAK) is a potent skeletal muscle-wasting cytokine. FASEB J. 2007, 21, 1857–1869. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oeckinghaus, A.; Ghosh, S. The NF-κappaB family of transcription factors and its regulation. Cold Spring Harb. Perspect. Biol. 2009, 1, a000034. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, C.S.; Kawamura, T.; Peng, X.; Tochigi, N.; Shigemura, N.; Billiar, T.R.; Nakao, A.; Toyoda, Y. Hydrogen inhalation reduced epithelial apoptosis in ventilator-induced lung injury via a mechanism involving nuclear factor-kappa B activation. Biochem. Biophys. Res. Commun. 2011, 408, 253–258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhuang, Z.; Sun, X.J.; Zhang, X.; Liu, H.D.; You, W.C.; Ma, C.Y.; Zhu, L.; Zhou, M.L.; Shi, J.X. Nuclear factor-kappaB/Bcl-XL pathway is involved in the protective effect of hydrogen-rich saline on the brain following experimental subarachnoid hemorrhage in rabbits. J. Neurosci. Res. 2013, 91, 1599–1608. [Google Scholar] [CrossRef] [Scilit]
- Hirayama, M.; Ito, M.; Minato, T.; Yoritaka, A.; LeBaron, T.W.; Ohno, K. Inhalation of hydrogen gas elevates urinary 8-hydroxy-2′-deoxyguanine in Parkinson’s disease. Med. Gas Res. 2018, 8, 144. [Google Scholar]
- Li, H.; Malhotra, S.; Kumar, A. Nuclear factor-kappa B signaling in skeletal muscle atrophy. J. Mol. Med. 2008, 86, 1113–1126. [Google Scholar] [CrossRef] [Scilit]
- Cai, D.; Frantz, J.D.; Tawa, N.E., Jr.; Melendez, P.A.; Oh, B.C.; Lidov, H.G.; Hasselgren, P.O.; Frontera, W.R.; Lee, J.; Glass, D.J.; et al. IKKbeta/NF-κappaB activation causes severe muscle wasting in mice. Cell 2004, 119, 285–298. [Google Scholar] [CrossRef] [Scilit]
- Tie, H.M.; Sun, R.X.; Yu, D.W.; Yang, F.; Jiang, Q.X.; Xu, Y.S.; Xia, W.S. The apoptosis of grass carp (Ctenopharyngodon idella) muscle during postmortem condition regulated by the cytokines via TOR and NF-κappaB signaling pathways. Food Chem. 2022, 369, 130911. [Google Scholar] [CrossRef] [Scilit]
- Kang, C.; Yeo, D.; Ji, L.L. Muscle immobilization activates mitophagy and disrupts mitochondrial dynamics in mice. Acta Physiol. 2016, 218, 188–197. [Google Scholar] [CrossRef] [Scilit]
- Slimani, L.; Micol, D.; Amat, J.; Delcros, G.; Meunier, B.; Taillandier, D.; Polge, C.; Bechet, D.; Dardevet, D.; Picard, B.; et al. The worsening of tibialis anterior muscle atrophy during recovery post-immobilization correlates with enhanced connective tissue area, proteolysis, and apoptosis. Am. J. Physiol. Endocrinol. Metab. 2012, 303, E1335–E1347. [Google Scholar] [CrossRef] [Scilit]
- Ji, L.L.; Yeo, D. Cellular mechanism of immobilization-induced muscle atrophy: A mini review. Sports Med. Health Sci. 2019, 1, 19–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sandri, M. Autophagy in skeletal muscle. FEBS Lett. 2010, 584, 1411–1416. [Google Scholar] [CrossRef] [Scilit]
- You, J.S.; Anderson, G.B.; Dooley, M.S.; Hornberger, T.A. The role of mTOR signaling in the regulation of protein synthesis and muscle mass during immobilization in mice. Dis. Model Mech. 2015, 8, 1059–1069. [Google Scholar] [CrossRef] [Scilit]
- LeBaron, T.W.; Asgharzadeh, F.; Khazei, M.; Kura, B.; Tarnava, A.; Slezak, J. Molecular hydrogen is comparable to sulfasalazine as a treatment for DSS-induced colitis in mice. EXCLI J. 2021, 20, 1106–1117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Asgharzadeh, F.; Tarnava, A.; Mostafapour, A.; Khazaei, M.; LeBaron, T.W. Hydrogen-rich water exerts anti-tumor effects comparable to 5-fluorouracil in a colorectal cancer xenograft model. World J. Gastrointest. Oncol. 2022, 14, 242–252. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene | Source | Primer | Sequence (5′ to 3′) |
|---|---|---|---|
| GAPDH | Mouse | Forward | CAACGACCCCTTCATTGACC |
| Reverse | CTTCCCATTCTCGGCCTTGA | ||
| NF-KB | Mouse | Forward | CCAGCTTCCGTGTTTGTTCA |
| Reverse | AGGGTTTCGGTTCACTAGTTTCC | ||
| Beclin 1 | Mouse | Forward | ATTTCAGACTGGGTCGCTTG |
| Reverse | TTATTGGCCAAAGCATGGAG | ||
| Bax | Mouse | Forward | AGACAGGGGCCTTTTTGCTAC |
| Reverse | AATTCGCCGGAGACACTCG | ||
| IL-6 | Human | Forward | TCTGGAGCCCACCAAGAACGA |
| Reverse | TTGTCACCAGCATCAGTCCCA | ||
| TNF-α | Mouse | Forward | AGGCTGTCGCTACATCACTG |
| Reverse | CTCTCAATGACCCGTAGGGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nazari, S.E.; Tarnava, A.; Khalili-Tanha, N.; Darroudi, M.; Khalili-Tanha, G.; Avan, A.; Khazaei, M.; LeBaron, T.W. Therapeutic Potential of Hydrogen-Rich Water on Muscle Atrophy Caused by Immobilization in a Mouse Model. Pharmaceuticals 2023, 16, 1436. https://doi.org/10.3390/ph16101436
Nazari SE, Tarnava A, Khalili-Tanha N, Darroudi M, Khalili-Tanha G, Avan A, Khazaei M, LeBaron TW. Therapeutic Potential of Hydrogen-Rich Water on Muscle Atrophy Caused by Immobilization in a Mouse Model. Pharmaceuticals. 2023; 16(10):1436. https://doi.org/10.3390/ph16101436
Chicago/Turabian StyleNazari, Seyedeh Elnaz, Alex Tarnava, Nima Khalili-Tanha, Mahdieh Darroudi, Ghazaleh Khalili-Tanha, Amir Avan, Majid Khazaei, and Tyler W. LeBaron. 2023. "Therapeutic Potential of Hydrogen-Rich Water on Muscle Atrophy Caused by Immobilization in a Mouse Model" Pharmaceuticals 16, no. 10: 1436. https://doi.org/10.3390/ph16101436
APA StyleNazari, S. E., Tarnava, A., Khalili-Tanha, N., Darroudi, M., Khalili-Tanha, G., Avan, A., Khazaei, M., & LeBaron, T. W. (2023). Therapeutic Potential of Hydrogen-Rich Water on Muscle Atrophy Caused by Immobilization in a Mouse Model. Pharmaceuticals, 16(10), 1436. https://doi.org/10.3390/ph16101436

