Next Article in Journal
Synthesis and Structure–Activity Relationships for the Anti-Mycobacterial Activity of 3-Phenyl-N-(Pyridin-2-ylmethyl)Pyrazolo[1,5-a]Pyrimidin-7-Amines
Next Article in Special Issue
LC–MS/MS Phytochemical Profiling, Antioxidant Activity, and Cytotoxicity of the Ethanolic Extract of Atriplex halimus L. against Breast Cancer Cell Lines: Computational Studies and Experimental Validation
Previous Article in Journal
Applications of the Novel Quantitative Pharmacophore Activity Relationship Method QPhAR in Virtual Screening and Lead-Optimisation
Previous Article in Special Issue
Phytochemicals as Regulators of Tumor Glycolysis and Hypoxia Signaling Pathways: Evidence from In Vitro Studies
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pharmaceuticals
Volume 15
Issue 9
10.3390/ph15091123
pharmaceuticals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Thymoquinone Inhibits JAK/STAT and PI3K/Akt/ mTOR Signaling Pathways in MV4-11 and K562 Myeloid Leukemia Cells

by
Futoon Abedrabbu Al-Rawashde
1,2,
Abdullah Saleh Al-wajeeh
3,
Mansoureh Nazari Vishkaei
4,
Hanan Kamel M. Saad
1,
Muhammad Farid Johan
5,
Wan Rohani Wan Taib
1,
Imilia Ismail
1 and
Hamid Ali Nagi Al-Jamal
1,*
1
School of Biomedicine, Faculty of Health Sciences, Universiti Sultan Zainal Abidin (UniSZA), Terengganu 21300, Malaysia
2
Department of Anatomy and Histology, Faculty of Medicine, Mutah University, Al-Karak 61710, Jordan
3
Anti-Doping Lab Qatar, Doha P.O. Box 27775, Qatar
4
School of Pharmacy, University of 17 August 1945, Jakarta 14350, Indonesia
5
Department of Haematology, School of Medical Sciences, Universiti Sains Malaysia, Kubang Kerian, Kelantan 16150, Malaysia
*
Author to whom correspondence should be addressed.
Pharmaceuticals 2022, 15(9), 1123; https://doi.org/10.3390/ph15091123
Submission received: 22 August 2022 / Revised: 31 August 2022 / Accepted: 5 September 2022 / Published: 8 September 2022
(This article belongs to the Special Issue Anticancer Compounds in Medicinal Plants 2023)
Browse Figures
Review Reports Versions Notes

Abstract

:
Constitutive activation of Janus tyrosine kinase-signal transducer and activator of transcription (JAK/STAT) and Phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin (PI3K/Akt/mTOR) signaling pathways plays a crucial role in the development of acute myeloid leukemia (AML) and chronic myeloid leukemia (CML). Thymoquinone (TQ), one of the main constituents of Nigella sativa, has shown anti-cancer activities in several cancers. However, the inhibitory effect mechanism of TQ on leukemia has not been fully understood. Therefore, this study aimed to investigate the effect of TQ on JAK/STAT and PI3K/Akt/mTOR pathways in MV4-11 AML cells and K562 CML cells. FLT3-ITD positive MV4-11 cells and BCR-ABL positive K562 cells were treated with TQ. Cytotoxicity assay was assessed using WSTs-8 kit. The expression of the target genes was evaluated using RT-qPCR. The phosphorylation status and the levels of proteins involved in JAK/STAT and PI3K/Akt/mTOR pathways were investigated using Jess western analysis. TQ induced a dose and time dependent inhibition of K562 cells proliferation. TQ significantly downregulated PI3K, Akt, and mTOR and upregulated PTEN expression with a significant inhibition of JAK/STAT and PI3K/Akt/mTOR signaling. In conclusion, TQ reduces the expression of PI3K, Akt, and mTOR genes and enhances the expression of PTEN gene at the mRNA and protein levels. TQ also inhibits JAK/STAT and PI3K/Akt/mTOR pathways, and consequently inhibits proliferation of myeloid leukemia cells, suggesting that TQ has potential anti-leukemic effects on both AML and CML cells.

Graphical Abstract

1. Introduction

Leukemia is a group of blood cancers characterized by accumulated acquired somatic genetic alterations in the hematopoietic stem cells (HSCs) resulting in uncontrolled proliferation and differentiation [1,2].
Acute myeloid leukemia (AML) is characterized by distinct genetic abnormalities, such as FLT3-ITD mutation [3]. FLT3-ITD mutation is the most frequently identified genetic event in AML that results in the activation of several signaling pathways, including Janus activated kinase/signal transducer and activator of transcription (JAK/STAT) and Phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin (PI3K/Akt/mTOR) signaling pathways [4,5].
Chronic myeloid leukemia (CML) is initiated by a chromosomal translocation t (9; 22), which results in the formation of a Philadelphia (Ph) chromosome with the BCR-ABL fusion gene [6,7]. The resulting oncoprotein (BCR-ABL) has a constitutive kinase activity that hyperactivates many signaling pathways, including JAK/STAT and PI3K/Akt/mTOR pathways, leading to enhanced hematopoietic cells survival and proliferation [8].
STAT proteins are downstream targets of JAKs that are essential transcription factors in regulating several cellular processes such as proliferation, cell cycle progression, and apoptosis [9]. STATs are constitutively activated through increased production of growth factors [10]. In addition, STATs are hyperactivated by mutated upstream tyrosine kinases, including FLT3-ITD and JAK2 or BCR-ABL oncoprotein [8,11]. Constitutive activation of JAK/STAT pathway has been associated with the pathogenesis of hematological malignancies, including leukemia [12]. Activated JAK2, STAT3, and STAT5 are confirmed in variable leukemia cells [13,14]. Thus, proteins involved in the JAK/STAT pathway are important targets for the treatment of leukemia.
The PI3K/Akt/mTOR signaling pathway plays a critical role in the regulation of cell proliferation, apoptosis, and cell cycle progression [15]. Hyperactivation of the PI3K/Akt/mTOR pathway is crucial for the development of various malignancies, including leukemia [16]. The activity of PI3K is negatively regulated by the phosphatase and tensin homolog (PTEN) protein [17]. Although mutations of PTEN are uncommon in myeloid leukemia, they are often inactivated in AML and CML [18]. Therefore, inhibiting PI3K/Akt/mTOR signaling represents a significant therapeutic target for leukemia treatment.
The outcome of leukemic patient therapy remains poor, with an unsatisfactory survival rate, and chemotherapy is still the first-line treatment for leukemia [19]. The development of tyrosine kinase inhibitors (TKIs) has resulted in significant advancements in leukemia treatment [8]. However, majority of leukemia patients treated with TKIs do not achieve a complete cure and exhibit drug resistance under prolonged therapy [20]. Moreover, several adverse side effects are associated with TKIs treatment [21]. Therefore, identifying alternative therapeutic candidates derived from natural products could substantially affect leukemia treatment.
Natural products are an effective and safe treatment for cancers including leukemia [22]. Thymoquinone (TQ) is a phytochemical compound and is one of the major bioactive components of Nigella sativa seeds [23]. TQ has been reported to inhibit cancer cell growth in various cancers [24,25,26]. However, the effect of TQ on leukemia cells has not been fully understood. Therefore, this study aimed to investigate the effect of TQ on JAK/STAT and PI3K/Akt/mTOR pathways in MV4-11 AML cells and K562 CML cells. For this purpose, cytotoxicity analysis was performed to evaluate the effect of TQ on the proliferation of K562 cells. RT-qPCR was performed to assess the effect of TQ on the expression of PI3K, Akt, mTOR, and PTEN genes in MV4-11 and K562 cells. Jess simple western analysis was conducted to evaluate the effect of TQ on JAK/STAT and PI3K/Akt/mTOR signaling pathways.

