Next Article in Journal
Relationship Between Sea Surface Temperature, Weather Events, and Location and the Morphology of Ceratodictyon (Lomentariaceae, Rhodophyta) on Primarily Mexican Pacific-Based Herbarium Data
Previous Article in Journal
Marine Highways and Barriers: A Case Study of Limacina helicina Phylogeography Across the Siberian Arctic Shelf Seas
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 17
Issue 8
10.3390/d17080524
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Redefining Latrogastropoda Again and Searching for Its Sister Group in Hypsogastropoda (Gastropoda: Caenogastropoda)

by
Donald J. Colgan
* and
Winston F. Ponder
Malacology, Australian Museum Research Institute, The Australian Museum, 1 William St., Sydney, NSW 2010, Australia
*
Author to whom correspondence should be addressed.
Diversity 2025, 17(8), 524; https://doi.org/10.3390/d17080524
Submission received: 3 May 2025 / Revised: 23 July 2025 / Accepted: 24 July 2025 / Published: 28 July 2025
(This article belongs to the Section Marine Diversity)
Browse Figures
Versions Notes

Abstract

Caenogastropoda is a highly speciose and ecologically diverse subclass of Gastropoda but its higher order classification remains unclear, especially within its largest constituent group, Hypsogastropoda. Two nominal taxa encompassing most of the great diversity of Hypsogastropoda are in current widespread use: one is Latrogastropoda, which has been repeatedly redefined resulting in changes to the second, Littorinimorpha, which is generally not supposed to be monophyletic. We examined the utility of these divisions by assembling single-gene data sets of nuclear 28S ribosomal RNA (28S rRNA) and mitochondrial 16S ribosomal RNA (16S rRNA) and cytochrome c oxidase subunit I from many genera. Capuloidea was consistently found with strong support within Latrogastropoda, so this taxon is redefined here to include that superfamily. The analyses also suggested the redefinition of some superfamilies within Littorinimorpha, particularly for the clade comprising Truncatelloidea, Vanikoroidea and Rissooidea, and the Littorinoidea. Littorinimorpha was monophyletic (albeit lacking strong support) in the combined analysis of 28S rRNA and 16S rRNA and was resolved as the sister group of Latrogastropoda which was also monophyletic, with bootstrap support of 66%. Littorinimorpha was not monophyletic in other analyses. In these, the sister group of Latrogastropoda comprised clades of multiple littorinimorph superfamilies but these relationships were also not strongly supported.

1. Introduction

Caenogastropoda Cox, 1960, is a highly speciose and ecologically successful subclass of Gastropoda, but its higher order classification remains unclear, especially within Hypsogastropoda Ponder & Lindberg, 1997, its largest constituent group. This grouping was proposed to include all the caenogastropods other than the basal architaenioglossans, Campaniloidea Douvillé, 1904, and Cerithioidea Fleming, 1822. Three nominal taxa that have been proposed to encompass most of the diversity observed in Hypsogastropoda, and that are in current widespread use, are Littorinimorpha Golikov & Starobogatov, 1975, Latrogastropoda Riedel, 2000, and Neogastropoda Wenz, 1938. The membership of Latrogastropoda has changed several times since the name was originally proposed to comprise not only the Neogastropoda but also the Naticoidea Guilding, 1834, Cypraeoidea Rafinesque, 1815, Lamellarioidea d’Orbigny, 1842, Laubierinoidea Warén (1990), Calyptraeoidea Lamarck, 1809 (including Capulidae, Haloceratidae, Calyptraeidae, and Hipponicidae), Cassoidea and Ficoidea Meek, 1864 (1840) (Table 1). In the amended definition of [1], Stromboidea Rafinesque, 1815, and Xenophoroidea Troschel, 1852 (1840), are added, and Naticoidea, Capulidae, Haloceratidae, and Hipponicidae are omitted from the original concept [2]. Lamellarioidea (now Velutinoidea Gray, 1849) and Laubierinoidea (now in Tonnoidea Suter, 1913 (1825)), remain in Latrogastropoda. The name Siphonogastropoda Simone, 2011, was intended to comprise a group [3] with a similar composition to the Latrogastropoda sensu [1], but excluding Stromboidea and Calyptraeoidea. Although Littorinimorpha is widely recognized as non-monophyletic, the name is frequently used to cover most or all of the Hypsogastropoda that do not belong to Latrogastropoda or Neogastropoda (e.g., [4,5,6]). Differences between the various definitions of Latrogastropoda and related taxa are shown in Table 2.
Forming a robust understanding of hypsogastropod phylogeny has proved difficult. Although its members have been the subject of many molecular studies (e.g., [5,6,10,11,12,13,14,15,16,17]), none have included a wide range of taxa and only a few have been based on a broad sampling of the group. Of these, some [18,19,20,21] used DNA sequencing to investigate the group’s overall phylogeny, refs. [22] and [3] used morphology, and [2] and [9] used both approaches. The studies based on DNA sequencing have mostly collected information from a range of taxa for a small number of genes [9,18] or from mitogenomes plus some nuclear genes [19,21]. Recently, some phylogenomic studies have been published, but whilst these provide more detailed information about subsets of Hypsogastropoda, particularly Littorinioidea [15] and Neogastropoda [14], overall investigations using such data are lacking. Ref. [23] analyzed 12 Littorinimorpha and 13 Latrogastropoda, commenting that additional taxon sampling would be needed for this approach to resolve the relationships of clades within the group, particularly in the Littorinidae and associated taxa.
The hypsogastropods studied by [18] and [9] were resolved with modest bootstrap support into two clades that were designated as the “siphonate group” and the “asiphonate group” in the latter paper [9] (Table 1). The siphonate group, characterized by the possession of an anterior siphon, was composed of superfamilies that would later be included in the redefined Latrogastropoda. The asiphonate group, with the exception of Cerithiopsoidea, lacks an anterior siphon. No other morphological autapomorphies that reliably distinguish Latrogastropoda and Littorinimorpha have been identified. However, the asiphonate group of [9] invariably had the bases G and C at the sites in the D9-10 expansion region towards the 3′ end of the 28S ribosomal RNA (28S rRNA) [24]. These bases correspond to positions 3023 and 3032 of the sequence of the stylommatophoran Gibbulinella dewinteri Bank, Groh & Ripken, 2002 [25]––the “GC motif”. The “siphonate group” invariably had the bases C and G at these positions (the “CG motif”).
The mitogenomic study of Caenogastropoda in [19] found strong support for the monophyly of the siphonate (latrogastropod) taxa they studied but not for the asiphonate taxa. Indeed, the placement of Vermetoidea as the sister group of all other Caenogastropoda contradicted the monophyly of Hypsogastropoda. A maximum likelihood analysis of combined mtDNA and nuclear DNA [19] suggested that the asiphonates other than Vermetoidea were monophyletic but with bootstrap support of less than 70%. A similar result was found in the study using complete mitochondrial genomes by [20], with Vermetoidea again being the sister of all other Caenogastropoda, including Architaenioglossa, and the remaining asiphonates were the sister group of Latrogastropoda. Vanikoroidea plus Vermetoidea constituted the sister group of all other Caenogastropoda in [21], which included both mitochondrial and nuclear sequences. Within the latter group, Epitonioidea was the sister group of the clade containing Architaenioglossa, Cerithioidea, and the remaining Hypsogastropoda included in [21].
Some hypsogastropod superfamilies were not represented in [18] or [9], including Abyssochrysoidea, Capuloidea, Velutinoidea, Ficoidea, and the neogastropods Olivoidea and Turbinelloidea. This problem has been partly resolved by the DNA sequencing studies of the relationships of these superfamilies that have subsequently become available. There is strong support for including Ficoidea in Latrogastropoda [21,26]. Ref. [27] studied a broad sample of “littorinimorph” families and three Latrogastropoda (as then understood). They found strong support for a clade consisting of Capulidae and the two buccinoideans they studied. Capuloidea (comprising Capulidae and Haloceratidae) has subsequently been resolved within Latrogastropoda [12], but few littorinimorphs were included in that study.
Studies of overall hypsogastropod phylogeny with broad taxonomic coverage have had limited numbers of species from most superfamilies, raising doubts as to whether the topologies are representative of the diversity of the included taxa. In this context, studies of certain groups within Hypsogastroda are potentially very useful if they include much larger numbers of taxa.
The need for the redefinition of some superfamilies has been highlighted by molecular phylogenetic analyses. Xenophoridae (considered in recent decades to comprise a distinct superfamily) has been shown to be included within Stromboidea [4,13,28,29], and Velutinoidea was confirmed as a distinct, strongly supported superfamily rather than being a family within Cypraeoidea [12,30]. The Rissooidea have been resolved as diphyletic in molecular phylogenies and may actually represent multiple superfamilies, although this needs to be considered using broader data sets [31,32].
The present study addresses whether the names Littorinimorpha and Latrogastropoda define major monophyletic clades within Hypsogastropoda. In particular, we address the following: (1) What is the most phylogenetically realistic concept of the Latrogastropoda? (2) Is Latrogastropoda paraphyletic to the remainder of Hypsogastropoda? (3) What are the most inclusive groups in the Hypsogastropoda other than Latrogastropoda? (4) Which one of these is the sister group of Latrogastropoda? Our investigation was based on DNA sequences from the three genes with by far the largest amount of available data. These were regions of the 28S rRNA, 16S ribosomal RNA (16S rRNA), and cytochrome c oxidase subunit I (COI) genes. Analyses were conducted for individual genes and also for concatenated data sets. The range of hypsogastropod diversity was sampled using large numbers of taxa by selecting one or more (in a few cases) representatives of each sequence per genus. A consequence of the use of these available data is that the monophyly of some superfamilies can be tested.

