An Enzyme- and Label-Free Fluorescence Aptasensor for Detection of Thrombin Based on Graphene Oxide and G-Quadruplex
Abstract
1. Introduction
2. Experimental Section
2.1. Materials and Reagents
2.2. Apparatus
2.3. The Sensing Procedure
2.4. Selectivity of the Thrombin Assay
3. Results and Discussion
3.1. Principle of the Method
3.2. The Feasibility of the Strategy
3.3. Optimization of Experimental Conditions
3.4. Analytical Performance
3.5. Selectivity of Thrombin Detection
3.6. Determination of Thrombin in Actual Samples (Serum)
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Lequin, R.M. Enzyme Immunoassay (EIA)/Enzyme-Linked Immunosorbent Assay (ELISA). Clin. Chem. 2005, 51, 2415–2418. [Google Scholar] [CrossRef]
- Lam, M.T.; Wan, Q.H.; Boulet, C.A.; Le, X.C. Competitive immunoassay for staphylococcal enterotoxin a using capillary electrophoresis with laser-induced fluorescence detection. J. Chromatogr. A 1999, 853, 545–553. [Google Scholar] [CrossRef]
- Baker, K.N.; Rendall, M.H.; Patel, A.; Boyd, P.; James, D.C. Rapid monitoring of recombinant protein products: A comparison of current technologies. Trends Biotechnol. 2002, 20, 149–156. [Google Scholar] [CrossRef]
- Stoltenburg, R.; Reinemann, C.; Strehlitz, B. Selex—A (r)evolutionary method to generate high-affinity nucleic acid ligands. Biomol. Eng. 2007, 24, 381–403. [Google Scholar] [CrossRef] [PubMed]
- Birch, C.M.; Hou, H.W.; Han, J.; Niles, J.C. Identification of malaria parasite-infected red blood cell surface aptamers by inertial microfluidic SELEX (I-SELEX). Sci. Rep. 2015, 5, 11347. [Google Scholar] [CrossRef] [PubMed]
- Cho, E.J.; Lee, J.W.; Ellington, A.D. Applications of aptamers as sensors. Annu. Rev. Anal. Chem. 2009, 2, 241–264. [Google Scholar] [CrossRef] [PubMed]
- Tombelli, S.; Minunni, A.A. Analytical applications of aptamers. Biosens. Bioelectron. 2005, 20, 2424–2434. [Google Scholar] [CrossRef] [PubMed]
- Shamah, S.M.; Healy, J.M.; Cload, S.T. Complex target selex. Acc. Chem. Res. 2008, 41, 130–138. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Cao, Z.; Lu, Y. Functional nucleic acid sensors. Chem. Rev. 2009, 109, 1948. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Chen, J.; Zhao, S.; Shi, M.; Chen, Z.F.; Liang, H. Label-free colorimetric aptasensor based on nicking enzyme assisted signal amplification and dnazyme amplification for highly sensitive detection of protein. Anal. Chem. 2013, 85, 4423–4430. [Google Scholar] [CrossRef]
- He, F.; Tang, Y.; Wang, S.; Li, Y.; Zhu, D. Fluorescent amplifying recognition for DNA G-quadruplex folding with a cationic conjugated polymer: A platform for homogeneous potassium detection. J. Am. Chem. Soc. 2005, 127, 12343–12346. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Liu, X.; Hu, X.; Song, S.; Fan, C. Unmodified gold nanoparticles as a colorimetric probe for potassium DNA aptamers. Chem. Commun. 2006, 36, 3780–3782. [Google Scholar] [CrossRef] [PubMed]
- Kong, L.; Xu, J.; Xu, Y.; Xiang, Y.; Yuan, R.; Chai, Y. A universal and label-free aptasensor for fluorescent detection of ATP and thrombin based on SYBR Green I dye. Biosens. Bioelectron. 2013, 42, 193–197. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Xu, J.; Xiang, Y.; Yuan, R.; Chai, Y. Target-induced structure switching of hairpin aptamers for label-free and sensitive fluorescent detection of ATP via exonuclease-catalyzed target recycling amplification. Biosens. Bioelectron. 2014, 51, 293–296. [Google Scholar] [CrossRef] [PubMed]
- Michaud, M.; Jourdan, E.; Villet, A.; Ravel, A.; Catherine Grosset, A.; Peyrin, E. A DNA aptamer as a new target-specific chiral selector for HPLC. J. Am. Chem. Soc. 2003, 125, 8672–8679. [Google Scholar] [CrossRef] [PubMed]
