Molecular Mechanism of Oryza sativa L. Under Long Day Regime Based on Transcriptome Analysis
Abstract
1. Introduction
2. Materials and Methods
2.1. Test Material
2.2. Total RNA Extraction and Detection, cDNA Library Construction, and Transcriptome Sequencing
2.3. Raw Data Processing and Comparison with Reference Genome Sequence
2.4. Analysis of Differential Gene Expressions (DEGs)
2.5. Analysis of Gene Ontology (GO) Functional Enrichment
2.6. Analysis of KEGG Pathway Enrichment
2.7. Real-Time Fluorescent Quantitative PCR Analysis
3. Results
3.1. Analysis of RNA-Seq Sequence
3.2. Functional Annotation of Genes
3.3. Display of Differentially Expressed Genes in Rice at Different Periods of Time
3.4. Comparison of Differentially Expressed Genes in Rice at Different Times
3.5. GO Function Enrichment Analysis of Differential Genes
3.6. KEGG Pathway Analysis of Differential Genes
3.7. Photoperiod-Related Differentially Expressed Genes
3.8. Expression Patterns of Photoperiod-Related Differentially Expressed Genes in Rice
3.9. Differential Gene Expression Specific to the Mid-Diameter in Y4 vs. F4 and Y9 vs. F9
- a.
- Differential genes in photoperiod pathway
- b.
- Differential expression of signaling-related genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Song, X.H.; Tian, L.; Wang, S.X.; Zhou, J.L.; Zhang, J.; Chen, Z.; Wu, L.J.; Ku, L.X.; Chen, Y.H. Integrating transcriptomic and proteomic analyses of photoperiod-sensitive in near isogenic maize line under long-day conditions. J. Integr. Agric. 2019, 18, 1211–1221. [Google Scholar] [CrossRef]
- Kathleen, G.; Robertson, C.M. Integrating circadian dynamics with physiological processes in plants. Nat. Rev. Genet. 2004, 16, 598–610. [Google Scholar] [CrossRef]
- Fernando, A.; George, C. The genetic basis of flowering responses to seasonal cues. Nat. Rev. Genet. 2012, 13, 627–639. [Google Scholar] [CrossRef]
- Soledad, P.; Nathanael, N.; Fran, R.; Weller, J.L.; Bond, D.M.; Macknight, R.C. Mutation in Phytochromobilin synthase Alters the Circadian Clock and Photoperiodic Flowering of Medicago truncatula. Plants 2022, 11, 239. [Google Scholar] [CrossRef]
- Sanchez, E.S.; Rugnone, L.M.; Kay, A.S. Light Perception: A Matter of Time. Mol. Plant 2020, 13, 363–385. [Google Scholar] [CrossRef] [PubMed]
- Xue, W.Y.; Xing, Y.Z.; Weng, X.Y.; Zhao, Y.; Tang, W.J.; Wang, L.; Zhou, H.J.; Yu, S.B.; Xu, C.G.; Li, X.H.; et al. Natural variation in Ghd7 is an important regulator of heading date and yield potential in rice. Nat. Genet. 2008, 40, 761–767. [Google Scholar] [CrossRef]
- Norihito, N.; Toru, K.; Nobue, M.; Takatoshi, K.; Toshinori, K.; Hitoshi, S. Flowering time control in rice by introducing Arabidopsis clock-associated PSEUDO-RESPONSE REGULATOR 5. Biosci. Biotechnol. Biochem. 2020, 84, 970–979. [Google Scholar] [CrossRef]
- Pathak, H.; Kumar, M.; Molla, K.; Chakraborty, K. Abiotic stresses in rice production: Impacts and management. Environ. Sci. Technol. 2021, 58, 103–125. [Google Scholar] [CrossRef]