2. Results

2.1. Thymoquinone Exhibits a Growth Inhibitory Effect in K562 Cells

The cell viability was investigated using WST-8 assay. Exposure of K562 cells to an increasing concentration of TQ (3 μM, 6 μM, 9 μM, 12 μM, 15 μM, 18 μM, 21 μM, 24 μM, 27 μM, and 30 μM) led to a concentration and time-dependent decrease in the viability of the cells, with IC50 values of 23 µM, 15 µM, and 11 µM cells after 24 h, 48 h, and 72 h of treatment (Figure 1). The cells showed the lowest IC50 value after 72 h of TQ treatment (Figure 1).
In our previous study, we found that TQ decreased the viability of MV4-11 cells in a dose and time-dependent manner with IC50 values of 7.8 µM, 5.5 µM, and 3.8 µM after 24 h, 48 h, and 72 h of treatment, respectively [27].

2.2. Thymoquinone Downregulates Several Genes in PI3K/Akt/mTOR Pathway in MV4-11 and K562 Cells

The mRNA expression levels of PI3K, Akt, mTOR, and PTEN genes in MV4-11 and K562 cells were evaluated by RT-qPCR before and after treatment with TQ. MV4-11 cells were incubated with the IC50 of TQ (5.5 μM) for 48 h. The results of RT-qPCR showed that TQ induced a significant decrease in the mRNA levels of PI3K by 6.3-fold (p < 0.001), Akt by 17.5-fold (p < 0.001), and mTOR by 8.2-fold (p < 0.001) in MV4-11 cells compared to untreated cells. On the other hand, TQ induced a slight increase in the mRNA level of PTEN in MV4-11 cells, but the increase was not significant (p > 0.05) compared to untreated cells (Figure 2A).
K562 cells were treated with the IC50 of TQ (15 μM) for 48 h. The results of RT-qPCR showed that TQ induced a significant decrease in the mRNA levels of PI3K by 25-fold (p < 0.001), Akt by 10.5-fold (p < 0.001), and mTOR by 2.7-fold (p < 0.001) compared to untreated K562 cells. On the other hand, TQ increased the mRNA level of PTEN in K562 cells by 1.3-fold (p < 0.05) compared to untreated cells (Figure 2B).

2.3. Thymoquinone Inhibits JAK/STAT Signaling in MV4-11 Cells

The influence of TQ on the protein levels and the phosphorylation status of STAT3, STAT5, and JAK2 were evaluated in MV4-11 cells using Jess simple western analysis before and after treatment with TQ. MV4-11 cells were incubated with the IC50 of TQ (5.5 μM) for 48 h. Jess simple western analysis results showed that TQ significantly inhibited JAK/STAT signaling in MV4-11 cells by reducing the phosphorylation of STAT3 (p < 0.001), STAT5 (p < 0.05), and JAK2 (p < 0.05) compared to untreated cells (Figure 3 and Table 1). The results also showed that TQ significantly reduced the protein levels of STAT3 (p < 0.05), STAT5 (p < 0.001), and JAK2 (p < 0.01) in MV4-11 cells compared to untreated cells (Figure 3 and Table 1).

2.4. Thymoquinone Inhibits PI3K/Akt/mTOR Signaling in MV4-11 Cells

TQ’s influence on the protein levels and the phosphorylation status of PI3K, Akt, and the protein expression levels of PTEN were evaluated in MV4-11 cells using Jess simple western analysis. MV4-11 cells were incubated with the IC50 of TQ (5.5 μM) for 48 h. The results demonstrated that TQ significantly inhibited PI3K/Akt/mTOR signaling in MV4-11 cells by decreasing the phosphorylation of p-PI3K (p < 0.001) and p-Akt (p < 0.001) compared to untreated cells (Figure 4 and Table 1). The results also demonstrated that TQ significantly reduced the protein levels of PI3K (p < 0.001) and Akt (p < 0.001) in MV4-11 cells compared to untreated cells. On the other hand, TQ induced a significant increase in the protein level of PTEN (p < 0.001) in MV4-11 cells compared to untreated cells (Figure 4 and Table 1).

2.5. Thymoquinone Inhibits PI3K/Akt/mTOR Signaling in K562 Cells

The effects of TQ on the protein expression levels and the phosphorylation status of PI3K and Akt, and the protein expression levels of PTEN were evaluated in K562 cells using Jess simple western analysis. K562 cells were incubated with the IC50 of TQ (15 μM) for 48 h. There was a significant inhibition of PI3K/Akt/mTOR signaling in K562 cells by decreasing the phosphorylation of p-PI3K (p < 0.001) and p-Akt (p < 0.001) compared to untreated cells (Figure 5 and Table 2). The results also demonstrated that TQ significantly reduced the protein levels of PI3K (p < 0.001) and Akt (p < 0.001) compared to untreated cells. On the other hand, TQ induced a significant increase in the protein level of PTEN (p < 0.001) in comparison with untreated cells (Figure 5 and Table 2).