- Fang, X.; Tan, W. Aptamers Generated from Cell-SELEX for Molecular Medicine: A Chemical Biology Approach. Acc. Chem. Res. 2010, 43, 48–57. [Google Scholar] [CrossRef] [PubMed]
- Jiang, B.; Wang, M.; Chen, Y.; Xie, J.; Xiang, Y. Highly sensitive electrochemical detection of cocaine on graphene/AuNP modified electrode via catalytic redox-recycling amplification. Biosens. Bioelectron. 2012, 32, 305–308. [Google Scholar] [CrossRef]
- Zhu, X.; Zhao, J.; Wu, Y.; Shen, Z.; Li, G. Fabrication of a Highly Sensitive Aptasensor for Potassium with a Nicking Endonuclease-Assisted Signal Amplification Strategy. Anal. Chem. 2011, 83, 4085–4089. [Google Scholar] [CrossRef]
- Zhou, W.; Gong, X.; Xiang, Y.; Yuan, R.; Chai, Y. Target-Triggered Quadratic Amplification for Label-Free and Sensitive Visual Detection of Cytokines Based on Hairpin Aptamer DNAzyme Probes. Anal. Chem. 2014, 86, 953–958. [Google Scholar] [CrossRef]
- Yang, R.; Tang, Z.; Yan, J.; Kang, H.; Kim, Y.; Zhu, Z. Noncovalent assembly of carbon nanotubes and single-stranded DNA: An effective sensing platform for probing biomolecular interactions. Anal. Chem. 2008, 80, 7408–7413. [Google Scholar] [CrossRef]
- Stojanovic, M.N.; Prada, P.D.; Landry, D.W. Fluorescent Sensors Based on Aptamer Self-Assembly. J. Am. Chem. Soc. 2000, 122, 11547–11548. [Google Scholar] [CrossRef] [PubMed]
- Tang, Z.; Mallikaratchy, P.; Yang, R.; Kim, Y.; Zhu, Z.; Wang, H. Aptamer Switch Probe Based on Intramolecular Displacement. J. Am. Chem. Soc. 2008, 130, 11268–11269. [Google Scholar] [CrossRef] [PubMed]
- Kim, B.; Hwan, J.I.; Mijeong, K.; Hongku, S.; Young, W.H. Cationic conjugated polyelectrolytes-triggered conformational change of molecular beacon aptamer for highly sensitive and selective potassium ion detection. J. Am. Chem. Soc. 2012, 134, 3133–3138. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Wang, L.; Zhang, H.; Boey, F.; Song, S.; Fan, C. Aptamer-Based Multicolor Fluorescent Gold Nanoprobes for Multiplex Detection in Homogeneous Solution. Small 2010, 6, 201–204. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Xue, S.; Yi, H.; Jing, P.; Chai, Y.; Yuan, R. A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes. Chem. Commun. 2015, 51, 1472–1474. [Google Scholar] [CrossRef] [PubMed]
- Xue, L.; Zhou, X.; Xing, D. Sensitive and Homogeneous Protein Detection Based on Target-Triggered Aptamer Hairpin Switch and Nicking Enzyme Assisted Fluorescence Signal Amplification. Anal. Chem. 2012, 84, 3507–3513. [Google Scholar] [CrossRef] [PubMed]
- Tuleuova, N.; Jones, C.N.; Yan, J.; Ramanculov, E.; Yokobayashi, Y.; Revzin, A. Development of an Aptamer Beacon for Detection of Interferon-Gamma. Anal. Chem. 2010, 82, 1851–1857. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Liu, Y.; Liu, C.; Huang, J.; Yang, P.; Liu, B. Microfluidic chip-based aptasensor for amplified electrochemical detection of human thrombin. Electrochem. Commun. 2010, 12, 258–261. [Google Scholar] [CrossRef]
- Shuman, M.A.; Majerus, P.W. The measurement of thrombin in clotting blood by radioimmunoassay. J. Clin. Investig. 1976, 58, 1249–1258. [Google Scholar] [CrossRef]
- Tan, Y.; Zhang, X.; Xie, Y.; Zhao, R.; Tan, C.; Jiang, Y. Label-free fluorescent assays based on aptamer-target recognition. Analyst 2012, 137, 2309–2312. [Google Scholar] [CrossRef]
- Yan, S.; Huang, R.; Zhou, Y.; Zhang, M.; Deng, M.; Wang, X. Aptamer-based turn-on fluorescent four-branched quaternary ammonium pyrazine probe for selective thrombin detection. Chem. Commun. 2011, 47, 1273–1275. [Google Scholar] [CrossRef] [PubMed]
- Zheng, A.X.; Wang, J.R.; Li, J.; Song, X.R.; Chen, G.N.; Yang, H.H. Enzyme-free fluorescence aptasensor for amplification detection of human thrombin via target-catalyzed hairpin assembly. Biosens. Bioelectron. 2012, 36, 217–221. [Google Scholar] [CrossRef] [PubMed]