- Izawa, T. Adaptation of flowering-time by natural and artificial selection in Arabidopsis and rice. J. Exp. Bot. 2007, 58, 3091–3097. [Google Scholar] [CrossRef]
- Song, H.Y.; Shim, S.J.; Kinmonth-Schultz, A.H.; Imaizumi, T. Photoperiodic Flowering: Time Measurement Mechanisms in Leaves. Annu. Rev. Plant Biol. 2015, 66, 441–464. [Google Scholar] [CrossRef]
- Hayama, R.; Yokoi, S.; Tamaki, S.; Yano, M.; Shimamoto, K. Adaptation of photoperiodic control pathways produces short-day flowering in rice. Nature 2023, 422, 719–722. [Google Scholar] [CrossRef]
- Doi, K.; Izawa, T.; Fuse, T.; Yamanouchi, U.; Kubo, T.; Shimatani, Z.; Yano, M.; Yoshimura, A. Ehd1, a B-type response regulator in rice, confers short-day promotion of flowering and controls FT-like gene expression independently of Hd1. Genes Dev. 2004, 18, 926–936. [Google Scholar] [CrossRef]
- Komiya, R.; Yokoi, S.; Shimamoto, K. A gene network for long-day flowering activates RFT1 encoding a mobile flowering signal in rice. Development 2009, 136, 3443–3450. [Google Scholar] [CrossRef]
- Izawa, T.; Takahashi, Y.; Yano, M. Comparative biology comes into bloom: Genomic and genetic comparison of flowering pathways in rice and Arabidopsis. Curr. Opin. Plant Biol. 2003, 6, 113–120. [Google Scholar] [CrossRef] [PubMed]
- Zhou, S.R.; Zhu, S.S.; Cui, S.; Hou, H.G.; Wu, H.Q.; Hao, B.Y.; Cai, L.; Xu, Z.; Liu, L.L.; Jiang, L.; et al. Transcriptional and post-transcriptional regulation of heading date in rice. New. Phytol. 2020, 230, 943–956. [Google Scholar] [CrossRef] [PubMed]
- Komiya, R.; Ikegami, A.; Tamaki, S.; Yokoi, S.; Shimamoto, K. Hd3a and RFT1 are essential for flowering in rice. Development 2008, 135, 767–774. [Google Scholar] [CrossRef]
- Tsuji, H.; Taoka, K.; Shimamoto, K. Regulation of flowering in rice: Two florigen genes, a complex gene network, and natural variation. Curr. Opin. Plant Biol. 2010, 14, 45–52. [Google Scholar] [CrossRef]
- Matsubara, K.; Yamanouchi, U.; Wang, Z.X.; Minobe, Y.; Izawa, T. Ehd2, a rice ortholog of the maize INDETERMINATE1 gene, promotes flowering by up-regulating Ehd1. Plant Physiol. 2008, 148, 1425–1435. [Google Scholar] [CrossRef]
- Dai, X. LHD1, an allele of DTH8/Ghd8, controls late heading date in common wild rice (Oryza rufipogon). J. Intgr. Plant Biol. 2012, 54, 790–799. [Google Scholar] [CrossRef] [PubMed]
- Tsuji, H.; Taoka, K.; Shimamoto, K. Florigen in rice: Complex gene network for florigen transcription, florigen activation complex, and multiple functions. Curr. Opin. Plant Biol. 2013, 16, 228–235. [Google Scholar] [CrossRef]
- Goretti, D.; Martignago, D.; Landini, M.; Brambilla, V.; Ariza, J.G.; Gnesutta, N.; Galbiati, F.; Collani, S.; Takagi, H.; Terauchi, R.; et al. Transcriptional and post-transcriptional mechanisms limit heading date 1 (Hd1) function to adapt rice to high latitudes. PLoS Genet. 2017, 13, e1006530. [Google Scholar] [CrossRef]
