A Flavonoid-Rich Extract from Bergamot Juice, Alone or in Association with Curcumin and Resveratrol, Shows Protective Effects in a Murine Model of Cadmium-Induced Testicular Injury
Abstract
1. Introduction
2. Results
2.1. Testes and Body Weight along with Their Ratio
2.2. Effect of Nutraceuticals on Inflammatory Markers
2.3. The Nutraceuticals Modulate the Expression of Apoptotic Markers
2.4. Effect of Nutraceuticals on Tubular Histological Organization
2.5. Measurement of Nutraceuticals Effects on Apoptosis with TUNEL Assay
3. Discussion
4. Materials and Methods
4.1. Ethical Approval
4.2. Experimental Protocol
4.3. Drugs and Chemicals
4.4. Real-Time PCR Analyses
4.5. Histological Evaluation
4.6. Measurement of Apoptosis with Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling (TUNEL) Assay
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- GBD 2016 Risk Factors Collaborators. Global, regional, and national comparative risk assessment of 84 behavioural, environmental and occupational, and metabolic risks or clusters of risks, 1990–2016: A systematic analysis for the Global Burden of Disease Study 2016. Lancet 2017, 390, 1345–1422. [Google Scholar] [CrossRef]
- IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Arsenic, metals, fibres, and dusts. IARC Monogr. Eval. Carcinog. Risks Hum. 2012, 100 Pt C, 11–465. [Google Scholar]
- Lee, J.; Lim, K.T. Inhibitory effect of plant-originated glycoprotein (27 kDa) on expression of matrix metalloproteinase-9 in cadmium chloride-induced BNL CL.2 cells. J. Trace Elem. Med. Biol. 2011, 25, 239–246. [Google Scholar] [CrossRef] [PubMed]
- Morales, A.I.; Vicente-Sanchez, C.; Sandoval, J.M.; Egido, J.; Mayoral, P.; Arevalo, M.A.; Fernandez-Tagarro, M.; Lopez-Novoa, J.M.; Perez-Barriocanal, F. Protective effect of quercetin on experimental chronic cadmium nephrotoxicity in rats is based on its antioxidant properties. Food Chem. Toxicol. 2006, 44, 2092–2100. [Google Scholar] [CrossRef]
- Chunhabundit, R. Cadmium Exposure and Potential Health Risk from Foods in Contaminated Area, Thailand. Toxicol. Res. 2016, 32, 65–72. [Google Scholar] [CrossRef]
- Rinaldi, M.; Micali, A.; Marini, H.; Adamo, E.B.; Puzzolo, D.; Pisani, A.; Trichilo, V.; Altavilla, D.; Squadrito, F.; Minutoli, L. Cadmium, Organ Toxicity and Therapeutic Approaches: A Review on Brain, Kidney and Testis Damage. Curr. Med. Chem. 2017, 24, 3879–3893. [Google Scholar] [CrossRef] [PubMed]
- Benoff, S.; Hauser, R.; Marmar, J.L.; Hurley, I.R.; Napolitano, B.; Centola, G.M. Cadmium concentrations in blood and seminal plasma: Correlations with sperm number and motility in three male populations (infertility patients, artificial insemination donors, and unselected volunteers). Mol. Med. 2009, 15, 248–262. [Google Scholar] [CrossRef]
- Interdonato, M.; Pizzino, G.; Bitto, A.; Galfo, F.; Irrera, N.; Mecchio, A.; Pallio, G.; Ramistella, V.; de Luca, F.; Santamaria, A.; et al. Cadmium delays puberty onset and testis growth in adolescents. Clin. Endocrinol. 2015, 83, 357–362. [Google Scholar] [CrossRef]