2. Materials and Methods

2.1. Experimental Methods

Most sequences for this study were downloaded from GenBank, but new sequences were also collected, mostly to obtain data from the D9-D10 region of 28S rRNA for a wider range of taxa, to add more genes from species already sequenced by us for some segments, and to increase the number of Littorinidae for the investigation of its monophyly. Specimens collected for this study were stored in 95% ethanol or frozen at −80 °C. DNA was extracted by the DNeasy Blood and Tissue Kit (QIAGEN, Venlo, The Netherlands) using the manufacturer’s protocol and eluted in a final volume of 200 μL of AE buffer. A few cubic millimeters of mantle or foot tissue were used for larger specimens and the whole animal for specimens less than 5 mm in the longest dimension.
PCR amplification was conducted following the procedures of [18] with an annealing temperature appropriate to the primer pairs (see Table 3) and with varying amounts of DNA (usually 1 μL of a 1 in 8 dilution of the original DNA extraction). For 28S rRNA, data were collected from the D1 expansion region using the D1F/D1R primer pair with an annealing temperature of 50 °C, from the D4–D6 region using the 28SAF/28SD6FC (annealing temperature of 50 °C) or the 28SD6F/28SARC (annealing temperature of 50 °C) pairs, and the D9–D10 region using the 28SBF/28SBR pair (annealing temperature of 50 °C). Sequences from 16S rRNA were amplified by the 16sar/16sbr primer pair with an annealing temperature of 50 °C, and sequences from COI by the 1490/2198 primer pair (annealing temperature of 43 °C).
PCR products were visualized by UV-induced fluorescence after electrophoresis in 2.5% agarose gels and sequenced in both directions at Macrogen (Seoul, Republic of Korea) using the original primers. The GenBank accession numbers of the newly collected sequences are PQ409420–PQ409423 for the D1 expansion region, MH197708–MH197718, MH197720, and PQ409431–PQ409434 for the D4–D6 expansion regions of 28S rRNA data sequenced using the 28SAF/28SD6FC primer pair and MH197721–MH197759 and PQ357497–PQ357499 for the D9–D10 expansion region. The sequences of some 28S rRNA accessions were updated by the addition of newly collected data. These were AH005968, AH005970, AH005972, AH005978, AH005987, AH005988, AH005990, AH005999, AH006000, AH006010, DQ916510, DQ916512, DQ916513, DQ916515, and DQ916517. The accessions for new 16S rRNA sequences are PQ350272–PQ350275 and PQ350277–PQ350294 and for COI, PQ409412.

2.2. Data Set Assembly

Four data sets were assembled for individual gene segments by downloading available sequences from GenBank and adding newly collected sequences. Two of these data sets were from the nuclear 28S rRNA. One comprised sequences from the D1–D6 expansion regions and the other sequences from the D9–D10 expansion region. In some cases, two accessions from the same species were downloaded for the D1–D6 region to obtain more complete coverage. The other two data sets were segments of the mitochondrial 16S rRNA and COI genes. The D9–D10 rRNA data were collected to examine the occurrence of the GC/CG sequence motifs so that no limitation was placed on the number of representatives of a genus. There was limited sequence variability in this region and less taxonomic coverage so it was not used for phylogenetic analysis. The three other data sets were used for phylogenetic analysis and were generally limited to one representative per genus. Exceptions were made for some newly collected sequences, mostly in the Littorinidae. The generic names used in GenBank were cross-checked in Molluscabase [38] and, where necessary, corrected to ensure that they conformed to the current understanding of taxonomy. The representative was chosen to be that with the longest sequence, or that with the earliest accession date among congeneric accessions of the same length. Preliminary analyses were run to identify sequences that were not resolved with confamilial sequences. These were treated as potentially anomalous and were generally removed from the data sets if they were suggested to be more closely related to other families by individual Blastn searches of GenBank databases. Exceptions were made for some truncatelloideans for which some familial locations are not well understood—see below. Data sets were aligned using Clustal W [39] for the mitochondrial sequences and MAFFT [40] for the 28S rRNA. The alignment was performed for the original data sets and ran again for each segment for the subsets of taxa that were included in the concatenated alignments. Data set inspection was performed in BioEdit [41]. Concatenated data sets were formed from GenBank downloads using generic names so that composite sequences sometimes combine different individuals or species for different gene segments. Multiple gene segments that were newly sequenced for this study were collected from single individuals.

2.3. Phylogenetic Analyses

A variety of analytical approaches were used to allow an assessment of the robustness of proposed relationships by comparing between results. Differences between the results of the various analyses are discussed below. In evaluating these differences, more weight is given to results that are consistently observed and to those that are less contradictory to the current understanding of the membership of Latrogastropoda.
Maximum likelihood (“ML”) phylogenetic analyses were conducted on the CIPRES data portal [42] using RAxML [43,44] with the Blackbox interface and IQ-TREE [45,46]. Bayesian inference (“BI”) was also conducted on the CIPRES data portal, using MrBayes [47]. The three sets of codon positions were treated as separate partitions in all analyses including COI, and the 16S and 28S rRNA data sets were treated as separate partitions in combined analyses. Sequences from Cerithioidea, which belong with Hypsogastropoda in Sorbeoconcha Ponder & Lindberg, 1997, were used as the outgroup for all reported analyses. Preliminary investigations using the Architaenioglossa Haller, 1892, as a more distant outgroup did not resolve Cerithiodea and Hypsogastropoda as monophyletic. Trees were examined using Figtree v. 1.4.3 [48].
RAxML analyses were run with a GTR model, modeling rate variability by the inverse gamma distribution, using Broyden–Fletcher–Goldfarb–Shanno optimization of the rate parameters, the use of empirical frequencies, and assuming that no sites were invariable. Analyses were conducted for the individual D1–D6 28S rRNA, 16S rRNA, COI (complete), and COI (codon positions 1 and 2 only) data sets, for the combinations of the 16S and 28S rRNA data sets, and of all three data sets. The numbers of required rapid bootstrap replicates were calculated by the majority rules extended (‘MRE’) bootstopping criterion [49].
IQ-TREE (ver. 2.4) [45,46] analyses were conducted using the included implementation of ModelFinder with the ‘TEST’ option [50] for model selection with ultrafast bootstrap [51] and separate partitions [46] for coding sequences and concatenated alignments. Runs used the “safe likelihood kernel” to avoid numerical underflow and a random starting tree. Analyses were run for the individual COI, 28S rRNA, and 16S rRNA data, the combined 28S rRNA and 16S rRNA, and the combination of all three genes. Attention below is focused on the combined 28S rRNA and 16S rRNA results but those of the other analyses are available on request.
MrBayes (version 3.2.7a) [47] analyses were conducted with unlinked parameters between partitions (where applicable), allowing variable rates of evolution with a GTR substitution model. An inverse gamma distribution with four categories was used to model rate differences between alignment positions. Analyses were conducted for two runs of 10 million ‘generations’ with four Monte Carlo Markov chains (default heating) and sampling trees every 1000 generations. Run convergence was assessed by confirming that the average standard deviation of split frequencies was asymptotically less than 0.01 and that the potential scale reduction factor was asymptotically near one for the analysis parameters. Output parameter values and the convergence of tree likelihoods were examined with Tracer [52] to determine the numbers to be discarded as burn-in. Analyses were run for the individual 28S rRNA and 16S rRNA data, the combined 28S rRNA and 16S rRNA, and the combination of all three genes. We focused on reporting the combined 28S rRNA and 16S rRNA results, but those of the other analyses are available on request.

3. Results

3.1. Alignment Details

Details of the lengths of the alignments for phylogenetic analyses, the number of taxa, and the number of parsimony informative sites in each data set (calculated by [53]), the likelihoods of the optimal topologies, and the number of bootstrap replicates determined by the MRE criterion are shown in Table 4.
Sequences in the alignments of individual gene segments (Supplementary Materials) and the topologies resulting from phylogenetic analysis are identified by the GenBank accession number, genus, and superfamily (and family, in some Supplementary Figures). Sequences in combined data sets are specified by genus and superfamily but not accession numbers.
In this section, the name Latrogastropoda is used sensu [1,8], with an indication of changes to that classification suggested by an analysis. The term ‘littorinimorph’ refers to Hypsogastropoda other than Capuloidea and Latrogastropoda.