- Kuang, L.; Cao, S.P.; Zhang, L.; Li, Q.H.; Liu, Z.C.; Liang, R.P. A novel nanosensor composed of aptamer bio-dots and gold nanoparticles for determination of thrombin with multiple signals. Biosens. Bioelectron. 2016, 85, 798–806. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Xu, D.D.; Pang, D.W.; Tang, H.W. Fluorescent sensing of thrombin using a magnetic nano-platform with aptamer-target-aptamer sandwich and fluorescent silica nanoprobe. J. Lumin. 2017, 187, 9–13. [Google Scholar] [CrossRef]
- Wang, J.; Li, B.; Lu, Q.; Li, X.; Weng, C.; Yan, X. A versatile fluorometric aptasensing scheme based on the use of a hybrid material composed of polypyrrole nanoparticles and dna-silver nanoclusters: Application to the determination of adenosine, thrombin, or interferon-gamma. Microchimica Acta 2019, 186, 356. [Google Scholar] [CrossRef] [PubMed]
- Niu, S.; Qu, L.; Zhang, Q.; Lin, J. Fluorescence detection of thrombin using autocatalytic strand displacement cycle reaction and a dual-aptamer DNA sandwich assay. Anal. Biochem. 2012, 421, 362–367. [Google Scholar] [CrossRef]
- Fu, B.; Cao, J.; Jiang, W.; Wang, L. A novel enzyme-free and label-free fluorescence aptasensor for amplified detection of adenosine. Biosens. Bioelectron. 2013, 44, 52–56. [Google Scholar] [CrossRef]
- Choi, M.S.; Yoon, M.; Baeg, J.O.; Kim, J. Label-free dual assay of DNA sequences and potassium ions using an aptamer probe and a molecular light switch complex. Chem. Commun. 2009, 47, 7419–7421. [Google Scholar] [CrossRef]
- Novoselov, K.S.; Geim, A.K.; Morozov, S.V. Electric Field Effect in Atomically Thin Carbon Films. Science 2004, 306, 666–669. [Google Scholar] [CrossRef]
- Li, L.L.; Liu, K.P.; Yang, G.H.; Wang, C.M.; Zhang, J.R.; Zhu, J.J. Fabrication of graphene–quantum dots composites for sensitive electrogenerated chemiluminescence immunosensing. Adv. Funct. Mater. 2011, 21, 869–878. [Google Scholar] [CrossRef]
- Liu, Z.; Robinson, J.T.; Sun, X.; Dai, H. PEGylated Nano-Graphene Oxide for Delivery of Water Insoluble Cancer Drugs. J. Am. Chem. Soc. 2008, 130, 10876–10877. [Google Scholar] [CrossRef] [PubMed]
- Dikin, D.A.; Stankovich, S.; Zimney, E.J.; Piner, R.D.; Ruoff, R.S. Preparation and characterization of graphene oxide paper. Nature 2007, 448, 457–460. [Google Scholar] [CrossRef] [PubMed]
- Swathi, R.S.; Sebastian, K.L. Long range resonance energy transfer from a dye molecule to graphene has (distance)(-4) dependence. J. Chem. Phys. 2009, 130, 086101. [Google Scholar] [CrossRef] [PubMed]
- Wu, W.; Hu, H.; Li, F.; Wang, L.; Gao, J.; Lu, J. A graphene oxide-based nano-beacon for DNA phosphorylation analysis. Chem. Commun. 2011, 47, 1201–1203. [Google Scholar] [CrossRef] [PubMed]
- Tang, L.; Chang, H.; Liu, Y.; Li, J. Duplex DNA/Graphene Oxide Biointerface: From Fundamental Understanding to Specific Enzymatic Effects. Adv. Funct. Mater. 2012, 22, 3083–3088. [Google Scholar] [CrossRef]
- Chun, H.L.; Li, J.; Mei, H.L.; Yi, W.W.; Huang, H.Y.; Chen, X. Amplified Aptamer-Based Assay through Catalytic Recycling of the Analyte. Angew. Chem. 2010, 49, 8454–8457. [Google Scholar]
- He, S.; Song, B.; Li, D.; Zhu, C.; Qi, W.; Wen, Y. A Graphene Nanoprobe for Rapid, Sensitive, and Multicolor Fluorescent DNA Analysis. Adv. Funct. Mater. 2010, 20, 453–459. [Google Scholar] [CrossRef]
- Chang, H.; Tang, L.; Wang, Y.; Jiang, J.; Li, J. Graphene fluorescence resonance energy transfer aptasensor for the thrombin detection. Anal. Chem. 2010, 82, 2341–2346. [Google Scholar] [CrossRef]
- Dong, H.; Gao, W.; Yan, F.; Ji, H.; Ju, H. Fluorescence resonance energy transfer between quantum dots and graphene oxide for sensing biomolecules. Anal. Chem. 2010, 82, 5511–5517. [Google Scholar] [CrossRef]
- Loh, K.P.; Bao, Q.; Eda, G.; Chhowalla, M. Graphene oxide as a chemically tunable platform for optical applications. Nat. Chem. 2010, 2, 1015–1024. [Google Scholar] [CrossRef]
