Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691
Supplementary Materials
Supplementary File 1Reference
- Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K.; Kim, K-P. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691. [Google Scholar] [CrossRef] [PubMed]
| Primer | Sequence a | Location in Lap Gene | Product Size (bp) | Specificity | 
|---|---|---|---|---|
| ELAP-F1 | 5′CGGTCCCCGGGTACCATGGCAATTAAAGAAAATGCGGCC3′ | 1–1301 | 1301 | Listeria spp. (except L. grayi, L. rocourtiae) | 
| LIS-R1 | 5′TTTGTGATACAGAGTTTTTACC3′ | |||
| Inn-F1 | 5′GGAGTTATTAACGAAGATACT3′ | 286–822 | 536 | L. innocua | 
| Inn-R1 | 5′TTCTGCTTTTACTTCTTTAGCA3′ | |||
| IvaSee-F1 | 5′AAGCTGCAGTTATTCATTCC3′ | 1137–1743 | 606 | L. ivanovii, L. seeligeri | 
| IvaSee-R1 | 5′ATCTAAGAATTTTTGTTTTAGT3′ | |||
| Wel-F1 | 5′TTCTCGTATTATCGGTTTACCA3′ | 2344–2581 | 237 | L. welshimeri | 
| Wel-R1 | 5′GCTTCAAGATAGATTTCTTTCAA3′ | |||
| Mar-F1 | 5′AGAATATATTTGGAACAGCATC3′ | 246–2059 | 1813 | L. marthii | 
| Mar-R1 | 5′GTTCGATTGCACGGATGGAAAG3′ | 
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691. Sensors 2017, 17, 945. https://doi.org/10.3390/s17050945
Kim K-P, Singh AK, Bai X, Leprun L, Bhunia AK. Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691. Sensors. 2017; 17(5):945. https://doi.org/10.3390/s17050945
Chicago/Turabian StyleKim, Kwang-Pyo, Atul K. Singh, Xingjian Bai, Lena Leprun, and Arun K. Bhunia. 2017. "Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691" Sensors 17, no. 5: 945. https://doi.org/10.3390/s17050945
APA StyleKim, K.-P., Singh, A. K., Bai, X., Leprun, L., & Bhunia, A. K. (2017). Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691. Sensors, 17(5), 945. https://doi.org/10.3390/s17050945
 
         
                                                


 
       