3.2. 28S rRNA Analysis

Three clades formed a basal trichotomy within Hypsogastroda (itself with bootstrap support of 77%) in the RAxML analysis of 28S rRNA (Figure 1). These were (1) the clade, including members of Latrogastropoda that also included Capuloidea and a littorinid, Mainwaringia; (2) most Cingulopsoidea (Littorinimorpha); and (3) Littorinimorpha except these Cingulopsoidea and Mainwaringia. Only the second of these clades had bootstrap support. The monophyly of some superfamilies of Latrogastropoda was contradicted by the 28S rRNA topology, including Cancellarioidea, Capuloidea, Velutinoidea, and the neogastropod superfamilies Conoidea and Buccinoidea. However, bootstrap support for contradictions was less than 70%. The single representative of Xenophoridae was resolved in a derived position within Stromboidea.
Most littorinimorphs were found in one of two large clades. One of these was separated into firstly Naticoidea and Rastodens (Cingulopsoidea: Rastodentidae), and secondly Littorinoidea, and embedded amongst members of the latter superfamily in divergent derived positions, Hipponicoidea and Pterotracheoidea. The other large clade included Abyssochrysoidea, Epitonioidea, Lyocyclus (incertae sedis), Triphoroidea, Vermetoidea, and in a derived clade with bootstrap support of 80%, Truncatelloidea, Vanikoroidea, and Rissooidea—the suborder Rissoidina [8], which is equivalent to the rissoiform clade of [1]. Rissooidea was separated into two groups, one of which was the sister group of Vanikoroidea. The other rissooidean clade comprised members of Barleeidae, Rissoinidae, and Zebinidae. Within Truncatelloidea, the branch leading to the root of the Hydrobiidae was very long in comparison to other branches in the topology (Supplementary Figure S1).

3.3. 16S rRNA Analysis

In this analysis (Figure 2), Hydrococcus (Truncatelloidea) + Coriophora (Triphoroidea) were resolved as constituting the sister group of other Hypsogastropoda. The next divergence separated an unexpected grouping of Scrupus (Truncatelloidea: ?Tornidae) plus Suterilla (Truncatelloidea: Assimineidae) from the remaining Hypsogastropoda. The basal ingroup clades with more than three members are identified by letters in Figure 2. Clade A contained some Abyssochrysoidea, some Littorinidae, and one pterotracheoidean and Naticoidea in divergent derived positions. Clade B was Stromboidea including Xenophoridae. Clade C included most Truncatelloidea. Clade D comprised two Abyssochrysoidea, some Littorinidae, and two Pterotracheoidea. Clade E was characterized by a very large amount of sequence divergence and contained a diverse group of species, mostly from Vanikoroidea (three species of Vanikoridae) and the truncatelloidean families Tornidae (except Scrupus), Calopiidae, Clenchiellidae, Caecidae, Iravadiidae, Teinostomatidae, and Vitrinellidae. Clade F included the remaining littorinimorphs, and some Marginellidae (7 members) (Volutoidea) resolved as the sister group of a clade of two families of Littorinoidea (Annulariidae + Pomatiidae) plus two Cingulopsoidea. The broad clade representing Latrogastropoda (Clade G) included Capuloidea and all other members of the group except Stromboidea (including Xenophoridae), which occupied a relatively basal position overall.
Neither Rissooidea nor Truncatelloidea was monophyletic, although most species in these groups were found in a single clade for each superfamily. Each also had some smaller clades or outlying species dispersed through the “littorinimorph” sections of the topology. For example, Botryphallus (Truncatelloidea: family?) and two of the three Zebinidae (Rissooidea) were resolved within clade E.
Two species probably wrongly attributed to the truncatelloidean family Elachisinidae (reviewed in [54]) were included in the analysis. These were, respectively, found in strongly supported positions, one as the sister group of Hipponicoidea and the second embedded within Vermetoidea, rendering this superfamily non-monophyletic.
With the exception of Calyptraeoidea, Cypraeoidea, Stromboidea (including Xenophoroidae), and Velutinoidea, the superfamilies of Latrogastropoda were not monophyletic in the 16S rRNA analysis. None of the contradictions were, however, supported by bootstrap percentages of 70% or more. The superfamilies Cancellarioidea and Olivoidea were particularly widely distributed in the topology. For example, members of Cancellarioidea: Cancellariidae) were found in four distinct clades: (1) Mirandaphera (Admetinae) was resolved within Volutoidea, and (2) Admete (Admetinae) was resolved within one of the two clades of Tonnoidea; (3) the clade comprising Tritonoharpa, Fusimoro, and Plesiotriton (Plesiotritinae) also included the Haloceratidae, supposedly belonging with Capuloidea; and (4) the clade comprising other cancellariids and Harpa (Neogastropoda i.s.). Muricoidea was monophyletic except for the exclusion of two singleton outliers (Favartia and Homalocantha), while Dolicholatiridae, supposedly a family within Buccinoidea, was resolved within Muricoidea with BS support of 47% as the sister group of some Muricidae.
Except for Marginellidae, the sequences of Latrogastropoda diverged from the ancestral condition (as determined by Cerithioidea) much less than many of the Littorinimorpha, particularly the members of clade E.

3.4. COI Analysis

The level of variability in COI sequences appeared to be too high for their use as a stand-alone data set for the investigation of hypsogastropod phylogeny. This was investigated using the index of substitution saturation (ISS) in DAMBE 7.3.32 [55]. The results for 32-taxon samples, repeated 600 times for the three sets of codon positions, were as follows. For codon positions 1 and 2, the ISSs of 0.160 and 0.066 were significantly lower (at p < 0.001) than the test statistics for both symmetric and asymmetric trees (0.686 and 0.367, respectively). For codon position 3, the ISS was 0.768, which was significantly higher than both test statistics, suggesting that there was saturation in this data set. Consequently, in addition to an analysis using all three codon positions, another was conducted using only positions 1 and 2.
Superfamily-level clades were not monophyletic in the analysis based on the division of codon positions into three data partitions. This is illustrated in Supplementary Figure S3 by highlighting the members of Truncatelloidea, which were widely distributed in the topology. Because of this, we do not give great emphasis to this analysis. However, a group analogous to the long-branch clade of Truncatelloidea observed in 16S rRNA analyses was also seen here, while the position of Zebinidae could not be tested as it was not represented in this data set. In contrast to the 16S rRNA analysis, Marginellidae was monophyletic here and included in Latrogastopoda.
The lack of resolution of recognized superfamilies as monophyletic clades was even more marked in the analysis using only COI codon positions 1 and 2. In this case, it was not even possible to resolve the outgroup (Cerithiodea) as monophyletic.

3.5. 28 S rRNA + 16S rRNA Analysis

The clade, including members of Latrogastropoda, which also included Capuloidea, received bootstrap support of 66% in the combined analysis of 28S rRNA and 16S rRNA (Figure 3, Supplementary Figure S4). Latrogastropoda + Capuloidea was the sister group (without bootstrap support) of Littorinimorpha, which was resolved as monophyletic.
Where this could be tested here (not for Mitroidea and Turbinelloidea with only one representative), most latrogastropod superfamilies were monophyletic. The exceptions were Buccinoidea, Cancellarioidea, and Conoidea. The contradictions of monophyly for Buccinoidea and Conoidea did not receive bootstrap support of more than 70%, but Plesiotriton (Cancellarioidea) was excluded from a clade containing the other representative of the superfamily, which had a BS of 81%. Stromboidea included Xenophoridae in a derived position (BS 100%), this combined clade being resolved as the sister group of Cypraeoidea plus all other Latrogastropoda.
Within Littorinimorpha, Rissooidea was resolved into two main clades, the larger of which was the sister group of Vanikoroidea, in contrast to the separate analyses of the 28S rRNA data set in which the smaller clade was the sister group of this superfamily. In contrast to the 16S rRNA analysis, Truncatelloidea was monophyletic. The monophyly of Hipponicoidea was contradicted by the inclusion of the triphoroidean, Ataxocerithium, possibly owing to the very short sequence of 28S rRNA for this species. Abyssochrysoidea was also not monophyletic owing to the inclusion of the other triphorid in the analysis. Littorinoidea was not monophyletic because Tudora, the only representative of Annulariidae (Littorinoidea), was anomalously resolved as the sister group of another clade comprising Hipponicoidea, Ataxocerithium (Triphoroidea), and Epitonioidea. As in other analyses, the single representatives of Pterotracheidae and Naticoidea were embedded amongst the littorinids in divergent derived positions, with that clade having bootstrap support of 92%.
The optimum model found by IQ-TREE assumed edge-unlinked partitions with separate substitution models and separate rates across sites and used the GTR matrix for substitution and empirical base frequencies. The log-likelihood of the tree was −114,912.64. In this analysis (Supplementary Figure S5), Hypsogastropoda was monophyletic (100% BS). Stromboidea was the sister group of Cypraeoidea plus all other Latrogastropoda, the latter receiving 73% BS, but anomalously including Rissoa (Rissoidea). Capuloidea was robustly supported as a derived member of Latrogastropoda. In contrast to the RAxML analysis, Buccinoidea was monophyletic, but Velutinoidea was not. Cancellarioidea and Conoidea were also not monophyletic in this analysis.
The sister group of Latrogastropoda was a clade within Littorinimorpha (Cingulopsoidea, Epitonioidea, Hipponicoidea, Tudora, and Ataxocerithium). Successively larger groups were formed by the nodes adding (1) Abyssochryoidea; (2) a clade with BS of 99% including Littorinidae, Naticidae, and Pterotracheidae; and (3) Rissoidina (100% BS) in which Vanikoroidea was again resolved as the sister group of the larger clade of Rissooidea.
In the Bayesian analysis, although both runs had a log-likelihood of 1.20 × 10−5, one had an ESS for the likelihood of less than 200, so topology estimation used only the trees from the other (ESS = 2238). In this analysis (Supplementary Figure S6), Cypraeoidea was the sister group of all other Hypsogastropoda, with the latter clade having a posterior probability (PP) of 0.75. The clade containing Capuloidea and all Latrogastropoda except Cypraeoidea and Stromboidea was strongly supported with a PP of 1.00. The sister group of Latrogastropda (excepting Cypraeoidea) was a clade similar to that in the IQ-TREE analysis, with successive nodes also formed by joining with clades similar to those in this analysis. These clades generally had high PP (e.g., 0.99 for Littorinidae, Naticidae plus Pterotracheidae, and 1.00 for Rissoidina). However, all of the nodes formed by the joining of these clades lacked significant PP support.

