Single-Molecule Detection of Nucleic Acids via Liposome Signal Amplification in Mass Spectrometry
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents and Materials
2.1.1. Materials
2.1.2. Instrumentation
2.2. Method
2.2.1. Liposome Preparation
2.2.2. Liposome-Labelled Detection Probe
2.2.3. Magnetic Beads Labelled with Trapping Probe
2.2.4. Capture of Target Chain and Release of Liposome
3. Results and Discussion
3.1. Principle of the Experiment
3.2. Liposome Characterisation
3.3. Selection of Liposome Particle Size
3.4. The Effect of Polyethylene Glycol (PEG)
3.5. Assessment of the Number of Particles
3.6. ESI-MS Detection of Liposomes at Different Concentrations
3.7. Target DNA Chain Detection
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Li, M.; Yin, F.; Song, L.; Mao, X.; Li, F.; Fan, C.; Zuo, X.; Xia, Q. Nucleic acid tests for clinical translation. Chem. Rev. 2021, 121, 10469–10558. [Google Scholar] [CrossRef]
- Wang, J.L.; Xie, S.J.; Liu, D.R.; Zhou, H.; Wang, L.; Liu, S.F. Assembled molecular beacon-based self-propelled DNA machine for enzyme-free and distinctly amplified nucleic acid detection. Sens. Actuators B Chem. 2021, 339. [Google Scholar] [CrossRef]
- Yera, H.; Ok, V.; Lee Koy Kuet, F.; Dahane, N.; Ariey, F.; Hasseine, L.; Delaunay, P.; Martiano, D.; Marty, P.; Bourges, J.L. PCR and culture for diagnosis of Acanthamoeba keratitis. Br. J. Ophthalmol. 2021, 105, 1302–1306. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Han, J.L.; Zhou, L.J.; Zhang, J.J.; Du, J. DNAzyme-Based Target-Triggered Rolling-Circle Amplification for High Sensitivity Detection of microRNAs. Sensors 2020, 20, 2017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, J.; Zhou, R.X.; Jin, Y.W.; Cheng, N.S. Magnetic immunoassay for tumor clinical diagnosis based on rolling circular amplification (RCA) coupled with ICP-MS. Microchem. J. 2021, 160. [Google Scholar] [CrossRef]
- Kim, J.; Shim, J.S.; Han, B.H.; Kim, H.J.; Park, J.; Cho, I.J.; Kang, S.G.; Kang, J.Y.; Bong, K.W.; Choi, N. Hydrogel-based hybridization chain reaction (HCR) for detection of urinary exosomal miRNAs as a diagnostic tool of prostate cancer. Biosens. Bioelectron. 2021, 192, 113504. [Google Scholar] [CrossRef] [PubMed]
- Landaverde, L.; Wong, W.; Hernandez, G.; Fan, A.; Klapperich, C. Method for the elucidation of LAMP products captured on lateral flow strips in a point of care test for HPV 16. Anal. Bioanal. Chem. 2020, 412, 6199–6209. [Google Scholar] [CrossRef] [PubMed]
- Moehling, T.J.; Choi, G.; Dugan, L.C.; Salit, M.; Meagher, R.J. LAMP Diagnostics at the Point-of-Care: Emerging Trends and Perspectives for the Developer Community. Expert. Rev. Mol. Diagn. 2021, 21, 43–61. [Google Scholar] [CrossRef] [PubMed]
- Sharma, A.; Gaind, R. Development of Loop-Mediated Isothermal Amplification Assay for Detection of Clinically Significant Members of Acinetobacter calcoaceticus-baumannii Complex and Associated Carbapenem Resistance. Front. Mol. Biosci. 2021, 8, 659256. [Google Scholar] [CrossRef]
- Lu, Z.; Zhang, Y.; Wang, Y.; Tan, G.H.; Huang, F.Y.; Cao, R.; He, N.; Zhang, L. A biotin-avidin-system-based virus-mimicking nanovaccine for tumor immunotherapy. J. Control Release 2021, 332, 245–259. [Google Scholar] [CrossRef]
- Ibrahim, N.; Jamaluddin, N.D.; Tan, L.L.; Mohd Yusof, N.Y. A Review on the Development of Gold and Silver Nanoparticles-Based Biosensor as a Detection Strategy of Emerging and Pathogenic RNA Virus. Sensors 2021, 21, 5114. [Google Scholar] [CrossRef] [PubMed]