- Siu, E.R.; Wong, E.W.; Mruk, D.D.; Sze, K.L.; Porto, C.S.; Cheng, C.Y. An occludin-focal adhesion kinase protein complex at the blood-testis barrier: A study using the cadmium model. Endocrinology 2009, 150, 3336–3344. [Google Scholar] [CrossRef] [PubMed]
- Monsefi, M.; Alaee, S.; Moradshahi, A.; Rohani, L. Cadmium-induced infertility in male mice. Environ. Toxicol. 2010, 25, 94–102. [Google Scholar] [CrossRef]
- Minutoli, L.; Micali, A.; Pisani, A.; Puzzolo, D.; Bitto, A.; Rinaldi, M.; Pizzino, G.; Irrera, N.; Galfo, F.; Arena, S.; et al. Flavocoxid Protects Against Cadmium-Induced Disruption of the Blood-Testis Barrier and Improves Testicular Damage and Germ Cell Impairment in Mice [corrected]. Toxicol. Sci. 2015, 148, 311–329. [Google Scholar] [CrossRef] [PubMed]
- Squadrito, F.; Micali, A.; Rinaldi, M.; Irrera, N.; Marini, H.; Puzzolo, D.; Pisani, A.; Lorenzini, C.; Valenti, A.; Laura, R.; et al. Polydeoxyribonucleotide, an Adenosine-A2A Receptor Agonist, Preserves Blood Testis Barrier from Cadmium-Induced Injury. Front. Pharmacol. 2016, 7, 537. [Google Scholar] [CrossRef]
- Benvenga, S.; Micali, A.; Pallio, G.; Vita, R.; Malta, C.; Puzzolo, D.; Irrera, N.; Squadrito, F.; Altavilla, D.; Minutoli, L. Effects of Myo-inositol Alone and in Combination with Seleno-Lmethionine on Cadmium-Induced Testicular Damage in Mice. Curr. Mol. Pharmacol. 2019, 12, 311–323. [Google Scholar] [CrossRef] [PubMed]
- Arafa, M.H.; Mohammad, N.S.; Atteia, H.H. Fenugreek seed powder mitigates cadmium-induced testicular damage and hepatotoxicity in male rats. Exp. Toxicol. Pathol. 2014, 66, 293–300. [Google Scholar] [CrossRef] [PubMed]
- Olszowski, T.; Baranowska-Bosiacka, I.; Gutowska, I.; Chlubek, D. Pro-inflammatory properties of cadmium. Acta Biochim. Pol. 2012, 59, 475–482. [Google Scholar] [CrossRef] [PubMed]
- Lanzafame, F.M.; la Vignera, S.; Vicari, E.; Calogero, A.E. Oxidative stress and medical antioxidant treatment in male infertility. Reprod. Biomed. Online 2009, 19, 638–659. [Google Scholar] [CrossRef]
- Angenard, G.; Muczynski, V.; Coffigny, H.; Pairault, C.; Duquenne, C.; Frydman, R.; Habert, R.; Rouiller-Fabre, V.; Livera, G. Cadmium increases human fetal germ cell apoptosis. Environ. Health Perspect. 2010, 118, 331–337. [Google Scholar] [CrossRef]
- Bu, T.; Mi, Y.; Zeng, W.; Zhang, C. Protective effect of quercetin on cadmium-induced oxidative toxicity on germ cells in male mice. Anat. Rec. 2011, 294, 520–526. [Google Scholar] [CrossRef]
- Al-Azemi, M.; Omu, F.E.; Kehinde, E.O.; Anim, J.T.; Oriowo, M.A.; Omu, A.E. Lithium protects against toxic effects of cadmium in the rat testes. J. Assist. Reprod. Genet. 2010, 27, 469–476. [Google Scholar] [CrossRef]
- Eleawa, S.M.; Alkhateeb, M.A.; Alhashem, F.H.; Bin-Jaliah, I.; Sakr, H.F.; Elrefaey, H.M.; Elkarib, A.O.; Alessa, R.M.; Haidara, M.A.; Shatoor, A.S.; et al. Resveratrol reverses cadmium chloride-induced testicular damage and subfertility by downregulating p53 and Bax and upregulating gonadotropins and Bcl-2 gene expression. J. Reprod. Dev. 2014, 60, 115–127. [Google Scholar] [CrossRef]