- Nemoto, Y.; Nonoue, Y.; Yano, M.; Izawa, T. Hd1, a CONSTANS ortholog in rice, functions as an Ehd1 repressor through interaction with monocot-specific CCT-domain protein Ghd7. Plant J. 2016, 86, 221–233. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Zhang, F.; Zhou, X.; Poh, T.X.; Xie, L.; Shen, J.; Yang, L.J.; Song, S.Y.; Yu, H.; Chen, Y. The tetratricopeptide repeat protein OsTPR075 promotes heading by regulating florigen transport in rice. Plant Cell 2022, 34, 3632–3646. [Google Scholar] [CrossRef]
- Song, S.; Chen, Y.; Liu, L.; Wang, Y.; Bao, S.; Zhou, X. OsFTIP1-mediated regulation of florigen transport in rice is negatively regulated by the ubiquitin-like domain kinase OsUbDKγ4. Plant Cell 2017, 29, 491–507. [Google Scholar] [CrossRef] [PubMed]
- Subudhi, P.K.; De, L.T.B.; Tapia, R.; Chai, C.L.; Karan, R.; Ontoy, J.; Ontoy, J.; Singh, P.K. Genetic interaction involving photoperiod-responsive Hd1 promotes early flowering under long-day conditions in rice. Sci Rep. 2018, 8, 2081. [Google Scholar] [CrossRef] [PubMed]
- Luo, W.J.; Li, Y.J.; Ma, P.J.; Lu, X.P.; Chen, C.J.; Yang, L.J.; He, D.M.; Wang, X.L. Transcriptomic analysis of Medicago truncatula under long day conditions. Diversity 2023, 15, 1020. [Google Scholar] [CrossRef]
- Chen, S.F.; Zhou, Y.Q.; Chen, Y.R.; Gu, J. Fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Ali, M.; Brian, A.W.; Kenneth, M.; Lorian, S.; Barbara, W. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene Ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef]
- Minoru, K.; Susumu, G.; Shuichi, K.; Yasushi, O.; Masahiro, H. The KEGG resource for deciphering the genome. Nucleic Acids Res. 2004, 32, D277–D280. [Google Scholar] [CrossRef]
- Mukesh, J.; Aashima, N.; Akhilesh, K.T.; Jitendra, P.K. Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real—Time PCR. Biochem. Biophys. Res. Commun. 2006, 345, 646–651. [Google Scholar] [CrossRef]
- Wang, L.; Wei, J.; Shi, X.Y.; Qian, W.H.; Mehmood, J.; Yin, Y.M.; Jia, H.J. Identification of the Light-Harvesting Chlorophyll a/b Binding Protein Gene Family in Peach (Prunus persica L.) and Their Expression under Drought Stress. Genes 2023, 14, 1475. [Google Scholar] [CrossRef]
- Matsubara, K.; Yano, M. Genetic and molecular dissection of flowering time control in rice. In Rice Genomics, Genet Breeding; Springer: Singapore, 2018; Volume 15, pp. 177–190. [Google Scholar] [CrossRef]
- Wu, M.J.; Liu, H.Q.; Lin, Y.; Chen, J.M.; Fu, Y.P.; Luo, J.M.; Zhang, Z.J.; Liang, K.J.; Chen, S.B.; Wang, F. In-frame and frame -shit editing of the Ehd1 gene to develop japonica rice with prolonged basic Nutrient growth period periods. Front. Plant Sci. 2020, 11, 307. [Google Scholar] [CrossRef]
- Li, X.F.; Tian, X.J.; He, M.L.; Liu, X.X.; Li, Z.Y.; Tang, J.Q.; Mei, E.Y.; Xu, M.; Liu, Y.X.; Wang, Z.Y.; et al. bZIP71 delays flowering by suppressing Ehd1 expression in rice. J. Integr. Plant Biol. 2022, 64, 1352–1363. [Google Scholar] [CrossRef]
- Li, C.; Liu, X.J.; Yan, Y.; Alam, M.S.; Liu, Z.; Yang, Z.K.; Tao, R.F.; Yue, E.; Duan, M.H.; Xu, J.H. OsLHY is involved in regulating flowering through the Hd1- and Ehd1- mediated pathways in rice (Oryza sativa L.). Plant Sci. 2022, 315, 111145. [Google Scholar] [CrossRef] [PubMed]