- Du, D.; Wang, L.; Shao, Y.; Wang, J.; Engelhard, M.H.; Lin, Y. Functionalized Graphene Oxide as a Nanocarrier in a Multienzyme Labeling Amplification Strategy for Ultrasensitive Electrochemical Immunoassay of Phosphorylated p53 (S392). Anal. Chem. 2011, 83, 746–752. [Google Scholar] [CrossRef] [PubMed]
- Cui, L.; Lin, X.; Lin, N. Graphene oxide-protected DNA probes for multiplex microRNA analysis in complex biological samples based on a cyclic enzymatic amplification method. Chem. Commun. 2011, 48, 194–196. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Li, Z.; Hu, D.; Lin, C.T.; Lin, Y. Aptamer/Graphene Oxide Nanocomplex for in Situ Molecular Probing in Living Cells. J. Am. Chem. Soc. 2010, 132, 9274–9276. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Ren, J.; Liu, Y.; Wang, E. Application of DNA machine in amplified DNA detection. Chem. Commun. 2013, 50, 704–706. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Ren, J.; Fan, D.; Liu, Y.; Wang, E. Integration of graphene oxide and DNA as a universal platform for multiple arithmetic logic units. Chem. Commun. 2014, 50, 14390–14393. [Google Scholar] [CrossRef]
- Lv, L.; Guo, Z.; Wang, J.; Wang, E. G-Quadruplex as Signal Transducer for Biorecognition Events. Curr. Pharm. Design 2012, 18, 2076–2095. [Google Scholar] [CrossRef] [PubMed]
- Lu, L.; Wang, W.; Wang, M.; Kang, T.S.; Lu, J.J.; Chen, X.P.; Han, Q.B.; Leung, C.H.; Ma, D.L. A luminescent G-quadruplex-selective iridium (III) complex for the label-free detection of lysozyme. J. Mater. Chem. B 2016, 4, 2407–2411. [Google Scholar] [CrossRef]
- Lu, L.; Mao, Z.; Kang, T.S.; Leung, C.H.; Ma, D.L. A versatile nanomachine for the sensitive detection of platelet-derived growth factor-BB utilizing a G-quadruplex-selective iridium(III) complex. Biosens. Bioelectron. 2016, 85, 300–309. [Google Scholar] [CrossRef]






| Name | Sequences (5’-3’) |
|---|---|
| S | AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGGTAGGGCGGGTTGGG |
| S1 | AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGGTA |
| S2 | AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGGTAGGGC |
| S3 | AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGGTAGGGCGGGT |
| Methods | Analytical Range | Detection Limit (nM) | Ref. |
|---|---|---|---|
| Fluorescence detection | 1.1–500 nM | 1.1 | [13] |
| Fluorescence detection | 0.59–35 nM | 0.59 | [33] |
| Fluorescence detection | 0.7 nM–0.16 µM | 0.7 | [34] |
| Fluorescence detection | 2.21–25 nM | 2.21 | [35] |
| Fluorescence detection | 0.37 nM–50 µM | 0.37 | This work |
| Samples | Thrombin Added | Detected | SD | Recovery |
|---|---|---|---|---|
| 1 | 0.1 µM | 0.11 µM | 30.8% | 110% |
| 2 | 1 µM | 0.97 µM | 21.7% | 97% |
| 3 | 10 µM | 10.65 µM | 19.6% | 106.5% |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wei, Y.; Wang, L.; Zhang, Y.; Dong, Y. An Enzyme- and Label-Free Fluorescence Aptasensor for Detection of Thrombin Based on Graphene Oxide and G-Quadruplex. Sensors 2019, 19, 4424. https://doi.org/10.3390/s19204424
Wei Y, Wang L, Zhang Y, Dong Y. An Enzyme- and Label-Free Fluorescence Aptasensor for Detection of Thrombin Based on Graphene Oxide and G-Quadruplex. Sensors. 2019; 19(20):4424. https://doi.org/10.3390/s19204424
Chicago/Turabian StyleWei, Yani, Luhui Wang, Yingying Zhang, and Yafei Dong. 2019. "An Enzyme- and Label-Free Fluorescence Aptasensor for Detection of Thrombin Based on Graphene Oxide and G-Quadruplex" Sensors 19, no. 20: 4424. https://doi.org/10.3390/s19204424
APA StyleWei, Y., Wang, L., Zhang, Y., & Dong, Y. (2019). An Enzyme- and Label-Free Fluorescence Aptasensor for Detection of Thrombin Based on Graphene Oxide and G-Quadruplex. Sensors, 19(20), 4424. https://doi.org/10.3390/s19204424