- Fouad, A.A.; Abdel-Aziz, A.M.; Hamouda, A.A.H. Diacerein Downregulates NLRP3/Caspase-1/IL-1beta and IL-6/STAT3 Pathways of Inflammation and Apoptosis in a Rat Model of Cadmium Testicular Toxicity. Biol. Trace Elem. Res. 2020, 195, 499–505. [Google Scholar] [CrossRef] [PubMed]
- El-Maraghy, S.A.; Nassar, N.N. Modulatory effects of lipoic acid and selenium against cadmium-induced biochemical alterations in testicular steroidogenesis. J. Biochem. Mol. Toxicol. 2011, 25, 15–25. [Google Scholar] [CrossRef] [PubMed]
- Blanco-Rodriguez, J.; Martinez-Garcia, C. Apoptosis precedes detachment of germ cells from the seminiferous epithelium after hormone suppression by short-term oestradiol treatment of rats. Int. J. Androl. 1998, 21, 109–115. [Google Scholar] [CrossRef]
- Mohebbati, R.; Anaeigoudari, A.; Khazdair, M.R. The effects of Curcuma longa and curcumin on reproductive systems. Endocr. Regul. 2017, 51, 220–228. [Google Scholar] [CrossRef]
- Priyadarsini, K.I. The chemistry of curcumin: From extraction to therapeutic agent. Molecules 2014, 19, 20091–20112. [Google Scholar] [CrossRef] [PubMed]
- Oguzturk, H.; Ciftci, O.; Aydin, M.; Timurkaan, N.; Beytur, A.; Yilmaz, F. Ameliorative effects of curcumin against acute cadmium toxicity on male reproductive system in rats. Andrologia 2012, 44, 243–249. [Google Scholar] [CrossRef]
- Momeni, H.R.; Eskandari, N. Curcumin protects the testis against cadmium-induced histopathological damages and oxidative stress in mice. Hum. Exp. Toxicol. 2020, 39, 653–661. [Google Scholar] [CrossRef]
- Aktas, C.; Kanter, M.; Erboga, M.; Ozturk, S. Anti-apoptotic effects of curcumin on cadmium-induced apoptosis in rat testes. Toxicol. Ind. Health 2012, 28, 122–130. [Google Scholar] [CrossRef]
- Muratoglu, S.; Dizakar, O.S.A.; Aktan, A.K.; Omeroglu, S.; Akbulut, K.G. The protective role of melatonin and curcumin in the testis of young and aged rats. Andrologia 2019, 51, e13203. [Google Scholar] [CrossRef]
- Xia, N.; Daiber, A.; Forstermann, U.; Li, H. Antioxidant effects of resveratrol in the cardiovascular system. Br. J. Pharmacol. 2017, 174, 1633–1646. [Google Scholar] [CrossRef]
- Wan, H.T.; Lai, K.P.; Wong, C.K.C. Comparative Analysis of PFOS and PFOA Toxicity on Sertoli Cells. Environ. Sci. Technol. 2020, 54, 3465–3475. [Google Scholar] [CrossRef]
- Galiniak, S.; Aebisher, D.; Bartusik-Aebisher, D. Health benefits of resveratrol administration. Acta Biochim. Pol. 2019, 66, 13–21. [Google Scholar] [CrossRef]
- Eybl, V.; Kotyzova, D.; Koutensky, J. Comparative study of natural antioxidants—curcumin, resveratrol and melatonin—in cadmium-induced oxidative damage in mice. Toxicology 2006, 225, 150–156. [Google Scholar] [CrossRef] [PubMed]
- Mitra, S.; Bhattacharyya, S.; Ray, S.; Saha, R.; Ghosh, P.; Rauth, S.; Mandal, S.; Banerjee, S.; Murmu, N. Resveratrol Alleviates Cadmium-Induced Damage and Overexpression of Epidermal Growth Factor Receptor and its Downstream Signaling Proteins in the Reproductive System of Male Swiss Albino Mice. J. Environ. Pathol. Toxicol. Oncol. 2016, 35, 73–90. [Google Scholar] [CrossRef]