3. Discussion

Despite the significant advances in the treatment of leukemia, the side effects of chemotherapy and the resistance to tyrosine kinase inhibitors (TKIs) represent the main challenges in treating leukemia patients [20,28]. Therefore, searching for new therapeutic alternatives could significantly impact leukemia treatment.
Constitutive activation of JAK/STAT and PI3K/Akt/mTOR signaling pathways are crucial in the pathogenesis of leukemia [16,22,29]. Therefore, proteins involved in JAK/STAT and PI3K/Akt/mTOR pathways provide vital targets for treating leukemia.
The anti-cancer activities of TQ have been demonstrated in several cancers [24,30]. TQ has been shown to inhibit many signaling pathways, including PI3K/Akt /mTOR and JAK/STAT signaling in several cancer cells [23,31]. However, the underlying mechanisms of TQ’s anti-leukemia activities have not been extensively studied.
We have previously reported that TQ exerted anti-leukemia effects by inducing antiproliferative effects and enhancing apoptosis in MV4-11 AML cells and K562 CML cells and through hypomethylation of JAK/STAT and PI3K/Akt/mTOR-negative regulator genes in MV4-11 AML cells [27,32]. In the current study, we have investigated the effect of TQ on JAK/STAT and PI3K/Akt/mTOR signaling pathways in MV4-11 AML cells and K562 CML cells.
The results of the present study showed that TQ induced growth inhibitory effect in K562 cells in a time and dose-dependent manner (Figure 1). Increasing TQ concentration induced a gradual increase in the growth inhibition up to 99% after 72 h of treatment. In addition, the growth inhibitory effect was increased significantly from 57–86% and 97% after incubation with 21 μM TQ for 24 h, 48 h, and 72 h, respectively, indicating a time-dependent course of TQ’s growth inhibitory effect. Our results are consistent with our previous findings of TQ’s time and dose-dependent course of growth inhibition in MV4-11 cells [27].
Regulation of PI3K/Akt/mTOR signaling has a crucial role in normal hematopoiesis [15]. Aberrant expression of PI3K, Akt, mTOR, and PTEN plays an essential role in the leukemogenesis [33,34]. Therefore, genes involved in PI3K/Akt/mTOR signaling provide critical molecular targets for the treatment of myeloid leukemia. In the current study, to further explore the underlying mechanism behind the antiproliferative and enhancement of apoptotic activities of TQ on MV4-11 and K562 cells, the effect of TQ on the expression of PI3K, Akt, mTOR, and PTEN was evaluated in MV4-11 and K562 cells. The findings revealed a significant decrease in the mRNA levels of PI3K, Akt, and mTOR in both MV4-11 cells (Figure 2A) and K562 cells (Figure 2B). Additionally, the findings showed that the mRNA level of PTEN was significantly increased in MV4-11 and K562 cells after TQ treatment (Figure 2A,B). The results of this study are in agreement with a recent study that showed that the in vivo administration of TQ downregulated the mRNA levels of PI3K, Akt, and mTOR in hamster oral cancer [35]. The results of this study are also in agreement with a previous study that reported that TQ treatment increased the expression of PTEN at the mRNA level in MCF-7 human breast adenocarcinoma cells [36], and Her2+ and Her2− breast cancer cells [37].
In AML cells, activation of FLT3 tyrosine kinase is frequent and results in dysregulation of PI3K/Akt/mTOR [16]. In addition, BCR-ABL oncogenic protein induces activation of PI3K/Akt/mTOR pathway by several mechanisms in CML cells [22,29]. Moreover, the inactivation of PTEN is associated with leukemogenesis and is frequently inhibited in AML and CML cells [18]. Thus, inhibition of PI3K/Akt/mTOR signaling and re-expression of PTEN protein might provide important therapeutic targets for the treatment of myeloid leukemia.
In the current study, the effect of TQ on the expression of PTEN protein and the activation status and the expression of proteins involved in PI3K/Akt/mTOR signaling were evaluated in MV4-11 and K562 cells. The findings indicated that TQ significantly reduced the phosphorylation of PI3K and Akt proteins in MV4-11 cells (Figure 4 and Table 1), and K562 cells (Figure 5 and Table 2). The results also showed that TQ dramatically reduced the protein expression level of PI3K and Akt, and increased the protein expression level of PTEN in MV4-11 cells (Figure 4 and Table 1) and K562 cells (Figure 5 and Table 2). These findings were supported by the results of gene expression analysis, indicating that TQ downregulated PI3K and Akt and upregulated PTEN at the mRNA and protein levels. Similarly, TQ reduced the phosphorylation and the protein expression level of Akt in ML-1, MV4-11, and Kasumi-1 leukemia cells [24], MDA-MB-231, and MDA-MB-436 triple-negative breast cancer (TNBC) cells [25], and Her2+ and Her2− breast cancer cells [37]. Moreover, TQ inhibited the phosphorylation of PI3K and Akt in oral squamous cell carcinoma (KB) cells [38]. Another study has demonstrated that the PTEN protein level was increased, and the PI3K protein level and the phosphorylation of its downstream molecules; Akt and mTOR, were decreased in K562 cells after treatment with ND-09 inhibitory compound [39].
Aberrant activation of JAK/STAT signaling has been associated with the development of hematopoietic malignancies including AML and CML [40,41]. FLT3-ITD and BCR-ABL oncoproteins have constitutive tyrosine kinase activities, which induce hyperactivation of signal transduction pathways, including JAK/STAT signaling [22,42]. Thus, inhibition of JAKs and STATs represents a potential strategy for treating AML and CML [43].
In this study, TQ’s effect on JAK/STAT signaling in MV4-11 cells was evaluated. The results showed that TQ significantly decreased the phosphorylation and protein levels of STAT3, STAT5, and JAK2 proteins in MV4-11 cells (Figure 3 and Table 1) and K562 cells (Data not shown) compared to untreated cells.
The results of the current study indicated that TQ induced the inhibition of JAK/STAT signaling, which inhibited growth and enhanced apoptosis in MV4-11 cells as reported previously in our published data [27]. These findings were consistent with our previous findings in which TQ decreased the phosphorylation and the protein levels of JAK2, STAT3, and STAT5 in HL60 AML cells [44]. The results were also supported by the findings of a previous study in which TQ treatment reduced the phosphorylation of JAK2 and STAT3 in SK-MEL-28 melanoma cells [30]. Additionally, Pang et al. 2017 have reported that TQ treatment reduced the phosphorylation and protein expression level of STAT5 in ML-1, MV4-11, and Kasumi-1 leukemia cells [24]. Another study demonstrated that TQ treatment inhibited the phosphorylation of STAT3 in HGC27, SGC7901, and BGC823 gastric cancer cells, and inhibited the phosphorylation of JAK2 in HGC27 cells [14].
Taken together, TQ downregulates the expression of PI3K, Akt, and mTOR, and upregulates the expression of PTEN. In addition, TQ inhibits PI3K/Akt/mTOR and JAK/STAT signaling in myeloid leukemia cells, which was associated with growth inhibition of leukemia cells.

4. Materials and Methods

4.1. Cell Culture

FLT3-ITD positive MV4-11 AML cells were purchased from Elabscience Biotechnology Co., Ltd., (Wuhan, China). BCR-ABL positive K562 CML cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). Roswell Park Memorial Institute (RPMI) medium, fetal bovine serum (FBS), and penicillin/streptomycin (P/S) solution were purchased from Elabscience Biotechnology Co., Ltd., (Wuhan, China). MV4-11 and K562 cells were cultured in an RPMI medium supplemented with 10% FBS and 1% P/S and maintained in a humidified incubator supplied with 5% carbon dioxide (CO2) at 37 °C. The cells were subcultured at a density of 5 × 104 cells/mL until 80% confluency.

4.2. Treatment with Thymoquinone

Thymoquinone (>98% pure), purchased from Sigma-Aldrich (Sigma-Aldrich Corp., Louis, MO, USA). A 30 mM stock solution of TQ was prepared in 1 mL of 100% dimethyl sulfoxide (DMSO) and kept at −80 °C. To prevent cytotoxicity of DMSO, the stock solution of TQ was serially diluted with culture media. After that, treatment concentrations of TQ (15 µM for K562 cells treatment and 5.5 µM for MV4-11 cells treatment) were prepared with final concentrations of DMSO of 0.048% and 0.017% for K562 cells treatment and MV4-11 cells treatment, respectively.

4.3. Cytotoxicity Analysis by WST-8 Assay

In the current study, the cytotoxic effect of TQ on K562 cells was investigated using the Cell counting water-soluble tetrazolium salt-8 (WST-8) kit (Nacalai Tesque, Inc., Kyoto, Japan). K562 cells were cultured in 96-well culture plates at a density of 5 × 103 viable cells/100 μL RPMI medium. The plates were then incubated in a humidified incubator (5% CO2, at 37 °C) for 24 h. After that, TQ solutions were prepared at varying concentrations (0 μM, 3 μM, 6 μM, 9 μM, 12 μM, 15 μM, 18 μM, 21 μM, 24 μM, 27 μM, and 30 μM), and 10 μL were added to the desired wells. The plates were then incubated for 24 h, 48 h, and 72 h. Following treatment, 10 μL of WST-8 solution was added to each well and incubated for another 4 h. The relative cell viability was assessed by measuring the absorbance at 450 nm (reference wavelength 600 nm) using a microplate reader (Infinite M200, Tecan, Männedorf, Switzerland).
In our previous study, the cytotoxic effect of TQ on MV4-11 cells was investigated, and the IC50 values of TQ on MV4-11 cells were determined after 24 h, 48 h, and 72 h of treatment [27].