- Pauly, M.D.; Kamili, S.; Hayden, T.M. Impact of nucleic acid extraction platforms on hepatitis virus genome detection. J. Virol. Methods 2019, 273, 113715. [Google Scholar] [CrossRef] [PubMed]
- Michalakis, Y.; Blanc, S. The Curious Strategy of Multipartite Viruses. Annu. Rev. Virol. 2020, 7, 203–218. [Google Scholar] [CrossRef]
- Largy, E.; Konig, A.; Ghosh, A.; Ghosh, D.; Benabou, S.; Rosu, F.; Gabelica, V. Mass Spectrometry of Nucleic Acid Noncovalent Complexes. Chem. Rev. 2021. [Google Scholar] [CrossRef] [PubMed]
- Yin, X.; Chen, B.; He, M.; Hu, B. A Homogeneous Multicomponent Nucleic Acid Enzyme Assay for Universal Nucleic Acid Detection by Single-Particle Inductively Coupled Plasma Mass Spectrometry. Anal. Chem. 2021, 93, 4952–4959. [Google Scholar] [CrossRef] [PubMed]
- Han, G.; Zhang, S.; Xing, Z.; Zhang, X. Absolute and relative quantification of multiplex DNA assays based on an elemental labeling strategy. Angew. Chem. Int. Ed. Engl. 2013, 52, 1466–1471. [Google Scholar] [CrossRef]
- Hu, Z.; Sun, G.; Jiang, W.; Xu, F.; Zhang, Y.; Xia, M.; Pan, X.; Xing, Z.; Zhang, S.; Zhang, X. Chemical-Modified Nucleotide-Based Elemental Tags for High-Sensitive Immunoassay. Anal. Chem. 2019, 91, 5980–5986. [Google Scholar] [CrossRef]
- Abad-Alvaro, I.; Leite, D.; Bartczak, D.; Cuello-Nunez, S.; Gomez-Gomez, B.; Madrid, Y.; Aramendia, M.; Resano, M.; Goenaga-Infante, H. An insight into the determination of size and number concentration of silver nanoparticles in blood using single particle ICP-MS (spICP-MS): Feasibility of application to samples relevant to in vivo toxicology studies. J. Anal. At. Spectrom. 2021, 36, 1180–1192. [Google Scholar] [CrossRef]
- Habe, T.T.; Liu, C.; Covey, T.R.; Simon, R.P.; Reindl, W.; Buttner, F.H.; Winter, M.; Bischoff, D.; Luippold, A.H.; Runge, F. Ultrahigh-Throughput ESI-MS: Sampling Pushed to Six Samples per Second by Acoustic Ejection Mass Spectrometry. Anal. Chem. 2020, 92, 12242–12249. [Google Scholar] [CrossRef]
- Lin, X.C.; Wang, X.N.; Liu, L.; Wen, Q.; Yu, R.Q.; Jiang, J.H. Surface enhanced laser desorption ionization of phospholipids on gold nanoparticles for mass spectrometric immunoassay. Anal. Chem. 2016, 88, 9881–9884. [Google Scholar] [CrossRef] [Green Version]
- Engel, K.M.; Schiller, J. The value of coupling thin-layer chromatography to mass spectrometry in lipid research—A review. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 2021, 1185, 123001. [Google Scholar] [CrossRef] [PubMed]
- Taiariol, L.; Chaix, C.; Farre, C.; Moreau, E. Click and Bioorthogonal Chemistry: The Future of Active Targeting of Nanoparticles for Nanomedicines? Chem. Rev. 2021. [Google Scholar] [CrossRef]
- Indelicato, S.; Bongiorno, D.; Ceraulo, L. Recent approaches for chemical speciation and analysis by electrospray ionization (esi) mass spectrometry. Front. Chem. 2020, 8, 625945. [Google Scholar] [CrossRef] [PubMed]
- Specker, J.T.; Van Orden, S.L.; Ridgeway, M.E.; Prentice, B.M. Identification of phosphatidylcholine isomers in imaging mass spectrometry using gas-phase charge inversion ion/ion reactions. Anal. Chem. 2020, 92, 13192–13201. [Google Scholar] [CrossRef]
- Cui, T.; Ma, Y.; Yang, J.Y.; Liu, S.; Wang, Z.; Zhang, F.; Wang, J.; Cai, T.; Dong, L.; Hong, J.; et al. Protein corona-guided tumor targeting therapy via the surface modulation of low molecular weight PEG. Nanoscale 2021, 13, 5883–5891. [Google Scholar] [CrossRef] [PubMed]
- Murthy, N.S.; Wang, W.; Sommerfeld, S.D.; Vaknin, D.; Kohn, J. Temperature-Activated PEG Surface Segregation Controls the Protein Repellency of Polymers. Langmuir 2019, 35, 9769–9776. [Google Scholar] [CrossRef] [PubMed]
- Xu, C.F.; Iqbal, S.; Shen, S.; Luo, Y.L.; Yang, X.; Wang, J. Development of “CLAN” Nanomedicine for Nucleic Acid Therapeutics. Small 2019, 15, e1900055. [Google Scholar] [CrossRef]
- Mu, J.; Yu, L.L.; Wellems, T.E. Sensitive Immunoassay Detection of Plasmodium Lactate Dehydrogenase by Inductively Coupled Plasma Mass Spectrometry. Front. Cell Infect. Microbiol. 2020, 10, 620419. [Google Scholar] [CrossRef]
- Xing, Y.; Han, J.; Wu, X.; Pierce, D.T.; Zhao, J.X. Aggregation-based determination of mercury (II) using DNA-modified single gold nanoparticle, T-Hg (II)-T interaction, and single-particle ICP-MS. Mikrochim. Acta 2019, 187, 56. [Google Scholar] [CrossRef]
- Haggag, M.G.; Shafaa Medhat, W.; Kareem Hossam, S.; El-Gamil Amir, M.; El-Hendawy Hoda, H. Screening and enhancement of the antimicrobial activity of some plant oils using liposomes as nanoscale carrier. Bull. Natl. Res. Cent. 2021, 45. [Google Scholar] [CrossRef]
- Romero-Arrieta, M.R.; Uria-Canseco, E.; Perez-Casas, S. Simultaneous encapsulation of hydrophilic and lipophilic molecules in liposomes of DSPC. Thermochim. Acta 2020, 687. [Google Scholar] [CrossRef]
- Chou, W.C.; Hu, W.P.; Yang, Y.S.; Chan, H.W.; Chen, W.Y. Neutralized chimeric DNA probe for the improvement of GC-rich RNA detection specificity on the nanowire field-effect transistor. Sci. Rep. 2019, 9, 11056. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rotem, A.; Ram, O.; Shoresh, N.; Sperling, R.A.; Goren, A.; Weitz, D.A.; Bernstein, B.E. Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state. Nat. Biotechnol. 2015, 33, 1165–1172. [Google Scholar] [CrossRef] [PubMed]
- Akhtar, J.; More, P.; Albrecht, S.; Marini, F.; Kaiser, W.; Kulkarni, A.; Wojnowski, L.; Fontaine, J.F.; Andrade-Navarro, M.A.; Silies, M.; et al. TAF-ChIP: An ultra-low input approach for genome-wide chromatin immunoprecipitation assay. Life Sci. Alliance 2019, 2. [Google Scholar] [CrossRef] [Green Version]
- Wen, X.; Wang, J.; Zhang, D.; Ding, Y.; Ji, X.; Tan, Z.; Wang, Y. Reverse Chromatin Immunoprecipitation (R-ChIP) enables investigation of the upstream regulators of plant genes. Commun. Biol. 2020, 3, 770. [Google Scholar] [CrossRef] [PubMed]





| Probes | Sequence (5′ to 3′) |
|---|---|
| Optical Cleavage Probe | alkynyl-TTTTTTTT-PC-TTTT-PC-TTTTTTGGCAGCACCGACGTAGAC |
| Detection Probe | CCAACACTACTCGGCTAGCAGGTCTACGTCGGTGCTGCC |
| Trapping Probe | Biotin- TTTTTTTTTTGTACCACAAGGCCTTCGCGA |
| Target Chain | CTGCTAGCCGAGTAGTGTTGGGTCGCGAAGGCCTTGTGGTAC |
| Non-Complementary Target Chain | CGCGATGTTTTGGCGCGTTAGTTCGTTGCGTATATTTTGTTG |
| FITC Probe | FITC-AAAAAGTCTACGTCGGTGCTGCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lin, X.; Zhao, M.; Li, M.; Long, J.; Zhang, J.; Yu, F.; Xu, F.; Sun, L. Single-Molecule Detection of Nucleic Acids via Liposome Signal Amplification in Mass Spectrometry. Sensors 2022, 22, 1346. https://doi.org/10.3390/s22041346
Lin X, Zhao M, Li M, Long J, Zhang J, Yu F, Xu F, Sun L. Single-Molecule Detection of Nucleic Acids via Liposome Signal Amplification in Mass Spectrometry. Sensors. 2022; 22(4):1346. https://doi.org/10.3390/s22041346
Chicago/Turabian StyleLin, Xiangcheng, Mengmeng Zhao, Mingyue Li, Juan Long, Jing Zhang, Fang Yu, Fen Xu, and Lixian Sun. 2022. "Single-Molecule Detection of Nucleic Acids via Liposome Signal Amplification in Mass Spectrometry" Sensors 22, no. 4: 1346. https://doi.org/10.3390/s22041346
APA StyleLin, X., Zhao, M., Li, M., Long, J., Zhang, J., Yu, F., Xu, F., & Sun, L. (2022). Single-Molecule Detection of Nucleic Acids via Liposome Signal Amplification in Mass Spectrometry. Sensors, 22(4), 1346. https://doi.org/10.3390/s22041346