- Mannucci, C.; Navarra, M.; Calapai, F.; Squeri, R.; Gangemi, S.; Calapai, G. Clinical Pharmacology of Citrus bergamia: A Systematic Review. Phytother. Res. 2017, 31, 27–39. [Google Scholar] [CrossRef] [PubMed]
- Cirmi, S.; Maugeri, A.; Ferlazzo, N.; Gangemi, S.; Calapai, G.; Schumacher, U.; Navarra, M. Anticancer Potential of Citrus Juices and Their Extracts: A Systematic Review of Both Preclinical and Clinical Studies. Front. Pharmacol. 2017, 8, 420. [Google Scholar] [CrossRef] [PubMed]
- Cirmi, S.; Navarra, M.; Woodside, J.V.; Cantwell, M.M. Citrus fruits intake and oral cancer risk: A systematic review and meta-analysis. Pharmacol. Res. 2018, 133, 187–194. [Google Scholar] [CrossRef]
- Mollace, V.; Sacco, I.; Janda, E.; Malara, C.; Ventrice, D.; Colica, C.; Visalli, V.; Muscoli, S.; Ragusa, S.; Muscoli, C.; et al. Hypolipemic and hypoglycaemic activity of bergamot polyphenols: From animal models to human studies. Fitoterapia 2011, 82, 309–316. [Google Scholar] [CrossRef] [PubMed]
- Navarra, M.; Femia, A.P.; Romagnoli, A.; Tortora, K.; Luceri, C.; Cirmi, S.; Ferlazzo, N.; Caderni, G. A flavonoid-rich extract from bergamot juice prevents carcinogenesis in a genetic model of colorectal cancer, the Pirc rat (F344/NTac-Apc(am1137)). Eur. J. Nutr. 2020, 59, 885–894. [Google Scholar] [CrossRef]
- Filocamo, A.; Bisignano, C.; Ferlazzo, N.; Cirmi, S.; Mandalari, G.; Navarra, M. In vitro effect of bergamot (Citrus bergamia) juice against cagA-positive and-negative clinical isolates of Helicobacter pylori. BMC Complement. Altern. Med. 2015, 15, 256. [Google Scholar] [CrossRef] [PubMed]
- Cirmi, S.; Bisignano, C.; Mandalari, G.; Navarra, M. Anti-infective potential of Citrus bergamia Risso et Poiteau (bergamot) derivatives: A systematic review. Phytother. Res. 2016, 30, 1404–1411. [Google Scholar] [CrossRef] [PubMed]
- Ferlazzo, N.; Cirmi, S.; Maugeri, A.; Russo, C.; Lombardo, G.E.; Gangemi, S.; Calapai, G.; Mollace, V.; Navarra, M. Neuroprotective Effect of Bergamot Juice in 6-OHDA-Induced SH-SY5Y Cell Death, an In Vitro Model of Parkinson’s Disease. Pharmaceutics 2020, 12, 326. [Google Scholar] [CrossRef] [PubMed]
- Ferlazzo, N.; Cirmi, S.; Calapai, G.; Ventura-Spagnolo, E.; Gangemi, S.; Navarra, M. Anti-Inflammatory Activity of Citrus bergamia Derivatives: Where Do We Stand? Molecules 2016, 21, 1273. [Google Scholar] [CrossRef] [PubMed]
- Ferlazzo, N.; Visalli, G.; Cirmi, S.; Lombardo, G.E.; Lagana, P.; di Pietro, A.; Navarra, M. Natural iron chelators: Protective role in A549 cells of flavonoids-rich extracts of Citrus juices in Fe3+-induced oxidative stress. Environ. Toxicol. Pharmacol. 2016, 43, 248–256. [Google Scholar] [CrossRef]
- Maugeri, A.; Ferlazzo, N.; de Luca, L.; Gitto, R.; Navarra, M. The link between the AMPK/SIRT1 axis and a flavonoid-rich extract of Citrus bergamia juice: A cell-free, in silico, and in vitro study. Phytother. Res. 2019, 33, 1805–1814. [Google Scholar] [CrossRef]
- Musumeci, L.; Maugeri, A.; Cirmi, S.; Lombardo, G.E.; Russo, C.; Gangemi, S.; Calapai, G.; Navarra, M. Citrus fruits and their flavonoids in inflammatory bowel disease: An overview. Nat. Prod. Res. 2020, 34, 122–136. [Google Scholar] [CrossRef]