- Duan, Y.L.; Xing, Z.; Diao, Z.; Xu, W.Y.; Li, S.P.; Du, X.Q.; Wu, G.H.; Wang, C.L.; Lan, T.; Meng, Z.; et al. Characterization of Osmads6-5, a null allele, reveals that OsMADS6 is a critical regulator for early flower development in rice (Oryza sativa L.). Plant Mol. Biol. 2012, 80, 429–442. [Google Scholar] [CrossRef]
- Zou, Z.; Yang, J. Genomics analysis of the light-harvesting chlorophyll a/b-binding (Lhc) superfamily in cassava (Manihot esculenta Crantz). Gene 2019, 702, 171–181. [Google Scholar] [CrossRef]
- Yadavalli, V.; Neelam, S.; Rao, A.; Reddy, A.; Subramanyam, R. Differential degradation of photosystem I subunits under iron deficiency in rice. J. Plant Physiol. 2012, 169, 753–759. [Google Scholar] [CrossRef]
- Luo, J.; Abid, M.; Tu, J.; Gao, P.; Wang, Z.; Huang, H. Genome-Wide Identification of the LHC Gene Family in Kiwifruit and Regulatory Role of AcLhcb3.1/3.2 for Chlorophyll a Content. Int. J. Mol. Sci. 2022, 23, 6528. [Google Scholar] [CrossRef]
- Zhang, Q.; Ma, C.; Wang, X.; Ma, Q.; Fan, S.; Zhang, C. Genome-wide identification of the light-harvesting chlorophyll a/b binding (Lhc) family in Gossypium hirsutum reveals the influence of GhLhcb2.3 on chlorophyll a synthesis. Plant Biol. 2021, 23, 831–842. [Google Scholar] [CrossRef] [PubMed]
- Xia, Y.; Ning, Z.; Bai, G.; Li, R.; Yan, G.; Siddique, K.H.; Baum, M.; Guo, P.G. Allelic variations of a light harvesting chlorophyll a/b-binding protein gene (Lhcb1) associated with agronomic traits in barley. PLoS ONE 2012, 7, e37573. [Google Scholar] [CrossRef] [PubMed]
- Fujino, K.J.; Obara, M.; Ikegaya, T.; Tamura, K. Genetic shift in local rice populations during rice breeding programs in the northern limit of rice cultivation in the world. TAG. Theoretical and applied genetics. Theor. Appl. Genet. 2015, 128, 1739–1746. [Google Scholar] [CrossRef] [PubMed]
- Ding, X.C.; Liu, S.; Duan, X.W.; Pan, X.J.; Dong, B.Y. MAPK cascade and ROS metabolism are involved in GABA-induced disease resistance in red pitaya fruit. Postharvest Biol. Technol. 2023, 200, 112324. [Google Scholar] [CrossRef]











| Variety | Developmental Stages | Sample Number | Duplicate Group Number |
|---|---|---|---|
| Oryza sativa, L., FaGI | Nutrient growth period | F4 | F4-1, F4-2, F4-3 |
| Flowering period | F9 | KF9-1, KF9-2, KF9-3 | |
| Oryza sativa, L., NIP | Nutrient growth period | Y4 | Y4-1, Y4-2, Y4-3 |
| Flowering period | Y9 | Y9-1, Y9-2, Y9-3 |
| Gene | Forward Primer Sequence (5′→3′) | Reverse Primer Sequence (5′→3′) |
|---|---|---|
| OSHAP5C | GCCATGGCGGTGCGG | GCCATGGCGGTGCGG |
| OsLFL1 | ACGTAAGCCAGCTAGGGAGA | TGGGCCAATACCTGTACTTGAA |
| Lhca6 | GGGCCCCATTGATAACCTCC | GGACGTGAATGCCGAGAAGA |
| OsCRD1 | CATTGCTGCGTACCTCATGC | CAGTAGACAAGCTGGGGCTC |
| OsBBX22 | ACGAGCAGTTCAACACCCCT | AAGAACTCGTTGAGCGGCCA |
| OsSIG6 | CCCCAGGGAGAAGGAGATCA | CCCAAACATGTCCCCGATGA |
| OsIRL5 | CCAAGTGGCAAGCCTGATAGA | TCTCGGAAAGATCAAGCTCGG |
| GH3-2 | CGGGGGAGAGGAAGCTAATG | GCACGTACAAGTTCATGACGG |
| GA20OX4 | CGATAATGGCGGTGCTAGGG | CTGCTGTCCTCGAAGAACTCC |
| UBC | CCGTTTGTAGAGCCATAATTGCA | AGGTTGCCTGAGTCA-CAGTTAAGTG |