4.4. RNA Extraction

MV4-11 and K562 cells were treated with the IC50 of TQ; 5.5 µM and 15 μM, respectively, for 48 h. Total cellular RNA was extracted from both TQ-treated and untreated cells using ReliaPrep™ RNA Cell Miniprep System RNA extraction kit (Promega, Madison, WI, USA) according to the instructions of the manufacturer. Nanodphotometer (Implen, Weslake Village, CA, USA) was used to measure the purity and concentration of the extracted RNA.

4.5. Reverse Transcriptase Quantitative PCR (RT-qPCR)

First, 100 ng of RNA was reverse transcribed into cDNA using GoTaq® 2-Step RT-qPCR System kit (Promega, USA) according to the manufacturer’s instructions. The expression of PI3K, Akt, mTOR, and PTEN was analyzed using SYBR Green-based GoTaq 2-Step RT–qPCR System kit (Promega, Madison, WI, USA). The PCR reactions were performed in triplicates. Each PCR reaction contained 10 μL of GoTaq® qPCR Master Mix (2×), 0.2 μL of CXR reference dye, 1 μL of forward (20×) and reverse primers (20X), 6.8 μL nuclease-free water, and 2 μL of cDNA template (2 μL of nuclease-free water were added to the no template control (NTC)). The cycling conditions for the RT-qPCR reactions were as follows: activation of GoTaq® DNA Polymerase, 2 min at 95 °C; denaturation step, 40 cycles at 95 °C for 15 s; annealing and extension, 40 cycles at 60 °C for 1 min. RT-qPCR was analyzed using Applied Biosystem StepOnePlus ™ thermocycler (Applied Biosystems, Foster City, CA, USA). The sequences of the primer sets used for PCR amplification are listed in Table 3. Data were analyzed by StepOne Software v2.3 (ABI step one plus, Foster City, CA, USA). The relative expression levels of the genes were determined using RT-qPCR and the 2−∆∆Cq method [45] after normalization to the endogenous reference β-actin, and the results were presented as fold changes.

4.6. Total Cell Lysates Preparation

The IC50 of TQ; 5.5 µM and 15 μM were used to treat MV4-11 and K562 cells, respectively, for 48 h. After that, the treated and untreated cells were lysed with RIPA buffer containing a protease inhibitor cocktail (Nacalai Tesque, Kyoto, Japan) and phosphatase inhibitor solution (Nacalai Tesque, Kyoto, Japan). The protein concentrations were measured by Bradford protein assay [49], using bovine serum albumin (BSA) and Coomassie brilliant blue (CBB) solution from Nacalai tesque, Inc. (Kyoto, Japan).

4.7. Protein Expression Analysis Using JESS Simple Western Analysis

Protein expression was investigated using the capillary-based Protein Simple Jess system (Jess; Protein Simple, San Jose, CA, USA). Briefly, 1 mg/mL concentration of the cell lysates was prepared after dilution with a sample buffer. Each sample was mixed with a master mix (1× fluorescent standard, 1× sample buffer, and 40 mM dithiothreitol) and heated at 95 °C for 5 min to denature the samples. After that, 3 μL of the denatured proteins and 10 μL of each protein normalization solution, chemiluminescent substrate, primary antibodies, and HRP-conjugated anti-mouse secondary antibodies were pipetted into the appropriate wells of the assay plate. Biotinylated ladder cartridge (12–230 kDa) was integrated for each assay. Subsequently, the plate and the capillaries were subjected to Jess machine for automated protein electrophoresis, blocking, antibody incubation, and signal detection. Within-capillary total protein normalization was performed to account for any differences in protein loading. Normalization reagent allowed the detection of total proteins in the capillary through the binding to the amine group by a biomolecule while also removing housekeeping proteins that might cause inconsistency and unreliability in the protein’s expression. With the Jess technology, no loading control is required. Chemiluminescent reactions were analyzed by Compass software (ProteinSimple). Relative protein amounts were assessed using the corrected area of chemiluminescent peaks. The primary antibodies used for Jess simple western analysis and their suppliers are listed in Table 4.

5. Conclusions

The effect of TQ against MV4-11 AML cells and K562 CML cells was evaluated. Based on our current findings, it can be concluded that TQ-induced growth inhibition of leukemia cells was associated with reduced expression of PI3K, Akt, and mTOR genes and re-expression of PTEN gene at the mRNA and protein levels. Moreover, TQ induced inhibition of PI3K/Akt/mTOR and JAK/STAT signaling pathways, which was associated with inhibition of proliferation of the leukemia cells. The results of this study suggest that TQ has potential anti-leukemic effects on both AML and CML cells. However, further experiments are required to evaluate the molecular mechanisms underlying TQ’s anti-leukemia activities in vivo and in clinical trials.

Author Contributions

Experiments design, F.A.A.-R. and H.A.N.A.-J.; experiments investigation, F.A.A.-R.; data collection and analysis, F.A.A.-R. and H.A.N.A.-J.; statistical analysis and results interpretation, F.A.A.-R. and H.A.N.A.-J.; software, F.A.A.-R., M.N.V., H.K.M.S. and H.A.N.A.-J.; validation, F.A.A.-R., H.A.N.A.-J., H.K.M.S. and W.R.W.T.; curation of data, F.A.A.-R.; resources, H.A.N.A.-J.; drafting of manuscript F.A.A.-R.; reviewing and editing of the manuscript, F.A.A.-R., H.A.N.A.-J., M.F.J., Taib, W.R.W.T., A.S.A.-w. and I.I.; supervision and acquisition of the fund, H.A.N.A.-J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Fundamental Research Grant Scheme of the Ministry of Education, Malaysia [FRGS/1/2019/SKK08/UNISZA/02/3 (RR330)].

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data sharing contain in this article.