3.6. 28S rRNA + 16S rRNA + COI Analysis

Many of the relationships found in other analyses were also recovered in the combined analysis of the 28S rRNA + 16S rRNA +COI data sets. For example, Capuloidea was resolved in a clade including all Latrogastropoda, except Cypraeoidae and Stromboidea, with 72% BS (Supplementary Figures S7 and S8). The clade Latrogastropoda + Capuloidea was monophyletic (with low bootstrap support of 34%).
Rissoidina, comprising Truncatelloidea, Rissooidea, and Vanikoroidea, was monophyletic, with reduced overall support compared to other analyses but with robust BS for the first and third of these superfamilies. Rissooidea was not divided into two groups (31% BS for its monophyly), although this was based on reduced diversity, with only one member of Rissoinidae representing one of the clades in the superfamily found in other analyses.
Littorinidae was again found not to be monophyletic as it included both Pterotracheoidea and Naticoidea, albeit represented by one species each (BS 96%). The other representative of Littorinoidea included in the analysis was Tudora (Annulariidae). This was resolved as the sister group of four other littorinimorph superfamilies but with low bootstrap support. In contrast to other analyses, the sister group of Latrogastropoda plus Capuloidea included Littorinindae plus Naticidae and Pterotracheidae. The other clade in the sister group was Abyssochrysoidea (73% BS).
Within Latrogastropoda + Capuloidea, the superfamilies Buccinoidea, Calyptraeoidae, Capuloidea, Cypraeiodea, Muricoidea, Stromboidea, and Tonnoidea were monophyletic. Cancellarioidea, which was represented by Plesiotriton and Cancellaria, was not monophyletic; the placement of the latter species within Conoidea resulted in this also not being the case for Conoidea.

3.7. GC/CG Motifs’ Occurrence

The numbers of species with GC or CG motifs in the D9–D10 region of 28S rRNA are indicated in Table 5. The provenance of new sequences is given in Supplementary Table S2. The alignment of the hypsogastropod sequences for this region is available as a Supplementary File. This was not phylogenetically analyzed owing to the relatively small number of genera for which sequences were available and low variability. In the trimmed alignment using one sequence per species, 24 of 279 sites were variable but only 9 were parsimony informative, and almost all of these (except for the sites at the CG/GC motifs) were at the level of the superfamily or below.
All the 28S rRNA sequences from taxa not belonging to Hypsogastropoda excluding Latrogastropoda had the CG motif, as did a species identified in GenBank as Graphis sp AD-2009, a supposed species of Aclididae (a family included in Eulimidae by [1]). We assume that this specimen was misidentified and possibly belongs to Cimidae, a family of similar appearance in the Heterobranchia. There is no 28S rRNA sequence available from the D9–D10 region of any members of Capuloidea.
The new data we have collected have added several additional families to the available data set and expanded the range of species in other families, particularly Littorinidae. The new sequence of Coriophora fusca (Dunker, 1860) (AMS, C.469222.001) represents Triphoridae, the second family of Triphoroidea for which data are available for this motif.