| Sample | Reads No. | Clean Reads No. | Q30 (%) | Total Mapped | Multiple Mapped | Uniquely Mapped |
|---|---|---|---|---|---|---|
| Y4-1 | 56189344 | 55528062 | 94.46 | 97.53% | 4.02% | 95.98% |
| Y-4-2 | 57606664 | 56925488 | 94.51 | 97.47% | 4.01% | 95.99% |
| Y-4-3 | 55151200 | 54623408 | 95.34 | 97.62% | 3.78% | 96.22% |
| F-4-1 | 57563602 | 56873476 | 94.70 | 96.89% | 4.18% | 95.82% |
| F-4-2 | 50968158 | 50313494 | 94.64 | 97.61% | 6.35% | 93.65% |
| F-4-3 | 53927314 | 53294994 | 94.80 | 97.46% | 4.04% | 95.96% |
| Y9-1 | 44032512 | 43614486 | 95.20 | 98.91% | 4.35% | 95.65% |
| Y9-2 | 39821914 | 39425780 | 95.00 | 98.51% | 8.64% | 91.36% |
| Y93 | 46534156 | 46044328 | 94.91 | 98.53% | 4.99% | 95.01% |
| F9-1 | 41974744 | 41501176 | 94.75 | 99.09% | 4.46% | 95.54% |
| F9-2 | 51869752 | 51289162 | 94.90 | 98.82% | 4.56% | 95.44% |
| F9-3 | 46273678 | 45817828 | 94.93 | 98.92% | 3.98% | 96.02% |
| Contrast Numbering | DEGs Annotated in Each Database | |||||
|---|---|---|---|---|---|---|
| NR | GO | KEGG | Egg NOG | Swissprot | Total | |
| Y4 vs. F4 | 12,917 | 6464 | 4850 | 11,219 | 9429 | 44,879 |
| Y9 vs. F9 | 14,115 | 7180 | 5385 | 12,337 | 10,431 | 49,448 |
| Development Stage | Gene ID | Database Annotation | Gene Function | Log2 (Fold Change) |
|---|---|---|---|---|
| Y4 vs. F4 | Os01g0713600 | response to light stimulus | B3 DNA-binding domain-containing transcription factor | 1.64 |
| Os03g0251350 | response to light stimulus | Histone-fold domain containing protein | 1.88 | |
| Os03g0272400 | response to red or far red light | Conserved hypothetical protein | 1.33 | |
| Os06g0713000 | response to light stimulus | Zinc finger, B-box domain containing protein | 1.07 | |
| Os08g0242800(OsSIG6) | response to blue light | Similar to Sigma factor SIG6 | 1.15 | |
| Os09g0439500(Lhca6) | photosynthesis, light reaction | Similar to Type II chlorophyll a/b binding protein from photosystem I precursor | 1.48 | |
| Os10g0572300(OsIRL5) | response to light stimulus | Leucine-rich repeat, typical subtype containing protein | 1.16 | |
| Os01g0764800 | response to light stimulus | Indole-3-acetic acid (IAA)-amido synthetase | −2.40 | |
| Os05g0421900 | response to light stimulus | GA 20-oxidase4 | −1.50 | |
| Os01g0279100(OsCRD1) | light-independent chlorophyll biosynthetic process | Subunit of magnesium-protoporphyrin IX monomethyl ester cyclase | 1.23 | |
| Y9 vs. F9 | Os01g0600900(CAB2R) | photosynthesis, light harvesting in photosystem I | Chlorophyll a-b binding protein 2 | 1.40 |
| Os01g0720500(Lhcb1.1) | photosynthesis, light harvesting in photosystem I | Similar to Type I chlorophyll a/b-binding protein b (Fragment) | 3.71 | |
| Os02g0197600 | photosynthesis, light harvesting in photosystem I | Chlorophyll a/b-binding protein type III (Fragment) | 1.03 | |
| Os02g0764500 | photosynthesis, light harvesting in photosystem I | Similar to Lhca5 protein | 1.07 | |
| Os03g0592500(LHCB) | photosynthesis, light harvesting in photosystem I | Similar to Photosystem II type II chlorophyll a/b binding protein (Fragment) | 1.31 | |