Acknowledgments

We acknowledge the laboratory staff in Medical School, Universiti Sultan Zainal Abidin for cooperation.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Bispo, J.A.B.; Pinheiro, P.S.; Kobetz, E.K. Epidemiology and etiology of leukemia and lymphoma. Cold Spring Harb. Perspect. Med. 2020, 10, a034819. [Google Scholar] [CrossRef]
  2. Liu, X.-L.; Liu, H.-Q.; Li, J.; Mao, C.-Y.; He, J.-T.; Zhao, X. Role of epigenetic in leukemia: From mechanism to therapy. Chem.-Biol. Interact. 2020, 317, 108963. [Google Scholar] [CrossRef] [PubMed]
  3. Vela-Ojeda, J.; Cardenas, P.V.; Esparza, M.A.G.-R.; Cervantes, L.A.M.; Chavez, J.G.; Caballero, A.H.; Majluf-Cruz, A.; Vega-López, A.; Reyes-Maldonado, E. FLT3-ITD and CD135 over-expression are frequent findings of poor survival in adult patients with acute leukemias. Arch. Med. Res. 2021, 52, 217–223. [Google Scholar] [CrossRef] [PubMed]
  4. Boddu, P.C.; Kadia, T.M.; Garcia-Manero, G.; Cortes, J.; Alfayez, M.; Borthakur, G.; Konopleva, M.; Jabbour, E.J.; Daver, N.G.; DiNardo, C.D. Validation of the 2017 European LeukemiaNet classification for acute myeloid leukemia with NPM1 and FLT3-internal tandem duplication genotypes. Cancer 2019, 125, 1091–1100. [Google Scholar] [CrossRef]
  5. Niparuck, P.; Limsuwanachot, N.; Pukiat, S.; Chantrathammachart, P.; Rerkamnuaychoke, B.; Magmuang, S.; Phusanti, S.; Boonyawat, K.; Puavilai, T.; Angchaisuksiri, P.; et al. Cytogenetics and FLT3-ITD mutation predict clinical outcomes in non transplant patients with acute myeloid leukemia. Exp. Hematol. Oncol. 2019, 8, 1–14. [Google Scholar] [CrossRef]
  6. Rowley, J.D. A new consistent chromosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature 1973, 243, 290–293. [Google Scholar] [CrossRef] [PubMed]
  7. Yu, C.; Gorantla, S.P.; Müller-Rudorf, A.; Müller, T.A.; Kreutmair, S.; Albers, C.; Jakob, L.; Lippert, L.J.; Yue, Z.; Engelhardt, M.; et al. Phosphorylation of BECLIN-1 by BCR-ABL suppresses autophagy in chronic myeloid leukemia. Haematologica 2020, 105, 1285. [Google Scholar] [CrossRef]
  8. Braun, T.P.; Eide, C.A.; Druker, B.J. Response and resistance to BCR-ABL1-targeted therapies. Cancer Cell 2020, 37, 530–542. [Google Scholar] [CrossRef]
  9. Xin, P.; Xu, X.; Deng, C.; Liu, S.; Wang, Y.; Zhou, X.; Ma, H.; Wei, D.; Sun, S. The role of JAK/STAT signaling pathway and its inhibitors in diseases. Int. Immunopharmacol. 2020, 80, 106210. [Google Scholar] [CrossRef]
  10. Zhu, L.; Li, Q.; Wang, X.; Liao, J.; Zhang, W.; Gao, L.; Liu, Y.; Zhang, C.; Zhang, X.; Rao, J.; et al. THBS1 is a novel serum prognostic factors of acute myeloid leukemia. Front. Oncol. 2020, 9, 1567. [Google Scholar] [CrossRef]
  11. Patel, A.B.; Pomicter, A.D.; Yan, D.; Eiring, A.M.; Antelope, O.; Schumacher, J.A.; Kelley, T.W.; Tantravahi, S.K.; Kovacsovics, T.J.; Shami, P.J. Dasatinib overcomes stroma-based resistance to the FLT3 inhibitor quizartinib using multiple mechanisms. Leukemia 2020, 34, 2981–2991. [Google Scholar] [CrossRef] [PubMed]
  12. Liu, K.; Wu, Z.; Chu, J.; Yang, L.; Wang, N. Promoter methylation and expression of SOCS3 affect the clinical outcome of pediatric acute lymphoblastic leukemia by JAK/STAT pathway. Biomed. Pharmacother. 2019, 115, 108913. [Google Scholar] [CrossRef] [PubMed]
  13. Venugopal, S.; Bar-Natan, M.; Mascarenhas, J.O. JAKs to STATs: A tantalizing therapeutic target in acute myeloid leukemia. Blood Rev. 2020, 40, 100634. [Google Scholar] [CrossRef]
  14. Zhu, W.-Q.; Wang, J.; Guo, X.-F.; Liu, Z.; Dong, W.-G. Thymoquinone inhibits proliferation in gastric cancer via the STAT3 pathway in vivo and in vitro. World J. Gastroenterol. 2016, 22, 4149. [Google Scholar] [CrossRef]
  15. Darici, S.; Alkhaldi, H.; Horne, G.; Jørgensen, H.G.; Marmiroli, S.; Huang, X. Targeting PI3K/Akt/mTOR in AML: Rationale and clinical evidence. J. Clin. Med. 2020, 9, 2934. [Google Scholar] [CrossRef] [PubMed]
  16. Nepstad, I.; Hatfield, K.J.; Grønningsæter, I.S.; Reikvam, H. The PI3K-Akt-mTOR signaling pathway in human acute myeloid leukemia (AML) cells. Int. J. Mol. Sci. 2020, 21, 2907. [Google Scholar] [CrossRef]
  17. Zheng, C.; Tang, F.; Min, L.; Hornicek, F.; Duan, Z.; Tu, C. PTEN in osteosarcoma: Recent advances and the therapeutic potential. Biochim. Biophys. Acta-Rev. Cancer 2020, 1874, 188405. [Google Scholar] [CrossRef]
  18. Bazzichetto, C.; Conciatori, F.; Pallocca, M.; Falcone, I.; Fanciulli, M.; Cognetti, F.; Milella, M.; Ciuffreda, L. PTEN as a prognostic/predictive biomarker in cancer: An unfulfilled promise? Cancers 2019, 11, 435. [Google Scholar] [CrossRef]
  19. Hackl, H.; Astanina, K.; Wieser, R. Molecular and genetic alterations associated with therapy resistance and relapse of acute myeloid leukemia. J. Hematol. Oncol. 2017, 10, 1–16. [Google Scholar] [CrossRef]
  20. Maiti, A.; Franquiz, M.J.; Ravandi, F.; Cortes, J.E.; Jabbour, E.J.; Sasaki, K.; Marx, K.; Daver, N.G.; Kadia, T.M.; Konopleva, M.Y.; et al. Venetoclax and BCR-ABL tyrosine kinase inhibitor combinations: Outcome in patients with philadelphia chromosome-positive advanced myeloid leukemias. Acta Haematol. 2020, 143, 567–573. [Google Scholar] [CrossRef]
  21. Zhang, Y.; Yan, H.; Xu, Z.; Yang, B.; Luo, P.; He, Q. Molecular basis for class side effects associated with PI3K/AKT/mTOR pathway inhibitors. Expert Opin. Drug Metab. Toxicol. 2019, 15, 767–774. [Google Scholar] [CrossRef] [PubMed]
  22. Singh, P.; Kumar, V.; Gupta, S.K.; Kumari, G.; Verma, M. Combating TKI resistance in CML by inhibiting the PI3K/Akt/mTOR pathway in combination with TKIs: A review. Med. Oncol. 2021, 38, 1–16. [Google Scholar] [CrossRef] [PubMed]
  23. Shanmugam, M.K.; Arfuso, F.; Kumar, A.P.; Wang, L.; Goh, B.C.; Ahn, K.S.; Bishayee, A.; Sethi, G. Modulation of diverse oncogenic transcription factors by thymoquinone, an essential oil compound isolated from the seeds of Nigella sativa Linn. Pharmacol. Res. 2018, 129, 357–364. [Google Scholar] [CrossRef] [PubMed]