- Unsal, V.; Dalkiran, T.; Cicek, M.; Kolukcu, E. The Role of Natural Antioxidants Against Reactive Oxygen Species Produced by Cadmium Toxicity: A Review. Adv. Pharm. Bull. 2020, 10, 184–202. [Google Scholar] [CrossRef]
- Zhang, H.; Reynolds, M. Cadmium exposure in living organisms: A short review. Sci. Total. Environ. 2019, 678, 761–767. [Google Scholar] [CrossRef]
- Almeer, R.S.; Soliman, D.; Kassab, R.B.; AlBasher, G.I.; Alarifi, S.; Alkahtani, S.; Ali, D.; Metwally, D.; Moneim, A.E.A. Royal Jelly Abrogates Cadmium-Induced Oxidative Challenge in Mouse Testes: Involvement of the Nrf2 Pathway. Int. J. Mol. Sci. 2018, 19, 3979. [Google Scholar] [CrossRef]
- Elmallah, M.I.Y.; Elkhadragy, M.F.; Al-Olayan, E.M.; Moneim, A.E.A. Protective Effect of Fragaria ananassa Crude Extract on Cadmium-Induced Lipid Peroxidation, Antioxidant Enzymes Suppression, and Apoptosis in Rat Testes. Int. J. Mol. Sci. 2017, 18, 957. [Google Scholar] [CrossRef]
- Rencuzogullari, N.; Erdogan, S. Oral administration of lycopene reverses cadmium-suppressed body weight loss and lipid peroxidation in rats. Biol. Trace Elem. Res. 2007, 118, 175–183. [Google Scholar] [CrossRef]
- Prahalathan, C.; Selvakumar, E.; Varalakshmi, P. Remedial effect of DL-alpha-lipoic acid against adriamycin induced testicular lipid peroxidation. Mol. Cell Biochem. 2004, 267, 209–214. [Google Scholar] [CrossRef]
- Aly, H.A.; Khafagy, R.M. Taurine reverses endosulfan-induced oxidative stress and apoptosis in adult rat testis. Food Chem. Toxicol. 2014, 64, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Aly, H.A.A.; Eid, B.G. Cisplatin induced testicular damage through mitochondria mediated apoptosis, inflammation and oxidative stress in rats: Impact of resveratrol. Endocr. J. 2020, 67, 969–980. [Google Scholar] [CrossRef] [PubMed]
- Marino, A.; Paterniti, I.; Cordaro, M.; Morabito, R.; Campolo, M.; Navarra, M.; Cuzzocrea, S. Role of natural antioxidants and potential use of bergamot in treating rheumatoid arthritis. PharmaNutrition 2015, 3, 53–59. [Google Scholar] [CrossRef]
- Celano, M.; Maggisano, V.; de Rose, R.F.; Bulotta, S.; Maiuolo, J.; Navarra, M.; Russo, D. Flavonoid Fraction of Citrus reticulata Juice Reduces Proliferation and Migration of Anaplastic Thyroid Carcinoma Cells. Nutr. Cancer 2015, 67, 1183–1190. [Google Scholar] [CrossRef]
- Fusco, R.; Cirmi, S.; Gugliandolo, E.; di Paola, R.; Cuzzocrea, S.; Navarra, M. A flavonoid-rich extract of orange juice reduced oxidative stress in an experimental model of inflammatory bowel disease. J. Funct. Foods 2017, 30, 168–178. [Google Scholar] [CrossRef]
- Maugeri, A.; Cirmi, S.; Minciullo, P.L.; Gangemi, S.; Calapai, G.; Mollace, V.; Navarra, M. Citrus fruits and inflammaging: A systematic review. Phytochem. Rev. 2019, 18, 1025–1049. [Google Scholar] [CrossRef]
- Gugliandolo, E.; Fusco, R.; D’Amico, R.; Peditto, M.; Oteri, G.; di Paola, R.; Cuzzocrea, S.; Navarra, M. Treatment With a Flavonoid-Rich Fraction of Bergamot Juice Improved Lipopolysaccharide-Induced Periodontitis in Rats. Front. Pharmacol. 2018, 9, 1563. [Google Scholar] [CrossRef]
- Impellizzeri, D.; Cordaro, M.; Campolo, M.; Gugliandolo, E.; Esposito, E.; Benedetto, F.; Cuzzocrea, S.; Navarra, M. Anti-inflammatory and Antioxidant Effects of Flavonoid-Rich Fraction of Bergamot Juice (BJe) in a Mouse Model of Intestinal Ischemia/Reperfusion Injury. Front. Pharmacol. 2016, 7, 203. [Google Scholar] [CrossRef]
- Curro, M.; Risitano, R.; Ferlazzo, N.; Cirmi, S.; Gangemi, C.; Caccamo, D.; Ientile, R.; Navarra, M. Citrus bergamia Juice Extract Attenuates beta-Amyloid-Induced Pro-Inflammatory Activation of THP-1 Cells Through MAPK and AP-1 Pathways. Sci. Rep. 2016, 6, 20809. [Google Scholar] [CrossRef]
- Bhardwaj, J.K.; Panchal, H.; Saraf, P. Cadmium as a testicular toxicant: A Review. J. Appl. Toxicol. 2021, 41, 105–117. [Google Scholar] [CrossRef]
- Montano, L.; Ceretti, E.; Donato, F.; Bergamo, P.; Zani, C.; Viola, G.C.V.; Notari, T.; Pappalardo, S.; Zani, D.; Ubaldi, S.; et al. Effects of a Lifestyle Change Intervention on Semen Quality in Healthy Young Men Living in Highly Polluted Areas in Italy: The FASt Randomized Controlled Trial. Eur. Urol. Focus 2021. [Google Scholar] [CrossRef] [PubMed]
- Salas-Huetos, A.; James, E.R.; Aston, K.I.; Jenkins, T.G.; Carrell, D.T. Diet and sperm quality: Nutrients, foods and dietary patterns. Reprod. Biol. 2019, 19, 219–224. [Google Scholar] [CrossRef] [PubMed]
- Efrat, M.; Stein, A.; Pinkas, H.; Unger, R.; Birk, R. Dietary patterns are positively associated with semen quality. Fertil. Steril. 2018, 109, 809–816. [Google Scholar] [CrossRef]
- Aitken, R.J. Oxidative stress and the etiology of male infertility. J. Assist. Reprod. Genet. 2016, 33, 1691–1692. [Google Scholar] [CrossRef] [PubMed]
- Torres-Arce, E.; Vizmanos, B.; Babio, N.; Marquez-Sandoval, F.; Salas-Huetos, A. Dietary Antioxidants in the Treatment of Male Infertility: Counteracting Oxidative Stress. Biology 2021, 10, 241. [Google Scholar] [CrossRef]
- Santoro, M.; Aquila, S.; Russo, G. Sperm performance in oligoasthenoteratozoospermic patients is induced by a nutraceuticals mix, containing mainly myo-inositol. Syst. Biol. Reprod. Med. 2021, 67, 50–63. [Google Scholar] [CrossRef] [PubMed]
- Delbarba, A.; Arrighi, N.; Facondo, P.; Cappelli, C.; Ferlin, A. Positive effect of nutraceuticals on sperm DNA damage in selected infertile patients with idiopathic high sperm DNA fragmentation. Minerva Endocrinol. 2020, 45, 89–96. [Google Scholar] [CrossRef]
- Yang, S.H.; He, J.B.; Yu, L.H.; Li, L.; Long, M.; Liu, M.D.; Li, P. Protective role of curcumin in cadmium-induced testicular injury in mice by attenuating oxidative stress via Nrf2/ARE pathway. Environ. Sci. Pollut. Res. Int. 2019, 26, 34575–34583. [Google Scholar] [CrossRef]
- Johnsen, S.G. Testicular biopsy score count—A method for registration of spermatogenesis in human testes: Normal values and results in 335 hypogonadal males. Hormones 1970, 1, 2–25. [Google Scholar] [CrossRef] [PubMed]
- Mizuno, K.; Hayashi, Y.; Kojima, Y.; Kurokawa, S.; Sasaki, S.; Kohri, K. Influence for testicular development and histological peculiarity in the testes of flutamide-induced cryptorchid rat model. Int. J. Urol. 2007, 14, 67–72. [Google Scholar] [CrossRef] [PubMed]
- Tsounapi, P.; Saito, M.; Dimitriadis, F.; Kitatani, K.; Kinoshita, Y.; Shomori, K.; Takenaka, A.; Satoh, K. The role of K ATP channels on ischemia-reperfusion injury in the rat testis. Life Sci. 2012, 90, 649–656. [Google Scholar] [CrossRef] [PubMed]




| BW (g) | TW (mg) | TW/BW Ratio | |
|---|---|---|---|
| Controls | 30.2 ± 1.8 | 108.2 ± 9.4 | 3.59 |
| CdCl2 + vehicle | 24.3 ± 1.5 a | 71.2 ± 5.4 a | 2.93 a |
| CdCl2 + Cur 50 mg/kg | 27.1 ± 1.4 a,b | 83.2 ± 5.9 a,b | 3.07 a,b |
| CdCl2 + Cur 100 mg/kg | 27.8 ± 1.6 a,b | 88.9 ± 6.1 a,b | 3.19 a,b |
| CdCl2 + Re 20 mg/kg | 28.9 ± 1.1 b | 94.7 ± 6.5 b | 3.27 b |
| CdCl2 + BJe 20 mg/kg | 25.9 ± 1.4 a | 80.6 ± 5.2 a | 3.11 a |
| CdCl2 + BJe 40 mg/kg | 29.2 ± 1.3 b | 98.4 ± 5.8 b | 3.36 b |
| CdCl2 + Cur 50 mg/kg + Re 20 mg/kg + BJe 20 mg/kg | 28.8 ± 1.2 b | 100.3 ± 5.2 b | 3.48 b |
| CdCl2 + Cur 100 mg/kg + Re 20 mg/kg + BJe 40 mg/kg | 29.8 ± 1.4 b | 105.7 ± 6.1 b | 3.54 b |
| Genes | Forward Primer Sequences | Reverse Primer Sequences |
|---|---|---|
| BAX | GCGAATTGGAGATGAACT | CAGTTGAAGTTGCCATCA |
| BCL-2 | GTGGAGGAACTCTTCAGG | TGACATCTCCCTGTTGAC |
| P53 | TGGAAGACAGGCAGACTT | ACTTGTAGTGGATGGTGGTA |
| IL-1β | ATCTATACCTGTCCTGTGTAATGA | GCTTGTGCTCTGCTTGTG |
| TNF-α | GTGGAACTGGCAGAAGAG | ATGAGAAGAGGCTGAGACA |
| iNOS | GAGCGAGTTGTGGATTGT | GCAGCCTCTTGTCTTTGA |
| β-ACT | GCTGTGCTATGTTGCTCTA | TCGTTGCCAATAGTGATGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ferlazzo, N.; Micali, A.; Marini, H.R.; Freni, J.; Santoro, G.; Puzzolo, D.; Squadrito, F.; Pallio, G.; Navarra, M.; Cirmi, S.; et al. A Flavonoid-Rich Extract from Bergamot Juice, Alone or in Association with Curcumin and Resveratrol, Shows Protective Effects in a Murine Model of Cadmium-Induced Testicular Injury. Pharmaceuticals 2021, 14, 386. https://doi.org/10.3390/ph14050386
Ferlazzo N, Micali A, Marini HR, Freni J, Santoro G, Puzzolo D, Squadrito F, Pallio G, Navarra M, Cirmi S, et al. A Flavonoid-Rich Extract from Bergamot Juice, Alone or in Association with Curcumin and Resveratrol, Shows Protective Effects in a Murine Model of Cadmium-Induced Testicular Injury. Pharmaceuticals. 2021; 14(5):386. https://doi.org/10.3390/ph14050386
Chicago/Turabian StyleFerlazzo, Nadia, Antonio Micali, Herbert Ryan Marini, Josè Freni, Giuseppe Santoro, Domenico Puzzolo, Francesco Squadrito, Giovanni Pallio, Michele Navarra, Santa Cirmi, and et al. 2021. "A Flavonoid-Rich Extract from Bergamot Juice, Alone or in Association with Curcumin and Resveratrol, Shows Protective Effects in a Murine Model of Cadmium-Induced Testicular Injury" Pharmaceuticals 14, no. 5: 386. https://doi.org/10.3390/ph14050386
APA StyleFerlazzo, N., Micali, A., Marini, H. R., Freni, J., Santoro, G., Puzzolo, D., Squadrito, F., Pallio, G., Navarra, M., Cirmi, S., & Minutoli, L. (2021). A Flavonoid-Rich Extract from Bergamot Juice, Alone or in Association with Curcumin and Resveratrol, Shows Protective Effects in a Murine Model of Cadmium-Induced Testicular Injury. Pharmaceuticals, 14(5), 386. https://doi.org/10.3390/ph14050386