4. Discussion

Using large numbers of sequences from as wide a range of genera as possible from the highly diverse clade Hypsogastropoda has resolved some questions regarding the affinities of some groups and identified others whose relationships remain uncertain. The analyses suggest the redefinition of Latrogastropoda and some superfamilies, whilst recognizing the validity of others.
The principal change to the definition of Latrogastropoda is that it now includes Capuloidea. This superfamily was consistently observed in all analyses in derived positions in the clade, including superfamilies previously recognized as Latrogastropoda. Capuloidea was resolved as a sub-clade within the group including all other Latrogastropoda except Stromboidea and Cypraeoidea in all analyses. Such sub-clades received bootstrap support of more than 70% or posterior probability of more than 0.95 in all analyses (RAxML, IQTREE, and MrBayes) of combined data sets. Capuloidea has been resolved in latrogastropod clades in studies of the sub-groups of Hypsogastropoda [12,27] although it has not previously been included in broader molecular analyses.
The expanded Latrogastropoda was monophyletic in most analyses, although infrequently, single littorinimorph taxa were included and Cypraeidae or Stromboidea were excluded. Notably, Cypraeoidea was resolved as the sister group of all other Hypsogastropoda in some analyses: 28S rRDNA/IQ-TREE (with Cancellaria (Cancellarioidea), 28S rRNA + 16S rRNA/MrBayes, combined COI and 28S rRNA + 16S rRNA/IQ-TREE). However, this was not consistently observed, and to accept this placement of Cypraeoidea would require large-scale changes to the definition of Latrogastropoda.
Bootstrap support for the monophyly of Latrogastropoda was not robust, but the value of 66% in the analysis of combined 16S rRNA and 28S rRNA data is notable (Figure 3).
The sister group of Latrogastropoda varied between analyses. Only in the combined 28S rRNA + 16S rRNA analysis (Figure 3) did this sister group comprise the entire Littorinimorpha. However, the support for other, smaller clades as the sister group of Latrogastropoda was low. It remains possible that the Littorinimorpha, if defined as Hypsogastropoda except for Latrogastropoda, is monophyletic and forms the sister group of the latter taxon. The distribution of the CG/GC motifs in the 28S rRNA D9–D10 region shown in the expanded data sets reported here supports this possibility, although data from more taxa are required for groups such as Capuloidea.
The definition of Latrogastropoda sensu [1] is also changed by the recognition from recent molecular studies that the Xenophoridae belongs to Stromboidea, rather than being a distinct superfamily [4,13] and that the Velutinoidea is a distinct superfamily [30] separated from Cypraeoidea, to which it was previously supposed to belong [56]. These changes were supported in the present analysis. Xenophoridae was always closely associated with Stromboidea, usually as a derived clade within it and as its sister group in the combined analysis (which lacked the families of Stromboidea causing paraphyly in other analyses). Members of Velutinoidea were more closely associated with superfamilies other than Cypraeoidea in all analyses.
The redefinition of Latrogastropoda requires consideration of the generalization that its members have anterior siphons and that this structure is mirrored in the shell. The membership of Latrogastropoda includes patelliform taxa such as Capuloidea, Calyptraeoidea, and the flattened Xenophoridae, all of which lack anterior siphons. However, these taxa are derived within Latrogastropoda, and most are related to taxa possessing an anterior siphon such as Strombidae regarding Xenophoridae, and Trichotropis with Capulidae, so we assume that the siphon has been secondarily lost in all these taxa. Members of Velutinoidea show no sign of a siphonal impression in the internal shell, but the animal possesses an inhalant siphon. There are no recognized siphonate relatives of Calyptraeoidea.
The phylogenetic structure within Latrogastropoda was not the subject of this investigation, but the present results suggest areas for future research. Either Stromboidea or Cypraeoidea was the most basal latrogastropod superfamily in all analyses. Notably, most neogastropods other than Cancellarioidea were generally closely associated. For example, Neogastropoda, except Plesiotriton (Cancellarioidea), received 81% BS (Figure 3). Some Marginellidae were excluded from Neogastropoda in the 16S rRNA analyses (Figure 2), but this was not observed in the COI analysis nor in the most comprehensive study of the family [57]. Recent genomic and transcriptomic studies have generally found that the Cancellariidae forms a distinct lineage to Volutoidea [14,17,58] and it should be treated as a distinct superfamily as previously recognised [8,59]. The polyphyly of Cancellarioidea seen in the 16S rRNA and 28S rRNA analyses is in concordance with the considerable divergence between components of the only recognized family, Cancellariidae, found by [60]. In their analysis, the subfamily Plesiotritoninae was the sister to the other studied taxa. The next bifurcation separated some Admetinae (Mirandaphera, etc.) from a clade comprising other members of this subfamily and the subfamilies Cancellariinae and Trigonostomatinae. The monophyly of Cancellariidae was strongly supported in the phylogenomic study of [14]. The study was focused on Neogastropoda (from which Cancellariidae was excluded) and did not include outgroup taxa such as Capuloidea, Calyptraeoidea, and Velutinoidea to which members of Cancellariidae were associated here.
The phylogenetic structure in Littorinimorpha is of particular interest in the context of determining the basal clades of Hypsogastropoda. Most probably, either Littorinimorpha as a whole, if it is monophyletic, or one of its constituent clades, is the sister group of Latrogastropoda.
In this context, the question arises as to whether Hypsogastropoda is itself monophyletic. Vermetoidea was not included in Hypsogastropoda in some previous analyses, notably [19,20,21] but was present in the 28S rRNA and 16S rRNA single-gene analyses, in combined analyses here, and in those of [27], all of which suggests that its placement outside the group is probably artefactual.
Three groups of superfamilies were found within Littorinimorpha in some or most analyses. (1) Littorinidae and associated taxa; (2) the suborder Rissoidina; and (3) Epitonioidea plus Hipponicoidea, sometimes with other superfamilies. The position of Abyssochrysoidea and Cingulopsoidea varied between analyses.
Littorinidae is a well-studied and long-recognized group [61], but neither this family nor the Littorinoidea has always been monophyletic in previous studies. For example, the smallest clade, including the two Littorinoidea in the phylogenomic study of [23], also comprises Naticoidea, Pterotracheoidea, and Abyssochrysoidea. A recent transcriptome study [15] found Pterotracheoidea to be included within a clade comprising five Littorinidae (with Peasiella shown as the sister of the other taxa in the clade) and Naticoidea being the sister of Lacuna, prompting the suggestion that Lacuna be removed from Littorinidae. In the mtDNA genome study of [20], Littorinidae was monophyletic but embedded in Naticoidea to make that superfamily paraphyletic. Based on the present analyses, Littorinoidea could be split into at least three taxa (superfamilies?). One comprises Annulariidae and Pomatiidae and is topologically distant to the Littorinidae. There are two main littorinoidean clades, one generally including Naticoidea and the second including most Pterotracheoidea. In the 28S rRNA analysis, Mainwaringia is anomalously placed within Latrogastopoda. It is very distant to other members of Littorinidae and its phylogenetic position requires further investigation [61,62,63,64]. One of the two major clades of Littorinoidea in the 28S rRNA analysis (Figure 1) contains the terrestrial annulariid genus Tudora, as well as the marine Pterotracheoidea and intertidal genera such as Afrolittorina, Austrolittorina, Cenchritis, Echinolittorina, Littorina, and Tectarius. These genera (except Tudora) were also commonly found in the analogous clades of other analyses that contain Pterotracheoidea (although Pterotrachea itself was excluded from this clade in 16S rRNA). The second main clade with littorinids in the 28S rRNA analysis contains Peasiella, Lacuna, Bembicium, Melarhaphe, and three other genera. In the 16S rRNA analysis (within clade A in Figure 2), Lacuna and Melarhaphe are the sister group of Naticoidea and a clade with other littorinids and Pterotrachea (Pterotracheoidea). Naticoidea is the sister group of Melarhaphe in the combined analysis, and together with Lacuna and Bembicium, they form one of the two main divisions within the clade including Littorinidae. Some littorinoid species [e.g., Laevilacunaria antarctica (Littorinidae) and Pseudonatica spp. (?Zerotulidae)] show similarities with naticoideans in their shell, opercular, and some anatomical characters [65], although phylogenetic analysis suggests that these similarities are due to convergence. Nevertheless, the transcriptome data provide strong evidence of the close relationships of Littorinoidea and Naticoidea [15], and this should be explored in further studies, especially considering their considerable anatomical divergence.
Rissoidina [8] is strongly supported in the 28S rRNA RAxML and all combined analyses but is contradicted in the 16S rRNA RAxML analysis, although without support. Further doubt is raised here whether Rissooidea should be considered as a single superfamily. Analogous clades including Barleeidae, Rissoinidae, and sometimes Zebinidae were separated from most Rissooidea in analyses including these sequences. These three families belong to a distinct clade in the rissooidean phylogenies of [31,32], who suggested the possibility that this old group should be considered as multiple superfamilies but recommended a broader scale analysis to determine this. The position of the Vanikoroidea, currently considered to comprise the highly divergent families Vanikoridae and Eulimidae [27], is relevant. The sister group of this superfamily could be considered for recognition at the same taxonomic level. In most analyses, only one of the two clades of Rissooidea formed the sister group of Vanikoroidea, indicating that they should be considered separate superfamilies, this being concordant with a suite of morphological differences. The name Rissoinoidea W. Stimpson, 1865, is available for the clade containing Rissoinidae.
Two instances of clades with very long branch lengths were observed in Truncatelloidea. In the 16S rRNA RAxML topology, this is represented by clade E, which causes non-monophyly of the superfamily. Most families in clade E are predominantly found in marine or brackish habitats, although Clenchiellidae has at least one known freshwater taxon [66]. In the 28S rRNA analysis, Hydrobiidae had a very long branch (Supplementary Figure S1), although it remained within Truncatelloidea. Neither of these clades was divergent in the analyses of both nuclear (28S rRNA) and mitochondrial genes (16S rRNA).
The present study does not fully answer questions about the basal clades within extant Hypsogastropoda, particularly concerning whether all non-Latrogastropoda belong to a single clade, the Littorinimorpha, and, if that is not the case, which taxa form the sister group of Latrogastropoda. Future work addressing these questions will require even broader taxon sampling to cover the full diversity of Littorinimorpha, incorporating, for example, typical Elachisinidae, Tornidae, and Lycocyclus. Phylogenomic studies will also be useful, but taxon sampling for that approach needs to be greatly increased. We emphasize that, following the example of [14,15], phylogenomic studies should move beyond exemplary approaches to better represent the range of diversity within each of the taxa comprising a wider group.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/d17080524/s1, Figure S1: Maximum likelihood analysis of the partial 28S ribosomal RNA data set: complete topology; Figure S2: Maximum likelihood analysis of the partial 16S ribosomal RNA data set: complete topology; Figure S3: Maximum likelihood analysis of the COI data set: complete topology. Truncatelloidea highlighted.; Figure S4: Maximum likelihood analysis of the combined 28S rRNA plus 16S rRNA data set: complete topology; Figure S5: IQ-TREE Maximum likelihood analysis of the combined 28S rRNA plus 16S rRNA data set: complete topology; Figure S6: MrBayes analysis of the combined 28S rRNA plus 16S rRNA data set: complete topology; Figure S7: Maximum likelihood analysis of the combined data set (28S rRNA, 16S rRNA and COI) data set: collapsed topology; Figure S8: Maximum likelihood analysis of the combined data set (28S rRNA, 16S rRNA and COI) data set: complete topology; Table S1: Sequences used in the phylogenetic analyses; Table S2: New sequences of the 28S rRNA D9–D10 expansion regions collected here. All bootstrap support values are shown in each supplementary figure. Alignments of the data set used for each analysis are also available as supplementary material. The genus names recognized in MolluscaBase are used in these alignments, but additional generic names (where different in GenBank) are given after the superfamily name for 16S and COI sequences. Two accession numbers are given where sequences were combined so that the entire D1–D6 region could be covered for 28S rRNA.

Author Contributions

Conceptualization, D.J.C. and W.F.P.; methodology, D.J.C.; validation, D.J.C. and W.F.P.; formal analysis, D.J.C. and W.F.P.; data curation, D.J.C.; writing—original draft preparation, D.J.C.; writing—review and editing, D.J.C. and W.F.P.; visualization, D.J.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Collections were undertaken with permissions granted by F86/2163(A) (New SouthWales Fisheries Research Permit) and experiments conducted according to the purposes allowed by this permit. Animal Care and Ethics Committerr approval is not needed for research on gastropods in Australia.

Data Availability Statement

All data used in this article are available in GenBank. Accession numbers for newly collected sequences are shown in the “Materials and Methods“. All accessions are listed in Supplementary Table S2 “Sequences used in the phylogenetic analysis”.