| Os04g0457000(CP24) | photosynthesis, light harvesting in photosystem I | Similar to Chlorophyll a/b-binding protein CP24 | 1.8 | |
| Os06g0320500 | photosynthesis, light harvesting in photosystem I | Similar to Light-harvesting complex I (Fragment) | 1.37 | |
| Os07g0558400(CP29) | photosynthesis, light harvesting in photosystem I | Similar to Chlorophyll a/b-binding protein CP29 precursor | 1.54 | |
| Os07g0562700 | photosynthesis, light harvesting | Similar to Type III chlorophyll a/b-binding protein (Fragment) | 1.23 | |
| Os07g0577600 | photosynthesis, light reaction | Similar to Type II chlorophyll a/b binding protein from photosystem I precursor | 1.39 | |
| Os08g0435900(cab) | photosynthesis, light reaction | Similar to LHC I type IV chlorophyll binding protein | 1.38 | |
| Os11g0242800(ASCAB9-A) | photosynthesis, light reaction | Similar to ASCAB9-A | 1.50 | |
| Os06g0705100 | photosynthesis, light harvesting | Similar to Thylakoid lumenal 13.3 kDa protein | 1.47 | |
| Os01g0501800(PsbO) | regulation of photosynthesis, light reaction | Similar to Photosystem II oxygen-evolving complex protein 1 (Fragment) | 1.31 | |
| Os01g0773700(PSBW) | regulation of photosynthesis, light reaction | Similar to Photosystem II reaction center W protein | 1.22 | |
| Os03g0333400 | photosynthesis, light reaction | Similar to photosystem II 11 kD protein | 1.62 | |
| Os07g0489800 | photosynthesis, light reaction | Beta-grasp fold | 1.15 | |
| Os07g0544800 | photosynthesis, light reaction | Similar to oxygen-evolving enhancer protein 3-2 | 1.45 | |
| Os01g0869800(PSBS1) | response to light intensity | 22-kDa Photosystem II protein, Photoprotection | 1.02 | |
| Os02g0729400(OsStr11) | response to red or far red light | Similar to extracellular calcium sensing receptor | 1.10 | |
| Os01g0764800(GH3-2) | response to light stimulus | Indole-3-acetic acid (IAA)-amido synthetase | −1.33 | |
| Os11g0195500(PAD4) | response to light stimulus | Hypothetical conserved gene | −1.18 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, W.; Li, Y.; Hou, X.; Wei, C.; Teng, Z.; Yang, C.; Su, H.; Wang, X.; Zhu, Z. Molecular Mechanism of Oryza sativa L. Under Long Day Regime Based on Transcriptome Analysis. Diversity 2025, 17, 603. https://doi.org/10.3390/d17090603
Luo W, Li Y, Hou X, Wei C, Teng Z, Yang C, Su H, Wang X, Zhu Z. Molecular Mechanism of Oryza sativa L. Under Long Day Regime Based on Transcriptome Analysis. Diversity. 2025; 17(9):603. https://doi.org/10.3390/d17090603
Chicago/Turabian StyleLuo, Wenju, Yufeng Li, Xianbin Hou, Chun Wei, Zheng Teng, Cuifeng Yang, Hongzhu Su, Xiaoli Wang, and Zhengjie Zhu. 2025. "Molecular Mechanism of Oryza sativa L. Under Long Day Regime Based on Transcriptome Analysis" Diversity 17, no. 9: 603. https://doi.org/10.3390/d17090603
APA StyleLuo, W., Li, Y., Hou, X., Wei, C., Teng, Z., Yang, C., Su, H., Wang, X., & Zhu, Z. (2025). Molecular Mechanism of Oryza sativa L. Under Long Day Regime Based on Transcriptome Analysis. Diversity, 17(9), 603. https://doi.org/10.3390/d17090603