  24. Pang, J.; Shen, N.; Yan, F.; Zhao, N.; Dou, L.; Wu, L.-C.; Seiler, C.L.; Yu, L.; Yang, K.; Bachanova, V.; et al. Thymoquinone exerts potent growth-suppressive activity on leukemia through DNA hypermethylation reversal in leukemia cells. Oncotarget 2017, 8, 34453. [Google Scholar] [CrossRef]
  25. Kabil, N.; Bayraktar, R.; Kahraman, N.; Mokhlis, H.A.; Calin, G.A.; Lopez-Berestein, G.; Ozpolat, B. Thymoquinone inhibits cell proliferation, migration, and invasion by regulating the elongation factor 2 kinase (eEF-2K) signaling axis in triple-negative breast cancer. Breast Cancer Res. Treat. 2018, 171, 593–605. [Google Scholar] [CrossRef]
  26. Almajali, B.; Al-Jamal, H.A.N.; Taib, W.R.W.; Ismail, I.; Johan, M.F.; Doolaanea, A.A.; Ibrahim, W.N. Thymoquinone, as a novel therapeutic candidate of cancers. Pharmaceuticals 2021, 14, 369. [Google Scholar] [CrossRef]
  27. Al-Rawashde, F.A.; Johan, M.F.; Taib, W.R.W.; Ismail, I.; Johari, S.A.T.T.; Almajali, B.; Al-Wajeeh, A.S.; Vishkaei, M.N.; Nazari, V.M.; Al-Jamal, H.A.N. Thymoquinone Inhibits Growth of Acute Myeloid Leukemia Cells through Reversal SHP-1 and SOCS-3 Hypermethylation: In Vitro and In Silico Evaluation. Pharmaceuticals 2021, 14, 1287. [Google Scholar] [CrossRef]
  28. Al-Jamal, H.A.N.; Johan, M.F.; Jusoh, S.A.M.; Ismail, I.; Taib, W.R.W. Re-expression of bone marrow proteoglycan-2 by 5-azacytidine is associated with STAT3 inactivation and sensitivity response to imatinib in resistant CML cells. Asian Pac. J. Cancer Prev. 2018, 19, 1585. [Google Scholar]
  29. Roshandel, E.; Noorazar, L.; Farhadihosseinabadi, B.; Mehdizadeh, M.; Kazemi, M.H.; Parkhideh, S. PI3 kinase signaling pathway in hematopoietic cancers: A glance in miRNA’s role. J. Clin. Lab. Anal. 2021, 35, e23725. [Google Scholar] [CrossRef]
  30. Raut, P.K.; Lee, H.S.; Joo, S.H.; Chun, K.-S. Thymoquinone induces oxidative stress-mediated apoptosis through downregulation of Jak2/STAT3 signaling pathway in human melanoma cells. Food Chem. Toxicol. 2021, 157, 112604. [Google Scholar] [CrossRef]
  31. Zhang, Y.; Fan, Y.; Huang, S.; Wang, G.; Han, R.; Lei, F.; Luo, A.; Jing, X.; Zhao, L.; Gu, S.; et al. Thymoquinone inhibits the metastasis of renal cell cancer cells by inducing autophagy via AMPK/mTOR signaling pathway. Cancer Sci. 2018, 109, 3865–3873. [Google Scholar] [CrossRef] [PubMed]
  32. Al-Rawashde, F.A.; Taib, W.R.W.; Ismail, I.; Johan, M.F.; Al-Wajeeh, A.S.; Al-Jamal, H.A.N. Thymoquinone Induces Downregulation of BCR-ABL/JAK/STAT Pathway and Apoptosis in K562 Leukemia Cells. Asian Pac. J. Cancer Prev. 2021, 22, 3959–3965. [Google Scholar] [CrossRef] [PubMed]
  33. Panah, M.Z.; Nikbakht, M.; Sajjadi, S.M.; Rostami, S.; Norooznezhad, A.H.; Fumani, H.K.; Ghavamzadeh, A.; Mohammadi, S. Anti-apoptotic effects of osteopontin via the up-regulation of AKT/mTOR/β-catenin loop in acute myeloid leukemia cells. Int. J. Hematol. Oncol. Stem Cell. Res. 2017, 11, 148. [Google Scholar]
  34. Xie, C.; He, Y.; Zhen, M.; Wang, Y.; Xu, Y.; Lou, L. Puquitinib, a novel orally available PI 3Kδ inhibitor, exhibits potent antitumor efficacy against acute myeloid leukemia. Cancer Sci. 2017, 108, 1476–1484. [Google Scholar] [CrossRef] [PubMed]
  35. Pu, Y.; Hu, S.; Chen, Y.; Zhang, Q.; Xia, C.; Deng, H.; Wang, Y.; Hu, Q. Thymoquinone loaded calcium alginate and polyvinyl alcohol carrier inhibits the 7, 12-dimethylbenz [a] anthracene-induced hamster oral cancer via the down-regulation of PI3K/AKT/mTOR signaling pathways. Environ. Toxicol. 2021, 36, 339–351. [Google Scholar] [CrossRef]
  36. Arafa, E.-S.A.; Zhu, Q.; Shah, Z.I.; Wani, G.; Barakat, B.M.; Racoma, I.; El-Mahdy, M.A.; Wani, A.A. Thymoquinone up-regulates PTEN expression and induces apoptosis in doxorubicin-resistant human breast cancer cells. Mutat. Res. Fundam. Mol. Mech. Mutagen. 2011, 706, 28–35. [Google Scholar] [CrossRef]
  37. Khan, A.; Aldebasu, Y.H.; Alsuhaibani, S.A.; Khan, M.A. Thymoquinone augments cyclophosphamide-mediated inhibition of cell proliferation in breast cancer cells. Asian Pac. J. Cancer Prev. 2019, 20, 1153. [Google Scholar] [CrossRef]
  38. Ren, X.; Luo, W. Exploration of pro-apoptotic effect of Thymoquinone on oral squamous cell carcinoma cells through PI3K/Akt signaling pathway. Cell. Mol. Biol. 2019, 65, 61–64. [Google Scholar] [CrossRef]
  39. Liu, Y.-H.; Zhu, M.; Lei, P.-P.; Pan, X.-Y.; Ma, W.-N. ND-09 inhibits chronic myeloid leukemia K562 cell growth by regulating BCR-ABL signaling. Oncol. Rep. 2021, 46, 1–10. [Google Scholar] [CrossRef]
  40. Fasouli, E.S.; Katsantoni, E. JAK-STAT in early hematopoiesis and leukemia. Front. Cell Dev. Biol. 2021, 9, 1219. [Google Scholar] [CrossRef]
  41. Hammarén, H.M.; Virtanen, A.T.; Raivola, J.; Silvennoinen, O. The regulation of JAKs in cytokine signaling and its breakdown in disease. Cytokine 2019, 118, 48–63. [Google Scholar] [CrossRef] [PubMed]
  42. Yang, J.; Lindström, H.J.G.; Friedman, R. Combating drug resistance in acute myeloid leukaemia by drug rotations: The effects of quizartinib and pexidartinib. Cancer Cell Int. 2021, 21, 1–14. [Google Scholar] [CrossRef] [PubMed]
  43. Mu, H.; Zhu, X.; Jia, H.; Zhou, L.; Liu, H. Combination Therapies in Chronic Myeloid Leukemia for Potential Treatment-Free Remission: Focus on Leukemia Stem Cells and Immune Modulation. Front. Oncol. 2021, 11, 1657. [Google Scholar] [CrossRef] [PubMed]
  44. Almajali, B.; Johan, M.F.; Al-Wajeeh, A.S.; Taib, W.R.W.; Ismail, I.; Alhawamdeh, M.; Al-Tawarah, N.M.; Ibrahim, W.N.; Al-Rawashde, F.A.; Al-Jamal, H.A.N. Gene Expression Profiling and Protein Analysis Reveal Suppression of the C-Myc Oncogene and Inhibition JAK/STAT and PI3K/AKT/mTOR Signaling by Thymoquinone in Acute Myeloid Leukemia Cells. Pharmaceuticals 2022, 15, 307. [Google Scholar] [CrossRef] [PubMed]