Acknowledgments

We thank Amanda Reid and Alison Miller of the Australian Museum Research Institute for assistance with specimen registration and curation. Most of the D9–D10 28S rRNA sequences were collected by an intern student Craig Heatherington. We thank three anonymous reviewers whose comments on the original version have greatly improved this manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bouchet, P.; Rocroi, J.-P.; Hausdorf, B.; Kaim, A.; Kano, Y.; Nützel, A.; Parkhaev, P.; Schrödl, M.; Strong, E.E. Revised classification, nomenclator and typification of gastropod and monoplacophoran families. Malacologia 2017, 61, 1–526. [Google Scholar] [CrossRef]
  2. Riedel, F. Ursprung Und Evolution Der “Höheren” Caenogastropoda. In Berliner Geowissenschaftliche Abhandlungen, Series E; Selbstverlag Fachbereich Geowissenschaften: Berlin, Germany, 2000; Volume 32, pp. 1–240, 21 pls. [Google Scholar]
  3. Simone, L.R.L. Phylogeny of the Caenogastropoda (Mollusca), based on comparative morphology. Arq. Zool. 2011, 42, 161–323. [Google Scholar] [CrossRef]
  4. Irwin, A.R.; Strong, E.E.; Kano, Y.; Harper, E.M.; Williams, S.T. Eight new mitogenomes clarify the phylogenetic relationships of Stromboidea within the caenogastropod phylogenetic framework. Mol. Phylogenet. Evol. 2021, 158, 107081. [Google Scholar] [CrossRef] [PubMed]
  5. Chen, K.; Yang, M.; Duan, H.; Liao, X. The mitochondrial genome of Littoraria melanostoma reveals a phylogenetic relationship within Littorinimorpha. Diversity 2023, 15, 1005. [Google Scholar] [CrossRef]
  6. Ma, Y.; Zheng, B.; Li, J.; Meng, W.; Xu, K.; Ye, Y. Characterization of the complete mitochondrial genome of Desmaulus extinctorium (Littorinimorpha, Calyptraeoidea, Calyptraeidae) and molecular phylogeny of Littorinimorpha. PLoS ONE 2024, 19, e0301389. [Google Scholar] [CrossRef]
  7. Bouchet, P.; Rocroi, J.-P. Classification and nomenclator of gastropod families. Malacologia 2005, 47, 1–397. [Google Scholar]
  8. Ponder, W.F.; Lindberg, D.R.; Ponder, J.M. Biology and Evolution of the Mollusca; CRC Press: Boca Raton, LA, USA, 2020; Volume 2. [Google Scholar]
  9. Ponder, W.F.; Colgan, D.J.; Healy, J.M.; Nützel, A.; Simone, L.R.L.; Strong, E.E. 2008. Caenogastropoda. In Phylogeny and Evolution of the Mollusca; Ponder, W.F., Lindberg, D.L., Eds.; University of California Press: Berkeley, CA, USA, 2008; pp. 331–383. [Google Scholar]
  10. Kantor, Y.I.; Fedosov, A.E.; Puillandre, N.; Bonillo, C.; Bouchet, P. Returning to the roots: Morphology, molecular phylogeny and classification of the Olivoidea (Gastropoda: Neogastropoda). Zool. J. Linn. Soc. 2017, 180, 493–541. [Google Scholar] [CrossRef]
  11. Kantor, Y.I.; Fedosov, A.E.; Kosyan, A.R.; Puillandre, N.; Sorokin, P.A.; Kano, Y.; Clark, R.; Bouchet, P. Molecular phylogeny and revised classification of the Buccinoidea (Neogastropoda). Zool. J. Linn. Soc. 2022, 194, 789–857. [Google Scholar] [CrossRef]
  12. Takano, T.; Warén, A.; Kano, Y. Phylogenetic position of the deep-sea snail family Haloceratidae and new insights into caenogastropod relationships. J. Molluscan Stud. 2022, 88, eyac012. [Google Scholar] [CrossRef]
  13. Irwin, A.R.; Bouchet, P.; Crame, J.A.; Harper, E.M.; Kronenberg, G.C.; Strong, E.E.; Williams, S.T. Molecular phylogenetics of the superfamily Stromboidea (Caenogastropoda): New insights from increased taxon sampling. Zool. Scr. 2024, 53, 818–838. [Google Scholar] [CrossRef]
  14. Fedosov, A.E.; Zaharias, P.; Lemarcis, T.; Modica, M.V.; Holford, M.; Oliverio, M.; Kantor, Y.I.; Puillandre, N. Phylogenomics of Neogastropoda: The backbone hidden in the bush. Syst. Biol. 2024, 73, 521–531. [Google Scholar] [CrossRef]
  15. Qi, L.; Zhang, N.; Xu, B.; Xu, Q.; Han, X.; Kong, L.; Li, Q. Increased microgastropoda sampling give new insights into the phylogenetic relationships of Littorinoidea (Littorinimorpha). Mol. Phylogenet. Evol. 2024, 199, 108139. [Google Scholar] [CrossRef]
  16. Qu, J.; Yang, W.; Teng, X.; Xu, L.; Zhang, D.; Xing, Z.; Wang, S.; Liu, X.; Wang, L.; Wang, X. Gene characterization and phylogenetic analysis of four mitochondrial genomes in Caenogastropoda. Acta Oceanol. Sin. 2024, 43, 137–150. [Google Scholar] [CrossRef]
  17. Wang, H.; He, X.; Chen, C.; Gao, K.; Dai, Y.; Sun, J. New insights into the phylogeny of Neogastropoda aided by draft genome sequencing of a volutid snail. Zool. Scr. 2024, 53, 805–817. [Google Scholar] [CrossRef]
  18. Colgan, D.J.; Ponder, W.F.; Beacham, E.; Macaranas, J. Molecular phylogenetics of Caenogastropoda (Gastropoda: Mollusca). Mol. Phylogenet. Evol. 2007, 42, 717–737. [Google Scholar] [CrossRef] [PubMed]
  19. Osca, D.; Templado, J.; Zardoya, R. Caenogastropod mitogenomics. Mol. Phylogenet. Evol. 2015, 93, 118–128. [Google Scholar] [CrossRef]
  20. Santos, C.A.; Bezerra, F.O.; Andrade, S.C. Littoraria flava (Gastropoda: Littorinidae) mitogenome: Phylogenetic considerations within the Caenogastropoda and evidence of microscale local adaptation. Mar. Biol. 2015, 169, 121. [Google Scholar]
  21. Li, F.; Li, W.; Zhang, Y.; Wang, A.; Liu, C.; Gu, Z.; Yang, Y. The molecular phylogeny of Caenogastropoda (Mollusca, Gastropoda) based on mitochondrial genomes and nuclear genes. Gene 2024, 928, 148790. [Google Scholar] [CrossRef] [PubMed]
  22. Strong, E.E. Refining molluscan characters: Morphology, character coding and a phylogeny of the Caenogastropoda. Zool. J. Linn. Soc. 2003, 137, 447–554. [Google Scholar] [CrossRef]
  23. Goulding, T.C.; Strong, E.E.; Quattrini, A.M. Target-capture probes for phylogenomics of the Caenogastropoda. Mol. Ecol. Resour. 2023, 23, 1372–1388. [Google Scholar] [CrossRef]
  24. Mindell, D.P.; Honeycutt, R.L. Ribosomal RNA in vertebrates: Evolution and phylogenetic applications. Ann. Rev. Ecol. Syst. 1990, 21, 541–566. [Google Scholar] [CrossRef]
  25. Fontanilla, I.K.; Naggs, F.; Wade, C.M. Molecular phylogeny of the Achatinoidea (Mollusca: Gastropoda). Mol. Phylogenet. Evol. 2017, 114, 382–385. [Google Scholar] [CrossRef] [PubMed]
  26. Zou, S.; Li, Q.; Kong, L. Additional gene data and increased sampling give new insights into the phylogenetic relationships of Neogastropoda, within the caenogastropod phylogenetic framework. Mol. Phylogenet. Evol. 2011, 61, 425–435. [Google Scholar] [CrossRef] [PubMed]
  27. Takano, T.; Kano, Y. Molecular phylogenetic investigations of the relationships of the echinoderm-parasite family Eulimidae within Hypsogastropoda (Mollusca). Mol. Phylogenet. Evol. 2014, 79, 258–269. [Google Scholar] [CrossRef]
  28. Machkour-M’Rabet, S.; Hanes, M.M.; Martínez-Noguez, J.J.; Cruz-Medina, J.; García-De León, F.J. The queen conch mitogenome: Intra- and interspecific mitogenomic variability in Strombidae and phylogenetic considerations within the Hypsogastropoda. Sci. Rep. 2021, 11, 11972. [Google Scholar] [CrossRef] [PubMed]
  29. Simone, L.R.L. Comparative morphological study of representatives of the three families of the Stromboidea and the Xenophoroidea (Mollusca, Caenogastropoda), with an assessment of their phylogeny. Arq. Zool. 2005, 37, 141–267. [Google Scholar] [CrossRef]
  30. Fassio, G.; Stefani, M.; Russini, V.; Buge, B.; Bouchet, P.; Treneman, N.; Malaquias, M.A.E.; Schiaparelli, S.; Modica, M.V.; Oliverio, M. Neither slugs nor snails: A molecular reappraisal of the gastropod family Velutinidae. Zool. J. Linn. Soc. 2023, 197, 924–964. [Google Scholar] [CrossRef]
  31. Criscione, F.; Ponder, W.F. A phylogenetic analysis of rissooidean and cingulopsoidean families (Gastropoda: Caenogastropoda). Mol. Phylogenet. Evol. 2013, 66, 1075–1082. [Google Scholar] [CrossRef]
  32. Criscione, F.; Ponder, W.F.; Köhler, F.; Takano, T.; Kano, Y. A molecular phylogeny of Rissoidae (Caenogastropoda: Rissooidea) allows testing the diagnostic utility of morphological traits. Zool. J. Linn. Soc. 2016, 179, 23–40. [Google Scholar] [CrossRef]
  33. Mcarthur, A.G.; Koop, B.F. Partial 28S rDNA sequences and the antiquity of the hydrothermal vent endemic gastropods. Mol. Phylogenet. Evol. 1999, 13, 255–274. [Google Scholar] [CrossRef]
  34. Colgan, D.J.; Ponder, W.F.; Beacham, E.; Macaranas, J.M. Molecular phylogenetic studies of Gastropoda based on six gene segments representing coding or non-coding and mitochondrial or nuclear DNA. Molluscan Res. 2003, 23, 123–148. [Google Scholar] [CrossRef]
  35. Colgan, D.J.; Ponder, W.F.; Eggler, P.E. Gastropod evolutionary rates and phylogenetic relationships assessed using partial 28S rDNA and histone H3 sequences. Zool. Scr. 2000, 29, 29–63. [Google Scholar] [CrossRef]
  36. Palumbi, S.R.; Martin, A.; Romano, S.; McMillan, W.O.; Stice, L.; Grabowski, G. The Simple Fool’s Guide to PCR; Department of Zoology and Kewalo Marine Laboratory, University of Hawai’i: Honolulu, HI, USA, 1991. [Google Scholar]
  37. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  38. MolluscaBase Editors. MolluscaBase. Available online: https://www.molluscabase.org (accessed on 25 June 2025).
  39. Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL X Windows interface: Flexible strategiesfor multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef]
  40. Katoh, K.; Asimenos, G.; Toh, H. Multiple alignment of DNA sequences with MAFFT. In Bioinformatics for DNA Sequence Analysis; Posada, D., Ed.; Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2009; pp. 39–64. [Google Scholar]
  41. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program forWindows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  42. Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Proceedings of the Gateway Computing Environments Workshop (GCE), New Orleans, LA, USA, 14 November 2010; pp. 1–8. [Google Scholar]
  43. Stamatakis, A. RAxML Version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 312–313. [Google Scholar] [CrossRef] [PubMed]
  44. Stamatakis, A.; Hoover, P.; Rougemont, J. A rapid bootstrap algorithm for the RAxML web-servers. Syst. Biol. 2008, 75, 758–771. [Google Scholar] [CrossRef] [PubMed]
  45. Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; von Haeseler, A.; Lanfear, R. IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef]
  46. Chernomor, O.; von Haeseler, A.; Minh, B.Q. Terrace aware data structure for phylogenomic inference from supermatrices. Syst. Biol. 2016, 65, 997–1008. [Google Scholar] [CrossRef]
  47. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2016, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
  48. Rambaut, A. Figtree Version 1.4.3. Available online: http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 18 November 2016).
  49. Pattengale, N.D.; Alipour, M.; Bininda-Emonds, O.R.P.; Moret, B.M.E.; Stamatakis, A. How many bootstrap replicates arenecessary? J. Comput. Biol. 2010, 17, 337–354. [Google Scholar] [CrossRef]
  50. Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef]
  51. Hoang, D.T.; Chernomor, O.; von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the ultrafast bootstrap approximation. Mol. Biol. Evol. 2016, 35, 518–522. [Google Scholar] [CrossRef]
  52. Rambaut, A.; Drummond, A.J. Tracer 1.3. Available online: http://beast.bio.ed.ac.uk/Tracer (accessed on 31 August 2023).
  53. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  54. Ponder, W.F. The anatomy and relationships of Elachisina Dall (Gastropoda: Rissoacea). J. Molluscan Stud. 1985, 51, 23–34. [Google Scholar] [CrossRef]
  55. Xia, X.; Lemey, P. Assessing substitution saturation with DAMBE. In The Phylogenetic Handbook: A Practical Approach to DNA and Protein Phylogeny, 2nd ed.; Lemey, P., Salemi, M., Vandamme, A.-M., Eds.; Cambridge University Press: Cambridge, UK, 2003. [Google Scholar]
  56. Wenz, W. Gastropoda. In Handbuch der Palaozoologie; Schindewolf, O.H., Ed.; Bornträger: Berlin, Germany, 1938; Volume 6, pp. 831–999. [Google Scholar]
  57. Fedosov, A.E.; Caballer Gutierrez, M.; Buge, B.; Sorokin, P.V.; Puillandre, N.; Bouchet, P. Mapping the missing branch on the neogastropod tree of life: Molecular phylogeny of marginelliform gastropods. J. Molluscan Stud. 2019, 85, 439–451. [Google Scholar] [CrossRef]
  58. Harasewych, M.G.; Sei, M.; Oleinik, A.; Uribe, J.E. The complete mitochondrial genome of Voluta musica Linnaeus, 1758 (Neogastropoda: Volutidae: Volutinae). Nautilus 2024, 138, 1–7. [Google Scholar]
  59. Ponder, W.F. The origin and evolution of the Neogastropoda. Malacologia 1974, 12, 295–338. [Google Scholar]
  60. Modica, M.V.; Bouchet, P.; Cruaud, C.; Utge, J.; Oliverio, M. Molecular phylogeny of the nutmeg shells (Neogastropoda, Cancellariidae). Mol. Phylogenet. Evol. 2011, 59, 685–697. [Google Scholar] [CrossRef] [PubMed]
  61. Reid, D.G.; Dyal, P.; Williams, S.T. A global molecular phylogeny of 147 periwinkle species (Gastropoda, Littorininae). Zool. Scr. 2012, 41, 125–136. [Google Scholar] [CrossRef]
  62. Reid, D.G. Mainwaringia Nevill, 1885, a littorinid genus from Asiatic mangrove forests, and a case of protandrous hermaphroditism. J. Molluscan Stud. 1986, 52, 225–242. [Google Scholar] [CrossRef]
  63. Reid, D.G. Systematic revision of the Recent species of Peasiella Nevill, 1885 (Gastropoda: Littorinidae), with notes on the fossil species. Nautilus 1989, 103, 43–69. [Google Scholar]
  64. Reid, D.G.; Mak, Y.M. Additions and corrections to the taxonomy of the genus Peasiella Nevill, 1885 (Gastropoda: Littorinidae). Naut. 1998, 112, 6–33. [Google Scholar]
  65. Simone, L.R.L. Convergence with naticids: Phenotypic phylogenetic study on some Antarctic littorinoideans, with description of the zerotulid new genus Pseudonatica, and its presence in Brazil (Mollusca, Caenogastropoda). J. Mar. Biol. Assoc. UK 2018, 98, 1365–1381. [Google Scholar] [CrossRef]
  66. Ponder, W.F.; Fukuda, H.; Hallan, A. A review of the family Clenchiellidae (Mollusca: Caenogastropoda: Truncatelloidea). Zootaxa 2014, 3872, 101–153. [Google Scholar] [CrossRef] [PubMed]
Diversity 17 00524 g001
Figure 1. Maximum likelihood topology of the partial 28S ribosomal RNA data set. The tree is rooted in the outgroup (Cerithioidea). Some clades with multiple members are shown collapsed as triangles with the number of sequences represented by a triangle shown following the name. Bootstrap support values over 65% are shown along branches. Clades belonging to Latrogastropoda (including Capuloidea, as defined here) are shown in an olive-colored box.
Figure 1. Maximum likelihood topology of the partial 28S ribosomal RNA data set. The tree is rooted in the outgroup (Cerithioidea). Some clades with multiple members are shown collapsed as triangles with the number of sequences represented by a triangle shown following the name. Bootstrap support values over 65% are shown along branches. Clades belonging to Latrogastropoda (including Capuloidea, as defined here) are shown in an olive-colored box.
Diversity 17 00524 g001
Diversity 17 00524 g002
Figure 2. Maximum likelihood topology of the partial 16S ribosomal RNA data set. The tree is rooted in the outgroup (Cerithioidea). Some clades with multiple members are shown collapsed as triangles. The number of sequences represented by a triangle is shown following a taxon’s name. Bootstrap support values over 70% are shown along branches. Clades belonging to Latrogastropoda as defined here are shown in olive-colored boxes. Some basal clades are identified by capital letters. Clade H denotes a group of five sequences from Ancilla (Olivoidea), Vasum and Tudivasum (Turbinelloidea), Favartia (Muricoidea), and Pseudoliva (Olivoidea). The red line in the Volutoidea triangle is at the right end of the longest branch in this superfamily for species not belonging to Marginellidae.
Figure 2. Maximum likelihood topology of the partial 16S ribosomal RNA data set. The tree is rooted in the outgroup (Cerithioidea). Some clades with multiple members are shown collapsed as triangles. The number of sequences represented by a triangle is shown following a taxon’s name. Bootstrap support values over 70% are shown along branches. Clades belonging to Latrogastropoda as defined here are shown in olive-colored boxes. Some basal clades are identified by capital letters. Clade H denotes a group of five sequences from Ancilla (Olivoidea), Vasum and Tudivasum (Turbinelloidea), Favartia (Muricoidea), and Pseudoliva (Olivoidea). The red line in the Volutoidea triangle is at the right end of the longest branch in this superfamily for species not belonging to Marginellidae.
Diversity 17 00524 g002
Diversity 17 00524 g003
Figure 3. Maximum likelihood topology of the 28S rRNA plus 16S rRNA data set. The tree is rooted in the outgroup (Cerithioidea). Monophyletic superfamilies represented by multiple members are shown collapsed as triangles. The number of sequences represented by a triangle is shown following a taxon’s name. Bootstrap support values over 65% are shown along branches. Clades belonging to Latrogastropoda as defined here are shown in an olive-colored box. The clade of Rissoidea marked by two asterisks contains Barleeidae, Rissoinidae, and Zebinidae.
Figure 3. Maximum likelihood topology of the 28S rRNA plus 16S rRNA data set. The tree is rooted in the outgroup (Cerithioidea). Monophyletic superfamilies represented by multiple members are shown collapsed as triangles. The number of sequences represented by a triangle is shown following a taxon’s name. Bootstrap support values over 65% are shown along branches. Clades belonging to Latrogastropoda as defined here are shown in an olive-colored box. The clade of Rissoidea marked by two asterisks contains Barleeidae, Rissoinidae, and Zebinidae.
Diversity 17 00524 g003
Table 1. The taxa included in some higher groupings of Hypsogastropoda. Taxa are listed alphabetically within higher groupings.
Table 1. The taxa included in some higher groupings of Hypsogastropoda. Taxa are listed alphabetically within higher groupings.
TaxonCompositionReference
LatrogastropodaCalyptraeoidea a, Cassoidea (= Tonnoidea), Cypraeoidea, Ficoidea, Lamellarioidea b, Laubierinoidea c, Naticoidea, Neogastropoda[2]
LatrogastropodaCalyptraeoidea, Cypraeoidea (including Velutinidae), Ficoidea, Neogastropoda, Stromboidea, Tonnoidea, Xenophoroidea [1]
LatrogastopodaCalyptraeoidea, Capuloidea, Cypraeoidea, Ficoidea, Stromboidea (includes Xenophoridae), Tonnoidea, Velutinoidea and Neogastropoda (Buccinoidea Rafinesque, 1815, Cancellarioidea, Forbes & Hanley, 1851, Conoidea Fleming, 1822, Mitroidea Swainson, 1831, Muricoidea Rafinesque, 1815, Olivoidea Latreille, 1825, Turbinelloidea Swainson, 1835, and Volutoidea Rafinesque, 1815)Redefined here
SiphonogastropodaCypraeoidea (including Velutinidae), Neogastropoda, Tonnoidea (including Ficidae) [3]
LittorinimorphaHypsogastropoda except Neogastropoda[7]
Rissoidina (= “Rissoiform clade” of [1])Rissooidea Gray, 1840, Truncatelloidea Gray, 1840 and Vanikoroidea Gray, 1840[8]
“Asiphonate group”Cingulopsoidea Fretter & Patil, 1958, Epitoniodea Berry, 1910 (1812), Vanikoroidea, Hipponicoidea Troschel, 1861, Littorinoidea Children, 1834, Naticoidea, Pterotracheoidea Rafinesque, 1814, Rissooidea, Triphoroidea Gray, 1847, Truncatelloidea and Vermetoidea Rafinesque, 1815[9]
“Siphonate group”Calyptraeoidea, Cypraeoidea, Stromboidea, Tonnoidea, Xenophoridae and the neogastropod superfamilies Buccinoidea, Cancellarioidea, Conoidea, Mitroidea, Muricoidea and Volutoidea[9]
a supposed by [2] to include Capulidae, Haloceratidae, and Hipponicidae. b contains Triviidae and Velutinidae, now included in Velutinoidea. c contains Laubierinidae only, now regarded as a member of Tonnoidea.
Table 2. The composition of various definitions of Latrogastropoda and related taxa. Taxa are listed alphabetically. Green shading is used to highlight taxa included in a definition.
Table 2. The composition of various definitions of Latrogastropoda and related taxa. Taxa are listed alphabetically. Green shading is used to highlight taxa included in a definition.
TaxonLatrogastropoda sensu [2]Latrogastropoda sensu [1]Siphonogastropoda [3]“Siphonate” Clade [9]Latrogastropoda as Here Redefined
CalyptraeidaeYesYesNoYesYes
CapulidaeYesNoNo?Yes
CypraeoideaYesYesYesYesYes
FicoideaYesYesYes?Yes
HipponicoideaYesNoNoYesYes
NeogastropodaYesYesYesYesYes
NaticoideaYesNoNoNoNo
StromboideaNoYesNoYesYes
TonnoideaYesYesYesYesYes
VelutinoideaYesYesYes?Yes
Table 3. Sequences of the primers used in this study. Abbrevaitions are used for 28S ribosomal RNA (28S rRNA), 16S ribosomal RNA (16S rRNA) and cytochrome c oxidase subunit I (COI).
Table 3. Sequences of the primers used in this study. Abbrevaitions are used for 28S ribosomal RNA (28S rRNA), 16S ribosomal RNA (16S rRNA) and cytochrome c oxidase subunit I (COI).
GenePrimer NamePrimer SequenceReference
28S rRNA28S D1FACCCSCTGAAYTTAAGCAT[33]
28S D1RAACTCTCTCMTTCARAGTTC [33]
28SAFGACCCGAAAGATGGTGAACTAT [34]
28SARCTTTTGGTAAGCAGAACTGGCGCTReverse complement of 28SAR
28S D6CAACTAGCCCTTAAAATGGATGG[35]
28S D6FCCCATCCATTTTAAGGGCTAGTTGReverse complement of 28SD6
28S D6RAMAGAAAAGARAACTCTYCC[35]
28SBFGGGAGTTTGACTGGGGCGGTACA[35]
28SBRTGGGTGAACAATCCAACGCTTGG[35]
16S rRNA16SarCGCCTGTTTATCAAAAACAT[36]
16SbrCCGGTCTGAACTCAGATCACGT[36]
COI1490GGTCAACAAATCATAAAGATATTGG[37]
2198TAAACTTCAGGGTGACCAAAAAATCA[37]
Table 4. Metrics of the data sets and tree topologies.
Table 4. Metrics of the data sets and tree topologies.
Data Set
Metric		28S rRNA16S rRNACOI28S rRNA + 16S rRNA28S rRNA + 16S rRNA + COI
No. of sequences390936996304236
Aligned length260371465830683793
Parsimony informative86651940012121456
Log likelihood −52,389.25−136,063.82−198,409.51−98,740.44−131,235.3164
Bootstrap replicates (RAxML)450450400350350
Table 5. Number of species with specified motifs in the D9–D10 expansion region of 28S rRNA. The table is divided into taxa having the “CG” motif and those with the “GC” motif.
Table 5. Number of species with specified motifs in the D9–D10 expansion region of 28S rRNA. The table is divided into taxa having the “CG” motif and those with the “GC” motif.
Motif or TaxonNumber of Species
CG
Vetigastropoda9
Heterobranchia260
Neritimorpha2
Peltospiridae2
Architaenioglossa6
Campaniloidea1
Cerithioidea6
Hypsogastropoda
Cypraeoidea1
Tonnoidea2
Stromboidea (1 Xenophoridae)8
Calyptraeoidea2
Neogastropoda50
GC
Abyssochrysoidea2
Cingulopsoidea1
Epitonioidea2
Littorinidae8
Hipponicoidea1
Naticidae3
Pterotracheidae 1
Rissooidea1
Triphoroidea3
Truncatelloidea6
Vanikoroidea (2 Eulimidae) a2
Vermetoidea1
Unknown
Latrogastropoda
CapuloideaNot available
FicoideaNot available
a plus another supposed eulimid (?Graphis) that has the sequence CG but which is likely misidentified (see text).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Colgan, D.J.; Ponder, W.F. Redefining Latrogastropoda Again and Searching for Its Sister Group in Hypsogastropoda (Gastropoda: Caenogastropoda). Diversity 2025, 17, 524. https://doi.org/10.3390/d17080524

AMA Style

Colgan DJ, Ponder WF. Redefining Latrogastropoda Again and Searching for Its Sister Group in Hypsogastropoda (Gastropoda: Caenogastropoda). Diversity. 2025; 17(8):524. https://doi.org/10.3390/d17080524

Chicago/Turabian Style

Colgan, Donald J., and Winston F. Ponder. 2025. "Redefining Latrogastropoda Again and Searching for Its Sister Group in Hypsogastropoda (Gastropoda: Caenogastropoda)" Diversity 17, no. 8: 524. https://doi.org/10.3390/d17080524

APA Style

Colgan, D. J., & Ponder, W. F. (2025). Redefining Latrogastropoda Again and Searching for Its Sister Group in Hypsogastropoda (Gastropoda: Caenogastropoda). Diversity, 17(8), 524. https://doi.org/10.3390/d17080524

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop