The Essential Oil from Oliveria decumbens Vent. (Apiaceae) as Inhibitor of Breast Cancer Cell (MCF-7) Growth

Abstract

Oliveria decumbens Vent. is an aromatic and medicinal plant traditionally used in Iran for the treatment of infections, gastrointestinal diseases, cancer, and inflammation. This research was aimed at investigating the pharmacological potential of O. decumbens essential oil (OEO) and its main compounds, focusing on OEO’s cytotoxic effects on MCF-7 breast cancer cells. OEO was obtained by hydro-distillation, and the chemical constituents were identified using GC-MS. Thymol, carvacrol, γ-terpinene, and p-cymene were the main OEO constituents. When MCF-7 cells were treated with OEO, the expressions of genes related to apoptosis (BIM and Bcl-2), tumor suppression (PTEN), and cell growth inhibition (AURKA), were evaluated using real-time PCR. Moreover, molecular docking was used for studying in silico the interaction of OEO principal compounds with PTEN and AURKA. The expression of AURKA was significantly reduced since the OEO treatment enhanced the expression of PTEN. Through in silico molecular docking, it was revealed that thymol, carvacrol, p-cymene, and γ-terpinene can activate PTEN and thus inhibit AURKA. Additionally, the DNA fragmentation assay, acridine orange/ethidium bromide (AO/EB) double-staining assay, and real-time PCR highlighted the fact that the OEO treatment could activate apoptosis and inhibit cell proliferation. Therefore, OEO is a viable candidate to be employed in the pharmaceutical industry, specifically as a possible agent for cancer therapy.

1. Introduction

Genetic damage in cells that exhibit defects in division and mutation is the main cause of cancer. As a serious threat to personal health, breast cancer is the cause of many deaths among women annually and worldwide [1,2]. Cell proliferation, angiogenesis, and death (apoptosis) are regulated by PTEN, a critical signaling molecule that plays a main role in several physiological processes [3]. PTEN is a lipid phosphatase of PI 3-kinase that works to prevent phosphatidylinositol-3 kinase (PI3K) signaling by converting the phosphatidylinositol (3,4,5)-triphoshphate (PIP3) into PIP2 [4]. By blocking the PI3K/AKT/mTOR pathway, PTEN plays a crucial role in regulating intracellular signaling for cell growth and proliferation [5]. The human AURK gene is a member of the serine/threonine kinase family. In human malignancies, Aurora kinases become over-expressed and amplified. Aurora kinase A (AURKA) is over-expressed in cancer and has various roles in carcinogenesis, e.g., the disruption of microtubule stability and cell cycle arrest by phosphorylating the RAS-association domain family 1 [6,7].

There are various types of plant-based anticancer drugs that act against proliferating cells [8]. Plants are recognized as a rich source of biologically active compounds that can be effective in the treatment of chronic diseases [9]. Compared to current breast cancer treatment methods, such as radiology and chemotherapy, plant-based compounds have fewer toxic side-effects. Essential oils (EOs) may be considered an appropriate alternative for cancer treatment [10]. In addition, there are several plant-originated anticancer and antimicrobial compounds, including secondary metabolites and proteins, that entail fewer side-effects [10,11]. Multiple lines of cancer cells are targeted by EOs and their major compounds [12]. EOs can have an antiproliferative impact through a variety of mechanisms, such as cell membrane rupture and apoptosis induction. EOs are considered complex mixtures of volatile compounds which include, to a major extent, terpenoids (mono- and sesquiterpenes) and phenylpropanoids. The chemical constituents of EOs vary among different species and subspecies [13]. Many plant-based EOs have demonstrated antiproliferative activity on MCF7 cells. EOs with potential as chemopreventive agents have been obtained from several plant species such as Schefflera heptaphylla (L.) Frodin [14], Heteropyxis dehniae Suess. [15], Satureja khuzistanica Jamzad [16], and S. intermedia C.A.Mey. [17].

O. decumbens Vent. is a herbaceous plant belonging to Apiaceae which is endemic to Iran and is found in southern and western regions of this country. The plant’s aerial parts are traditionally used in the Persian medicine for treating diarrhea, dyspepsia, abdominal pains, and fever [13,18]. Although the antimicrobial and antioxidant activities of O. decumbens essential oil (OEO) have already been studied, its anticancer activities remain to be clarified in detail [19,20,21].

The traditional background and medicinal effects reported in the literature inspired the current research on the anticancer potential of OEO. Here, the main compounds of OEO were examined for their impact on PTEN activation and AURKA inactivation. Indeed, their interactions with PTEN, a disruptive regulator of the PI3K/AKT signaling pathway, and AURKA have yet to be delineated. Thus, the interaction and effective binding between the main OEO compounds and protein targets of PTEN and AURKA have been studied for their cancer treating potential via in silico molecular docking. In addition, the expressions of genes involved in tumor suppression (PTEN), cell growth inhibition (AURKA), and apoptosis (BIM and Bcl-2) have been measured in cells exposed to OEO.

2. Results

2.1. Chemical Identification by GC/MS (Gas Chromatography–Mass Spectrometry) Analysis

The chemical compounds of OEO were identified by GC/MS. Thymol (26.63%), carvacrol (24.12%), γ-terpinene (19.6%), and p-cymene (19.95%) were the main constituents (

Table 1. The chemical composition of Oliveria decumbens Vent. Essential oil.

No	Compounds	Class a	RI b	RI c	Relative Percentage (%)
1	α-Thujene	MH	927	930	0.14 ± 0.05
2	α-Pinene	MH	934	939	0.18 ± 0.02
3	β-Pinene	MH	973	979	1.53 ± 0.08
4	Limonene	MH	1023	1029	1.00 ± 0.12
5	β–Phellandrene	MH	1021	1030	0.88 ± 0.10
6	p-Cymene	MH	1024	1024	19.95 ± 0.63
7	γ-Terpinene	MH	1050	1059	19.65 ± 0.30
8	cis-Limonene oxide	MO	1117	1132	1.09 ± 0.04
9	trans-Carveol	MO	1200	1215	0.46 ± 0.12
10	Thymol	MO	1271	1290	26.63 ± 1.42
11	Carvacrol	MO	1283	1298	24.12 ± 1.23
12	Eugenol	PP	1339	1356	0.14 ± 0.07
13	Spathulenol	SO	1566	1577	0.17 ± 0.11
14	Myristicin	PP	1494	1522	1.88 ± 0.24
Total	-		-		97.84

^b Retention indices experimentally determined on an HP-5MS column. ^c Retention index value taken from ADAMS library. ^a MH: Monoterpene Hydrocarbons; MO: Oxygenated Monoterpenes; PP: Phenylpropanoids; SO: Oxygenated sesquiterpenes.

).

2.2. Assessment of Antioxidant Activity

DPPH inhibitory activity is considered an important parameter for evaluating the antioxidant potential of chemical compounds of plant origin. The antioxidant activity of tert-butylhydroquinone (TBHQ) as positive control was also determined. The IC₅₀ of OEO was 0.582 ± 0.011 mg/mL, whereas that of TBHQ was 0.030 ± 0.001 mg/mL.

2.3. Cytotoxic Activity

In vitro cytotoxic activities of OEO and doxorubicin (positive control) were expressed as IC₅₀ values which indicated the required dose for 50% inhibition of cell growth (

Table 2. Growth inhibitory effects (IC₅₀ values) of OEO and doxorubicin on the MCF-7 cell line after 24, 48, and 72 h of treatment.

Time (h)	OEO (µg/mL)	Doxorubicin (µg/mL)
24	84.07 * ± 6.66	-
48	39.54 * ± 2.35	0.215 * ± 0.028
72	33.32 * ± 1.14	0.111 * ± 0.036

Asterisks (*) indicate statistical significance caused by the essential oil (p < 0.01), as determined by the t-test. Data are the mean values of three replicates.

).

2.4. Alteration in the Morphology of MCF-7 Cells by Acridine Orange/Ethidium Bromide (AO/EB) Double-Staining

Figure 1A shows that after treatment with OEO, significant morphological changes occurred in the cells. According to this assay, the color of the nucleus in healthy cells, original apoptotic cells, cells with secondary apoptosis, and necrotized cells was yellow, yellow to orange, dark orange, and red, respectively. Ethidium bromide was only detected in cells with damaged membranes. Although acridine orange penetrates into both dead and living cells, only the nucleus of the latter was green colored [22]. Therefore, the color of living cells was generally observed as green (Figure 1B,C). Apoptosis occurred in all treatments with OEO.

2.5. DNA Fragmentation Assay

Apoptosis is characterized by changes in morphology of cells and their nuclei. These changes may occur as cellular contraction, density, and fragmentation of nuclei and plasma membranes. In most cases, this process is associated with chromosomal DNA destruction. The DNA ladder pattern can also be observed in the apoptosis process [23]. After treating the cells with appropriate concentrations of OEO, DNA was extracted using the CTAB method. Figure 1D shows that the DNA ladder was observed in the assayed cultures after treatment with doxorubicin and OEO.

2.6. Expression of BIM, Bcl-2, PTEN, and AURKA Genes in OEO-Treated MCF-7 Cells

As can be seen in Figure 2 (colored nodes), hub genes were identified from all mitochondrial apoptotic genes in the network based on degree analysis. Two factors of Bcl-2 and BIM (Bcl2L11) were selected for anti-apoptotic and pro-apoptotic genes, respectively. It was found that PTEN alterations and protein loss normally occur in breast cancer [24]. PTEN acts as a transcriptional repressor, inhibits cell survival signaling pathways (by AKT-pathway), and negatively regulates human breast carcinoma cell growth [25]. Furthermore, AURKA induces AKT and NF-KB pathways. Therefore, AURKA leads to tumor growth and proliferation through the mentioned pathways [26]. PTEN and AURKA are usually selected as repressor and proliferation genes, respectively.

According to the current study, molecular mechanisms were involved in the occurrence of these effects. The evaluations primarily relied on the ability of OEO to affect the expression levels of Bcl-2, BIM, AURKA, and PTEN. The expressions of Bcl-2 and AURKA were reduced after a 48 h exposure to OEO (Figure 1E). By contrast, an increase in BIM and PTEN led to changes in BIM/Bcl-2 and PTEN/AURKA and, consequently, caused apoptosis which inhibited tumor growth.

2.7. Relationship between Gene Expressions in OEO-Treated MCF-7 Cells

Various correlation analyses were carried out on PTEN, BIM, AURKA, and Bcl-2. According to Pearson’s correlation analysis, there was a positive correlation between the expression levels of PTEN and BIM, but a negative correlation between PTEN and Bcl-2. In addition, a positive correlation existed between AURKA and Bcl-2, but a negative correlation appeared between AURKA and BIM. There was a negative correlation between BIM and Bcl-2 expressions (

Table 3. Correlation between expressions of genes in MCF-7 cells in response to OEO.

		Aurka	Bim	Bcl-2
PTEN	Pearson’s r	−0.947 **	0.886 *	−0.967 **
	p-value	0.004	0.019	0.002
Aurka	Pearson’s r		−0.793	0.962 **
	p-value		0.060	0.002
Bim	Pearson’s r			−0.879 *
	p-value			0.021

** Correlation is significant at the 0.01 level (p-value). * Correlation is significant at the 0.05 level (p-value).

).

2.8. Analysis of Protein–Ligand Interaction of PTEN with Main Compounds of OEO

The docking tests indicated that carvacrol and thymol were better ligands for the PTEN protein when compared to other compounds based on the docking score (

Table 4. Interaction of OEO compounds with PTEN.

Compound IDs	Docking Score	H-Bond Interactions	Hydrophobic Interaction
10364	−5.3	Tyr16, Asp24	Lys128, Arg159, Thr160
6989	−5.4	Asp92, His93, Arg130	Cys124, Lys125, Ala126, Lys128, Gly129, Ile168, Gln171
7461	−4.6	-	Tyr16, Asp24, Lys28, Gly127, Arg159, Thr160
7463	−4.7	-	Tyr16, Asp24, Lys28, Gly127, Arg159, Thr160

). According to earlier reports, the amino acids Cys124, Arg130, His93, Gly127, Asp92, Gln171, Ala126, Lys125, and Lys128 determine the function of the PTEN protein [27]. Finding the potential binding mechanism of the major OEO compounds with the PTEN protein is the main goal of molecular docking. It was interesting to note that the creation of hydrogen bonds had a substantial impact on the interaction of the PTEN protein with thymol and carvacrol. Thymol demonstrated three hydrogen bond interactions with the amino acid residues Arg130, His93, and Asp92. Among these, Asp92 is a key residue of the PTEN catalytic pocket and creates a strong bond with the hydroxyl group of the thymol molecule. Additionally, carvacrol demonstrated two hydrogen bond interactions with the amino acid residues Tyr16 and Asp24 (Figure 3). Through hydrophobic interactions, both p-cymene and γ-terpinene docked. Overall, our findings suggest that thymol and carvacrol act as PTEN activators and may be useful in the treatment of breast cancer.

2.9. AURKA Interaction with Ligands during Molecular Docking

In this study, the docking approach was used for examining how the main compounds of OEO and OC3 interacted with AURKA. The results indicated that carvacrol and thymol are nearly docked at the OC3 binding site. As a result, H-bonds and hydrophobic interactions between either thymol or carvacrol and the AURKA active site were observed, resulting in acceptable ligand–receptor affinity (Figure 4). However, p-cymene and γ-terpinene docked virtually at an active location with a high docking score (

Table 5. Interactions between OEO compounds and AURKA.

Compound IDs	Docking Score	H-Bond Interactions	Hydrophobic Interaction
10364	−7.0	Glu211, Ala213	Leu139, Val147, Ala160, Leu194, Leu210, Tyr212, Gly216, Leu263
6989	−6.2	Ala213	Leu139, Val147, Ala160, Leu210, Tyr212, Gly216, Leu263
7461	−6.7	-	Leu139, Val147, Ala160, Leu194, Leu210, Tyr212, Ala213, Gly216, Leu263
7463	−6.8	-	Leu139, Val147, Ala160, Leu194, Leu210, Tyr212, Ala213, Gly216, Leu263

) through a hydrophobic interaction. Figure 4 shows the protein–ligand complexes with hydrogen bond interactions. Carvacrol can develop H bonds with the Glu 211 and Ala 213 in the hinge region of the Aurora A (Figure 4). The hinge region of Aurora kinase A plays a crucial role in the formation of the catalytic active site and is located at residues 210–216 [28].

3. Discussion

Almost 74% of the new anticancer compounds are natural products or their derivatives [9]. The biological activity of EOs is associated with alteration of the cell membrane permeability and various intracellular targets. EOs may enhance intracellular ROS/RNS levels and trigger apoptosis in cancer cells [29]. Many different forms of cancer, including breast cancer, have been linked to the loss of PTEN function [30]. Some natural anticancer agents can stimulate or increase PTEN gene/protein expression/activity [31]. Aurora A kinase becomes an over-expressed gene in a variety of cancers, including solid tumors and leukemia [26]. In the current research, the OEO treatment increased PTEN expression and resulted in a significant reduction of AURKA, an established regulator of cell survival. OEO increased PTEN, thereby modulating the activity of the PI3K/Akt pathway downstream [32]. The potential anticancer activity of single OEO compounds against the MCF-7 cell line was not examined in the current study. Thus, at this stage, it was not possible to determine which compounds led to the effects seen herein.

OEO chemical analysis using GC/MS showed high percentages of thymol, carvacrol, γ-terpinene, and p-cymene. There was a significant decrease in γ-terpinene percentage, whereas thymol and carvacrol percentages increased through plant growth upon the full flowering stage. Thymol and carvacrol reached their highest percentages during the flowering stage [33]. The cytotoxic impacts of carvacrol on cancer cells have already been documented [34]. In addition, carvacrol was reported to decrease Bcl2/Bax and to induce apoptosis [35]. Thymol is endowed with anti-inflammatory, anticancer, antioxidant, and antimicrobial properties [36]. This compound exerts its anticancer effects through the suppression of cell growth, induction of apoptosis, production of intracellular ROS, depolarization of mitochondrial membrane potential, and activation of various pro-apoptotic mitochondrial proteins in human gastric AGS and breast cancer cells [37,38]. Thus, the antitumor, antioxidant, and antimicrobial activities of OEO [19,20,21] may be related to the presence of thymol and carvacrol. The induction of apoptosis and cell death are regarded as valuable effects of the OEO herein.

We described here the interaction of PTEN and AURKA with four major compounds of OEO. The structure of PTEN encompasses an N-terminal phosphatase domain (residue 7–185) and a C-terminal C2 domain (residue 186–351). The phosphatase domain includes the active site, which performs the protein’s enzymatic action, while the C2 domain binds to the phospholipid membrane [27,39,40]. Therefore, the C-terminus is involved in both protein stability and PTEN function. The OEO inhibited the breast cancer signaling pathway (PI3K/Akt) in tumor cells by increasing the expression level of the tumor-suppressor PTEN protein in MCF-7 cells. The docking showed that carvacrol and thymol were more effective than γ-terpinene and p-cymene in activating the PTEN. As a result, thymol may play a role in inducing apoptotic cell death via activating the PTEN protein.

The poor prognosis of cancer patients is related to the over-expression of AURKA. Thus, AURKA is regarded as a target for cancer treatment [41,42]. The development of AURKA inhibitors has become a major challenge in cancer treatment [43]. Noteworthy, the decrease in AURKA activity by OEO containing high percentages of thymol and carvacrol probably results in the blockage of the active site and reduction of enzyme activity. Thymol and carvacrol interacted with the main chain of AURKA by direct H-bonding, specifically the amino acid residues Glu211 and Ala213. These residues (Glu211 and Ala213) are considered hot spots because they significantly contribute to inhibitor binding interactions. Moreover, several of the structurally conserved AURKA proteins were Leu139, Glu211, and Ala213 [28,44]. Notably, the Ala213 residue is fundamental for the formation of essential H-bond interactions with ligands. These residues are needed for the catalytic activity of AURKA [28]. Thus, carvacrol and thymol are potent inhibitors of the AURKA protein in breast cancer. Studying the interactions of the main compounds of OEO can provide insights into their potential use in breast cancer treatment.

4. Materials and Methods

4.1. Preparation of O. decumbens Vent Essential Oil

Aerial parts of O. decumbens Vent. were collected at full flowering stage from Kazeroun, Fars province, south of Iran (29°35′41.0″ N latitude, 51°44′49.3″ E longitude). Herbarium specimens were recorded by Dr. Ahmad Reza Khosravi with number (55,075) and maintained at the Faculty of Science, Department of Biology at Shiraz University. After drying the plant materials in the shade, OEO was obtained through hydro-distillation using a Clevenger-type apparatus for approximately 4 h. After dehydration with anhydrous sodium sulfate, the OEO was stored in tightly closed dark vials at 4 °C. Finally, the OEO yield (%, v/w) was calculated as the weight of collected oil from dry material × 100. The extraction efficiency was 3%.

4.2. Identification of Oliveria decumbens Vent Essential Oil Components

By applying a flame ionization detector (FID) with the HP-5 capillary column (30 m × 0.32 mm i.d; film thickness 0.25 μm), the GC analysis was carried out on an Agilent 7890-A gas chromatograph (Agilent Technologies, Palo Alto, CA, USA). The injector and detector temperatures were 250 and 280 °C, respectively. Nitrogen, which was associated with a flow rate of 1 mL/min, was applied as the carrier gas. In addition, the range and rate of increase in oven temperature were 60–210 °C and 4 °C/min, respectively. Subsequently, the above-mentioned temperature increased to 240 °C (at a ratio of 20 °C/min). This temperature was isothermally maintained for 8.5 min. The split ratio was 1:50. The GC–MS analysis was carried out on an Agilent gas chromatograph, which was equipped with a fused silica capillary HP-5MS column (30 m × 0.25 mm i.d.; film thickness 0.25 μm) and the 5975-C mass spectrometer detector. Helium was applied as the carrier gas with an ionization voltage of 70 eV. Utilized ion source and interface temperatures were determined to be 230 and 280 °C, respectively, while the mass range was 45 to 550 amu. Conditions of the oven temperature program were similar to those of GC-FID. A homologous series of n-alkanes (C₈–C₂₅) was used to calculate the Retention Indices (RIs) of all components. Then, these values were compared with those reported in the literature [45]. In addition, related mass spectra were compared with those available in the Wiley/NBS data bank (Willey/ChemStation data system and NIST 08/National Institute of Standards and Technology). The peak area percentages were obtained by FID without applying correction factors.

4.3. DPPH Assay

The DPPH method was conducted to test the free radical-scavenging capability using the Blois technique [46]. The antioxidant activity of OEO was measured using the equation below.

% inhibition= {(Abscontrol − Abssample)}/(Abscontrol) × 100

All the examinations were triply performed with IC₅₀ values, which were considered as mean values ± SD of triplicates. Compared to standard/commercial antioxidant (TBHQ), OEOs’ inhibitory concentration (IC₅₀) had to inhibit 50% of DPPH radicals obtained from the standard curve.

4.4. Cell Culture

MCF-7 cells (National Cell Bank, Pasteur Institute of Iran, Teheran, Iran) were cultured in an RPMI 1640 medium (Bioidea Company-Iran, Teheran, Iran) with a pH value of 7.4. This medium was supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Gibco-BRL, Baltimore, MD, USA), 1% penicillin (100 units/mL) (Biosera-Iran, Teheran, Iran), and streptomycin (100 μg/mL) (Biosera-Iran). The cells were also maintained in a humidified atmosphere of CO₂ (5%) at 37 °C.

4.5. Cell Viability Test

To perform cell viability assays, cells were seeded in 96-well tissue culture plates at a density of 1.5 × 10⁴ cells/well in a 0.2 mL medium. The period of cell incubation was 24 h. The colorimetric MTT assay was applied to quantify cell viability. Applying the above-mentioned assay led to the measurement of dimethylthiazol diphenyl tetrazolium bromide reduction into formazan using mitochondrial enzyme succinate dehydrogenase. This reduction capacity represented the number of viable cells. After the 24 h period, the medium was discarded and 200 MTT solutions (Sigma-Aldrich, London, UK) (0.5 mg/mL final concentration) were added to the cells. Reading the absorbance was carried out at 570 nm after shaking through a micro-plate reader (Stat Fax 2100, Ramsey, MN, USA). As illustrated, IC₅₀ values were calculated using GraphPad Prism 4 (GraphPad Software Inc., San Diego, CA, USA).

4.6. Acridine Orange/Ethidium Bromide Staining

Ethidium bromide (EB)/acridine orange (AO)-fluorescence labeling was used for measuring apoptosis and cell viability. The untreated and treated cells were harvested and centrifuged. Cold PBS was used for washing the cell pellets before adding the EB/AO solution (1:1, v/v) at a final concentration of 100 g/mL to the cell suspension. Finally, a fluorescence microscope was used for viewing the labeled cells (Olympus, BX51, Tokyo, Japan).

4.7. DNA Extraction

There are several properties associated with apoptosis, including cellular DNA fragmentation into low-molecular-weight oligomers. Grown cells transform into a confluence which is then incubated with various concentrations of doxorubicin (0.22 µg/mL) and OEO (39.54 µg/mL) for 48 h. Moreover, DNA was extracted using a modified CTAB method [47].

4.8. PPI Network Analysis and Hub Gene Identification

To construct the gene network and find intrinsic apoptosis hub genes, the PPI (Protein–Protein Interaction) analysis was carried out using STRING (http://string.embl.de/, accessed on 15 June 2021). Data visualization was made by Cytoscape (version 3.7.1; http://www.cytoscape.org/, accessed on 15 June 2021). The process of hub detection and subnetwork identification was carried out using CytoHubba. In addition, ‘Degree’ was employed as a topological analysis method, utilized in CytoHubba. Furthermore, the PPI network topology was analyzed using the Hubba plug-in via ‘Degree’.

4.9. RNA Extraction and cDNA Synthesis Genomics

The MCF-7 cell line was routinely maintained in the RPMI 1640 media and supplemented with 10% FBS. The total RNA was extracted through an RNX-Plus reagent kit (Cinnagen, Tehran, Iran) according to the manufacturer’s instructions. Then, the quantity and concentration were measured using a Nanodrop device (Thermo Fisher Scientific, Waltham, MA, USA), while the integrity and quantity of RNA were measured by the visual observation of 28S and 18S rRNA bands on a 1% agarose gel. A first-strand cDNA synthesis kit (Fermentas, Leon-Rot, Germany) was applied to synthesize cDNAs based on the manufacturer’s instructions. DNA-free total RNA (1 μg) was reverse-transcribed using oligo-dT primers (Fermentas, Leon-Rot, Germany), and finally, cDNA samples were stored at −20 °C for future use.

4.10. Primer Design and Quantitative Expression Examination

NCBI nucleotide database (NCBI GenBank) was used for retrieving gene sequences. Allele ID 7 and Vector NTI 11 software were employed for designing PTEN, AURKA, BIM, Bcl-2, and β-actin (internal control gene) primers (

Table 6. Sequences of the primers used for RT-PCR amplification, product sizes, and Ta.

Gene	Primer Sequence 5′→3′	Ta (°C)	Product Length (bp)
Bim	F: CCACCAGCACCATAGAAGAAT	63	135
	R: TAAGGAGCAGGCACAGAGA
PTEN	F: CAGTAGAGGAGCCGTCAA	58.5	108
	R: CAGAGTCAGTGGTGTCAGA
Aurka	F: CATAGAGACATTAAGCCAGAGA	59	157
	R: GCATCCGACCTTCAATCA
Bcl-2	F: AGTGATAATCAAGTCCTTT	60	155
	R: GGCAGTCCAGATGAACCG
β-actin	F: GCCTTTGCCGATCCGC	65	160
	R: GCCGTAGCCGTTGTCG

Ta, temperature annealing; F, Forward; R, Reverse.

). The specifics of all primers were subsequently checked through BLAST. In addition, real-time quantitative analysis of gene expression was performed in a lineGeneK thermal cycler (Bioer, Hangzhou, China). Real-time PCR reactions were prepared in 20 μL total volume that contained 5 μL cDNA (diluted) of cells, 10 μL Master Mix (Real Q Plus 2-X Green Low ROX), and 0.7 μL of 100 pmol of each primer (forward and reverse). Cycling states were made from an initial denaturation step of 94 °C/10 min, which is considered a “hot start”, followed by 40 cycles with 94 °C/10 s at the mentioned annealing temperature for 40 s and 72 °C for 30 s. An extra melting curve analysis in the range of 50–95 °C was utilized in each qPCR reaction to confirm the specific amplification.

4.11. Binding Site and Docking

The specifics of molecular docking, structures of the PTEN tumor suppressor, and Aurora kinase A were obtained from a protein data bank (PDB) (https://www.rcsb.org/, accessed on 17 April 2021) with PDB ID 1D5R and 3UOD at high resolution. The three-dimensional structures of carvacrol (10364), thymol (6989), γ-terpinene (7461), and p-cymene (7463) were obtained from PubChem (https://pubchem.ncbi.nlm.nih.gov/, accessed on 17 April 2021). To confirm parameters for the docking experiments, the original ligand, OC3 (Trifluoromethyl) phenyl] amino} pyrimidin-2-Yl)amino]benzoic acid) in the 3uod.pdb structure, and TLA (L-Tartaric acid) in 1dr5.pdb were used. Using the USCF Chimera software, the protein and ligand were docked, and all potential conformations were retrieved using the default settings. Finally, all results were displayed with PYMOL software, and the docking scores were recorded as binding free energy (ΔG). Furthermore, we used LIGPLOT v.4.5.3 to plot the protein–ligand interactions, which can be downloaded from https://www.ebi.ac.uk/thornton-srv/software/LIGPLOT/, accessed on 30 June 2021. The active binding pockets of ID 1D5R and 3uod were predicted by CASTp (http://sts.bioe.uic.edu/castp/, accessed on 30 June 2021).

4.12. Statistical Analysis

The qPCR provided cycle threshold (CT) values which were used for computing the relative fold expression (2-ΔΔCT method). Statistical analysis was carried out via IBM SPSS Statistics software, version 16. In addition, an unpaired t-test was applied to perform statistical comparisons. p-values less than 0.05 were regarded as statistically significant.

5. Conclusions

In this study, OEO, characterized by thymol, carvacrol, p-cymene, and γ-terpinene, exhibited antiproliferative activity against breast cancer cells. In silico molecular docking simulation showed that thymol and carvacrol may establish proper bonds in the AURKA active site, and thus inhibit this enzyme while activating PTEN. Apoptotic death in OEO-treated MCF-7 cells was also detected using fluorescence microscopy and DNA fragmentation assay. The apoptotic mechanism and the occurrence of antiproliferation were confirmed by an increase in the Bim/Bcl2 ratio and the PTEN/AURKA ratio. Due to the fact that OEO showed antiproliferative activities against MCF-7 cell line, it is required that more investigations should be conducted to deepen the activity on other cancer cell lines and the mechanism of action of OEO’s main constituents. Overall, OEO can be regarded as a promising candidate for developing future anticancer drugs.