  45. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  46. Chen, M.; Lu, J.; Wei, W.; Lv, Y.; Zhang, X.; Yao, Y.; Wang, L.; Ling, T.; Zou, X. Effects of proton pump inhibitors on reversing multidrug resistance via downregulating V-ATPases/PI3K/Akt/mTOR/HIF-1α signaling pathway through TSC1/2 complex and Rheb in human gastric adenocarcinoma cells in vitro and in vivo. Oncol. Targets Ther. 2018, 11, 6705. [Google Scholar] [CrossRef]
  47. Yi, W.; Li, D.; Guo, Y.; Zhang, Y.; Huang, B.; Li, X. Sevoflurane inhibits the migration and invasion of glioma cells by upregulating microRNA-637. Int. J. Mol. Med. 2016, 38, 1857–1863. [Google Scholar] [CrossRef]
  48. Relles, D.; Chipitsyna, G.I.; Gong, Q.; Yeo, C.J.; Arafat, H.A. Thymoquinone promotes pancreatic cancer cell death and reduction of tumor size through combined inhibition of histone deacetylation and induction of histone acetylation. Adv. Prev. Med. 2016, 2016, 1407840. [Google Scholar] [CrossRef]
  49. Kielkopf, C.L.; Bauer, W.; Urbatsch, I.L. Bradford assay for determining protein concentration. Cold Spring Harb. Protoc. 2020, 2020, 102269. [Google Scholar] [CrossRef] [PubMed]
Pharmaceuticals 15 01123 g001 550
Figure 1. TQ’s dose and time-dependent inhibitory effects on the proliferation of K562 cells. The WST-8 assay was used to assess the cytotoxicity effects of TQ at different concentrations (3 μM, 6 μM, 9 μM, 12 μM, 15 μM, 18 μM, 21 μM, 24 μM, 27 μM, and 30 μM) on K562 cells after 24 h, 48 h, and 72 h of treatment, the IC50 values were 23 μM, 15 μM, and 11 μM, respectively. Wilcoxon signed ranks test was conducted and the results are stated as the median of four independent experiments, * p < 0.05, ** p < 0.01, and *** p < 0.001 are significant versus untreated control cells.
Figure 1. TQ’s dose and time-dependent inhibitory effects on the proliferation of K562 cells. The WST-8 assay was used to assess the cytotoxicity effects of TQ at different concentrations (3 μM, 6 μM, 9 μM, 12 μM, 15 μM, 18 μM, 21 μM, 24 μM, 27 μM, and 30 μM) on K562 cells after 24 h, 48 h, and 72 h of treatment, the IC50 values were 23 μM, 15 μM, and 11 μM, respectively. Wilcoxon signed ranks test was conducted and the results are stated as the median of four independent experiments, * p < 0.05, ** p < 0.01, and *** p < 0.001 are significant versus untreated control cells.
Pharmaceuticals 15 01123 g001
Pharmaceuticals 15 01123 g002 550
Figure 2. Effect of TQ on PI3K/Akt/mTOR signaling expression in MV4-11 and K562 cells. RT-qPCR analyses were performed. The graph demonstrates the downregulation of PI3K, Akt, and mTOR genes and upregulation of PTEN in (A) MV4-11 cells and (B) K562 cells after treatment with TQ. The data represent three separate experiments and are presented as the median and interquartile range (error bars). Wilcoxon signed ranks test was conducted. Where * p < 0.05 and *** p < 0.001 are significant versus untreated control cells.
Figure 2. Effect of TQ on PI3K/Akt/mTOR signaling expression in MV4-11 and K562 cells. RT-qPCR analyses were performed. The graph demonstrates the downregulation of PI3K, Akt, and mTOR genes and upregulation of PTEN in (A) MV4-11 cells and (B) K562 cells after treatment with TQ. The data represent three separate experiments and are presented as the median and interquartile range (error bars). Wilcoxon signed ranks test was conducted. Where * p < 0.05 and *** p < 0.001 are significant versus untreated control cells.
Pharmaceuticals 15 01123 g002
Pharmaceuticals 15 01123 g003 550
Figure 3. Effect of TQ on the activation status of JAK/STAT signaling in MV4-11 cells. The cells were incubated for 48 h with 5.5 μM TQ. The protein levels were determined by Jess simple western analysis. (A) Images of Jess simple western analysis for the target proteins before and after TQ treatment. (B) The bar graph demonstrates the reduction of STAT3, p-STAT3, STAT5, p-STAT5, JAK2, and p-JAK2 protein levels in MV4-11 cells after TQ treatment. Wilcoxon signed rank test was conducted, and the results are presented as medians and interquartile range (error bars) (n = 3), where * p < 0.05, ** p < 0.01, *** p < 0.001 are significant versus untreated control cells.
Figure 3. Effect of TQ on the activation status of JAK/STAT signaling in MV4-11 cells. The cells were incubated for 48 h with 5.5 μM TQ. The protein levels were determined by Jess simple western analysis. (A) Images of Jess simple western analysis for the target proteins before and after TQ treatment. (B) The bar graph demonstrates the reduction of STAT3, p-STAT3, STAT5, p-STAT5, JAK2, and p-JAK2 protein levels in MV4-11 cells after TQ treatment. Wilcoxon signed rank test was conducted, and the results are presented as medians and interquartile range (error bars) (n = 3), where * p < 0.05, ** p < 0.01, *** p < 0.001 are significant versus untreated control cells.
Pharmaceuticals 15 01123 g003
Pharmaceuticals 15 01123 g004 550
Figure 4. Effect of TQ on the activation of PI3K/Akt/mTOR signaling in MV4-11 cells. The cells were incubated for 48 h with 5.5 μM TQ. The protein levels were determined by Jess simple western analysis. (A) Images of Jess simple western analysis for the target proteins before and after TQ treatment. (B) The bar graph demonstrates the reduction of PI3K, p-PI3K, Akt, and p-Akt, and the increase of PTEN protein levels in MV4-11 cells after TQ treatment. Wilcoxon signed rank test was applied, and the results are stated as medians and interquartile range (error bars) (n = 3), *** p < 0.001 is significant versus untreated control cells.
Figure 4. Effect of TQ on the activation of PI3K/Akt/mTOR signaling in MV4-11 cells. The cells were incubated for 48 h with 5.5 μM TQ. The protein levels were determined by Jess simple western analysis. (A) Images of Jess simple western analysis for the target proteins before and after TQ treatment. (B) The bar graph demonstrates the reduction of PI3K, p-PI3K, Akt, and p-Akt, and the increase of PTEN protein levels in MV4-11 cells after TQ treatment. Wilcoxon signed rank test was applied, and the results are stated as medians and interquartile range (error bars) (n = 3), *** p < 0.001 is significant versus untreated control cells.
Pharmaceuticals 15 01123 g004
Pharmaceuticals 15 01123 g005 550
Figure 5. Effect of TQ on the activation of PI3K/Akt/mTOR signaling in K562 cells. The cells were incubated for 48 h with 15 μM TQ. The protein levels were determined by Jess simple western analysis. (A) Images of Jess simple western analysis for the target proteins before and after TQ treatment. (B) The bar graph demonstrates the reduction of PI3K, p-PI3K, Akt, and p-Akt, and the increase in PTEN protein levels in K562 cells after treatment with TQ. Wilcoxon signed rank test was conducted, and the results are presented as medians and interquartile range (error bars) (n = 3), *** p < 0.001 is significant versus untreated control cells.
Figure 5. Effect of TQ on the activation of PI3K/Akt/mTOR signaling in K562 cells. The cells were incubated for 48 h with 15 μM TQ. The protein levels were determined by Jess simple western analysis. (A) Images of Jess simple western analysis for the target proteins before and after TQ treatment. (B) The bar graph demonstrates the reduction of PI3K, p-PI3K, Akt, and p-Akt, and the increase in PTEN protein levels in K562 cells after treatment with TQ. Wilcoxon signed rank test was conducted, and the results are presented as medians and interquartile range (error bars) (n = 3), *** p < 0.001 is significant versus untreated control cells.
Pharmaceuticals 15 01123 g005
Table
Table 1. Medians of protein intensity in MV4-11 cells.
Table 1. Medians of protein intensity in MV4-11 cells.
ProteinsM.W (kDa)Intensity of Proteins Median (IqR) (n = 3)p-Value a
Untreated MV4-11 CellsTreated MV4-11 Cells
STAT380–906,238,528 (382,810)5,156,854 (196,459)<0.05
p-STAT3954,644,236 (217,641)2,588,108 (131,717)<0.001
STAT5919,545,158 (541,613)6,908,133 (315,229)<0.001
p-STAT5921,944,235 (463,715)1,376,497 (681,108)<0.05
JAK213016,523,707(831,602)13,585,639 (719,317)<0.01
p-JAK21309,233,971 (691,001)7,481,068 (592,419)<0.05
PI3K85107,064 (45,613)6627 (8731)<0.001
p-PI3K89575,923 (104,621)473,130 (85,372)<0.001
Akt6217,443 (4794)9897 (7803)<0.001
p-Akt6022,879 (9117)11,646 (2712)<0.001
PTEN6028,705 (9062)60,137 (11,823)<0.001
a Wilcoxon signed ranks test was applied. The median of protein expression is significant versus untreated control cells.
Table
Table 2. Medians of protein intensity in K562 cells.
Table 2. Medians of protein intensity in K562 cells.
Proteins M.W (kDa)Intensity of Proteins Median (IqR) (n = 3)p-Value a
Untreated K562 CellsTQ-Treated K562 Cells
PI3K85520,529 (73,119)332,532 (57,649)<0.001
p-PI3K8929,977 (6881)9633 (437)<0.001
Akt6243,372 (9653)12,165 (1711)<0.001
p-Akt6072,651 (8091)16,152 (5793)<0.001
PTEN60194,916 (39,293)295,205 (11,719)<0.001
a Wilcoxon signed ranks test was applied. The median of protein expression is significant versus untreated control cells.
Table
Table 3. The sequences of the primer set for RT-qPCR analysis.
Table 3. The sequences of the primer set for RT-qPCR analysis.
GeneAccession NumberPrimer Set Sequences (5′–3′)Reference
PI3KNG_012113.2Forward: TTAGCTATTCCCACGCAGGA
Reverse: CACAATAGTGTCTGTGACTC		[46]
AKTNG_012188.1Forward: CTGAGATTGTGTCAGCCCTG
Reverse: CACAGCCCGAAGTCTGTGATCTTA		[47]
mTORNG_033239.1Forward: ATGCAGCTGTCCTGGTTCTC
Reverse: AATCAGACAGGCACGAAG		[46]
PTENAF_067844.1Forward: TGGATTCGACTTAGACT GACCT
Reverse: TTTGGCGGTGTCATAATGTCTT		[33]
β-actinNC_000071.7Forward: CTGGCACCCAGGACAATG
Reverse: GCCGATCCACACGGAGTA		[48]
Table
Table 4. List of primary antibodies used for Jess simple western analysis.
Table 4. List of primary antibodies used for Jess simple western analysis.
Primary AntibodiesCatalogue NumberCOMPANY
Anti-JAK2NBP2-59451Novus Biologicals, LLC, Littleton, CO, USA
Anti-phospho-JAK2NBP2-67429Novus Biologicals, LLC, Littleton, CO, USA
Anti-STAT3MAB1799R&D System, Minneapolis, MN, USA
Anti-phospho-STAT3AF4607R&D System, Minneapolis, MN, USA
Anti-STAT5AF2168R&D System, Minneapolis, MN, USA
Anti-phospho-STAT5MAB41901R&D System, Minneapolis, MN, USA
Anti-PI3KMAB2998R&D System, Minneapolis, MN, USA
Anti-phospho-PI3KPA5-177387Invitrogen, Waltham, MA, USA
Anti-AktMAB2055R&D System, Minneapolis, MN, USA
Anti-phospho-AktAF887R&D System, Minneapolis, MN, USA
Anti-PTENAF847R&D System, Minneapolis, MN, USA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Al-Rawashde, F.A.; Al-wajeeh, A.S.; Vishkaei, M.N.; Saad, H.K.M.; Johan, M.F.; Taib, W.R.W.; Ismail, I.; Al-Jamal, H.A.N. Thymoquinone Inhibits JAK/STAT and PI3K/Akt/ mTOR Signaling Pathways in MV4-11 and K562 Myeloid Leukemia Cells. Pharmaceuticals 2022, 15, 1123. https://doi.org/10.3390/ph15091123

AMA Style

Al-Rawashde FA, Al-wajeeh AS, Vishkaei MN, Saad HKM, Johan MF, Taib WRW, Ismail I, Al-Jamal HAN. Thymoquinone Inhibits JAK/STAT and PI3K/Akt/ mTOR Signaling Pathways in MV4-11 and K562 Myeloid Leukemia Cells. Pharmaceuticals. 2022; 15(9):1123. https://doi.org/10.3390/ph15091123

Chicago/Turabian Style

Al-Rawashde, Futoon Abedrabbu, Abdullah Saleh Al-wajeeh, Mansoureh Nazari Vishkaei, Hanan Kamel M. Saad, Muhammad Farid Johan, Wan Rohani Wan Taib, Imilia Ismail, and Hamid Ali Nagi Al-Jamal. 2022. "Thymoquinone Inhibits JAK/STAT and PI3K/Akt/ mTOR Signaling Pathways in MV4-11 and K562 Myeloid Leukemia Cells" Pharmaceuticals 15, no. 9: 1123. https://doi.org/10.3390/ph15091123

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop