Next Article in Journal
First Report of Middle Eocene Micromorphic Brachiopods from Northeastern Libya: Taxonomy and Paleobiogeography Implications
Next Article in Special Issue
Catfishes from the North-Western Part of Lake Tanganyika: Contribution to a Reference Library of DNA Barcodes
Previous Article in Journal
Bibliometric Analysis of the Status and Trends of Seamounts’ Research and Their Conservation
Previous Article in Special Issue
A Molecular-Informed Species Inventory of the Order Ceramiales (Rhodophyta) in the Narragansett Bay Area (Rhode Island and Massachusetts), USA
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

First Attempts at DNA Barcoding Lepidoptera in North Cyprus Reveal Unexpected Complexities in Taxonomic and Faunistic Issues

1
Naturwissenschaftliche Sammlungen, Sammlungs- und Forschungszentrum, Tiroler Landesmuseen Betriebsges.m.b.H., 6060 Hall in Tirol, Austria
2
Faculty of Agriculture, Near East University, 99138 Nicosia, Cyprus
*
Author to whom correspondence should be addressed.
Diversity 2024, 16(11), 671; https://doi.org/10.3390/d16110671
Submission received: 2 October 2024 / Revised: 30 October 2024 / Accepted: 30 October 2024 / Published: 31 October 2024
(This article belongs to the Special Issue DNA Barcodes for Evolution and Biodiversity—2nd Edition)

Abstract

:
The fauna of Lepidoptera in the Mediterranean is still inadequately documented. As a result, even remotely complete DNA barcode libraries (mt. COI (cytochrome c oxidase 1) gene) are lacking in most areas. This proposed gap is being analyzed for the first time for the fauna of North Cyprus. In the initial phase, 248 morphospecies from 29 families (exclusive Heterocera) were sampled, sequenced and compared with existing DNA reference sequences in the global BOLD database (Barcode of Life Data Systems) via BINs (Barcode Index Numbers). A total of 194 species could be unequivocally assigned to a Linnaean taxon. Additionally, six species previously unidentified in BOLD, as well as fourteen species without reference barcodes, were identified at the species level. Twenty-four of these species were new records for Cyprus. In addition, 25 taxa with new BINs could not be assigned to a valid species due to potential cryptic diversity or the lack of relevant revisions. Furthermore, a few species could not be identified due to barcode sharing and/or potential misidentifications in BOLD. Overall, approximately 20% of the samples could not be identified using the existing DNA barcode libraries, a significant deficit for European standards, which should be addressed as a priority issue in future studies.

1. Introduction

Lepidoptera are a flagship group in the development of barcode libraries for molecular identification in megadiverse animal groups [1,2,3,4]. Thanks to several national efforts, international initiatives, and the focus of individual experts on specific taxonomic groups, an increasingly complete reference database has been created, particularly for Europe, within just over a decade, and these sources are often publicly available, i.e., via BOLD (Barcode of Life Database) [5,6,7,8,9,10,11]. This allows for the advanced identification of species through genetic sequences in many countries, especially in Central and Northern Europe. However, the state of progress is significantly less favorable in more southern parts of the continent [12].
The insufficient processing of Mediterranean fauna is reflected in the inadequate taxonomic and faunistic study of several Southern European regions. The eastern Mediterranean, in particular, is insufficiently studied in terms of lepidopterology, a fact mirrored by ongoing descriptions of new species from this region [13]. Due to a lack of financial resources and, in part, a shortage of expertise, not a single Southeast European country has anything close to a complete barcode library. Targeted group-specific continental DNA barcode libraries [14,15,16,17] can only partially mitigate this deficit. Despite these efforts, the majority of species lacking reference sequences still come from the Mediterranean region, especially the eastern parts.
A striking example of the taxonomic, faunistic and molecular research gaps on Mediterranean Lepidoptera is Cyprus. As the third-largest island in the Mediterranean after Sicily and Sardinia, with over 9000 km2, Cyprus features a high diversity in habitats, ranging from partially still semi-natural coasts to significant elevations, such as the nearly 2000 m high Troodos Mountains in the south and the over 1000 m high Kyrenia Range in the north. It is therefore hardly surprising that Cyprus’s Lepidoptera fauna first attracted attention as early as the mid-19th century [18]. However, comprehensive studies remained the exception for nearly 100 years [19]. Only with the increasing travel activity of the European lepidopterological community towards the end of the 20th century did the understanding of the country’s fauna improve rapidly. In particular, Microlepidoptera have been covered in many recent publications [20,21,22,23,24,25,26]. In contrast, macro-lepidoptera, in the classical sense, have only been comprehensively published for specific groups in recent times, despite intensive but uncoordinated sampling efforts [27,28,29,30,31]. However, new descriptions or first country records are in general only scattered across several publications [32,33,34,35,36,37,38,39]. Furthermore, many unpublished data rest in various European collections or are at most available through online forums [13]. Although, according to Fauna Europaea, the island’s fauna comprises about 900 species [40], it can be inferred from the available data that the known fauna inventory likely contains around 1000 species. However, this cannot be determined precisely due to the lack of a comprehensive checklist.
Apart from these general knowledge gaps, the northern part of Cyprus, in particular, is considered largely a terra incognita due to the political division in 1974. It was therefore logical to focus especially on intensive sampling in this part of the country. A collaboration initiated in September 2023 between Near East University (Nicosia, North Cyprus) and the Tyrolean State Museums (Innsbruck, Austria) aims to address the described gaps by generating DNA barcodes for a representative portion of Lepidoptera from North Cyprus. This initiative will contribute to the expansion of European DNA barcode projects and help to address the aforementioned deficiencies.

2. Materials and Methods

Material was collected by PH at several sites in North Cyprus from the 6th to the 21st of September 2023. The surveys focused on the following locations (Figure 1):
  • Dipkarpaz, Ayios Phylon Beach, 28 m; sand dunes with predominant psammophytic vegetation (Figure 2).
  • Bafra/Vokolida, Thalassa Beach, 4–6 m; Mediterranean maquis, halophytic vegetation.
  • Ilgaz E, 240–280 m; Mediterranean maquis, pine forest.
  • Selvili tepe, 890 m; pine forest.
  • Hisarköy, 250 m; orchards, agricultural land.
The collecting efforts covered all Lepidoptera taxa except for butterflies, which have already been genetically studied on a continental scale [17]. The survey was based on various types of UV light traps, with only a few specimens collected at dawn, dusk, or during the day. Special focus was placed on microlepidoptera. Based on an initial macroscopic analysis in the field, a maximum of five specimens per morphospecies were collected. This material was euthanized immediately after sampling, pinned and spread, and subsequently dried for preservation purposes. The final sample selection was made after a more detailed analysis of morphological features, particularly wing markings and color, head characteristics, and occasionally also after examining genital morphology using an Olympus SZ12 stereomicroscope. A total of 344 specimens from 248 morphospecies were selected for genetic analysis, and tissue samples (dried legs) were prepared according to the described standards [41] and submitted to the designated cooperative laboratory. Material was finally processed at the Canadian Centre for DNA Barcoding (CCDB, Biodiversity Institute of Ontario, University of Guelph) using a standard high-throughput protocol [41]. Primer sets employed in amplification of COI barcode region (658 bp) are LepF1 (ATTCAACCAATCATAAAGATATTGG) and LepR1 (TAAACTTCTGATGTCC-AAAAAATCA) (https://boldsystems.org/index.php/Public_Primer_PrimerSearch (accessed on 15 September 2024). Details including complete voucher data and images can be accessed in the public dataset “Lepidoptera of northern Cyprus” dx.doi.org/10.5883/DS-LEPNCYPR in BOLD. Sequences were finally submitted to GenBank (accession numbers PQ525707–PQ526040).
All sequences were assigned to Barcode Index Numbers (BINs), algorithm-based operational taxonomic units that provide an accurate proxy for true species [42]. BINs were automatically generated for records in BOLD that comply with the DNA barcode standard. Species identification followed available reference sequences in BOLD, with a cross-check against external morphology. In cases where BINs were attributed to a single Linnaean name, these were accepted as correct, although potential misidentifications cannot be completely ruled out. For BINs covering more than one taxon in BOLD (due to BIN-sharing, misidentifications, or contaminations), identification was based on external morphology, and in critical cases, on genital morphology. However, some identification issues remained unresolved for a few taxa.
The accompanying map is based on OpenStreetMap WMS (Version 1.1.1) with layers TOPO-WMS, OSM-WMS, SRTM30-Colored-Hillshade.
Taxa in the individual subchapters are primarily sorted alphabetically by family for better clarity.

3. Results

3.1. Overview

Sequencing of 344 specimens resulted in 339 DNA barcode sequences. Full barcodes of 658 bp were recovered for 329 specimens, while for 10 specimens, sequences ranged from 457 to 654 bp. Sequencing failed for only five records. A total of 279 sequences were considered barcode-compliant according to BOLD standards. DNA barcode sequences could be assigned to 248 putative species belonging to 29 families, of which 200 species were assigned to a Linnaean species. However, 49 putative species could initially only be identified to the genus or family level (Table 1). A total of 336 sequences were assigned to 247 different BINs in BOLD, whereas no BIN is available for 3 sequences (see Table S1).

3.2. BIN Analysis—Taxa Identified to Species Level

3.2.1. Species Attached to BINs with Associated Linnean Names

After preliminary morphological identification and verification of the identification results using already available reference sequences or BINs in BOLD, 200 species could be unequivocally assigned to a valid name in the Linnaean system.
However, even within this group of seemingly indisputable species, there are potentially taxa still in need of revision, with striking and noteworthy intraspecific divergence that manifests in multiple BINs. Examples of this include Odites kollarella, Metacrambus carectellus, and Zeuzera pyrina, each showing significant geographic barcode variability, or Bryotropha hulli, Cydia fagiglandana, and Eublemma parva, with geographically unstructured divergence, where the latter two species even exhibit two BINs in samples from North Cyprus.

3.2.2. Taxa Matching BINs with Currently Unidentified Species in BOLD

Some of the morphologically unambiguously determinable species were already represented by a BIN in BOLD, but not taxonomically identified to the species level (Table 2).
Ascalenia pachnodes (Meyrick, 1917) (Cosmopterigidae)
Records: Cyprus, Iskele, Bafra/Vokolida, Thalassa Beach, 6 m, 35.33° N, 34.065° E, 6-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_38982; Cyprus, Iskele, Bafra/Vokolida, Thalassa Beach, 4 m, 35.331° N, 34.068° E, 8-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39052.
Remarks. In BOLD hitherto unnamed species with BIN members from Azerbaijan and Israel.
Parapoynx affinialis (Guenée, 1845) (Crambidae)
Records: Cyprus, Iskele, Bafra/Vokolida, Thalassa Beach, 6 m, 35.33° N, 34.065° E, 6-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_38955; Cyprus, Kyrenia/Girne, Hisarköy, 250 m, 35.303° N, 33.105° E, 13-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39190.
Remarks. New record for Cyprus (see below). In BOLD hitherto unnamed species with BIN members from Egypt and Iraq. Specimens from Australia identified as P. affinialis in BOLD cluster in a different BIN and most likely represent a separate species.
Earias syriacana Bartel, 1903 (Nolidae)
Record: Cyprus, Dipkarpaz, Ayios Phylon Beach, 28 m, 35.62° N, 34.37° E, 9-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39256.
Remarks. In BOLD hitherto unnamed species with BIN members from France, Ghana, Israel, Iran, United Arab Emirates, and Cyprus.
Agdistis cypriota Arenberger, 1983 (Pterophoridae)
Records: Cyprus, Iskele, Bafra/Vokolida, Thalassa Beach, 4 m, 35.331° N, 34.068° E, 8-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39025; Cyprus, Dipkarpaz, Ayios Phylon Beach, 28 m, 35.62° N, 34.37° E, 9-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39125; Cyprus, Kyrenia/Girne, Hisarköy, 250 m, 35.303° N, 33.105° E, 13-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39186.
Remarks. In BOLD hitherto unnamed species with BIN members from Egypt.
Eretmocera medinella (Staudinger, 1859) (Scythrididae)
Record: Cyprus, Iskele, Bafra/Vokolida, Thalassa Beach, 4 m, 35.331° N, 34.068° E, 8-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39026.
Remarks. In BOLD hitherto unnamed species with BIN members from Saudi Arabia, Egypt and Pakistan.
Scythris monochrella (Ragonot, 1895) (Scythrididae)
Record: Cyprus, Iskele, Bafra/Vokolida, Thalassa Beach, 6 m, 35.33° N, 34.065° E, 6-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_38953.
Remarks. In BOLD hitherto unnamed species with BIN members from Israel and Pakistan.

3.2.3. New BINs for BOLD Attached to Linnean Species Names

A total of 14 taxa with new BINs could be unambiguously identified to the species level from morphology (phenotype, partially dissection of genitalia) (Table 3). Metzneria artificella and Coleophora auroguttella were already present in BOLD under different BINs, but the Cypriot samples, which differ in their DNA barcode, belong to these species based on morphological examinations. This, therefore, expands the knowledge of intraspecific genetic variability.

3.3. BIN Analysis—Unidentified Species

3.3.1. Unidentified Species with New BINs—Potentially New Species

A total of 25 taxa with new BINs (Barcode Index Numbers) for BOLD have so far only been identified at the genus level, and in some cases only at the family level, and could not be confidently assigned to a specific species (Table 4). The reasons for this are primarily a lack of reliable revisionary work, and possibly, in some cases, knowledge gaps among the study authors, particularly in the families Tineidae and Pyralidae. However, it is very likely that several of these taxa represent undescribed species, for example, the description of a new Scrobipalpa species [43].

3.3.2. Unidentified Species Based on Alleged BIN Sharing

Few taxa with already available BINs in BOLD could not unequivocally be identified due to alleged BIN sharing of species. Such cases may reflect misidentifications in BOLD or alternatively also overlooked cryptic diversity.
Euchromius sp. (Crambidae)
BIN: BOLD:AAX8047 (n = 17). Record: Cyprus, Iskele, Bafra/Vokolida, Thalassa Beach, 4 m, 35.331° N, 34.068° E, 8-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39050.
Remarks. Sequences within this BIN in BOLD are attributed to Eucromius ramburiellus or to E. gratiosella.
Stomopteryx sp. (Gelechiidae)
BIN: BOLD:ADM8516 (n = 4). Records: Cyprus, Iskele, Bafra/Vokolida, Thalassa Beach, 6 m, 35.33° N, 34.065° E, 6-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_38984; Cyprus, Kyrenia/Girne, Yilgaz E, 280 m, 35.322° N, 33.227° E, 11-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39123, DNA Barcode ID TLMF_Lep_39130.
Remarks. A single sequence from Greece within this BIN in BOLD is attributed to Stomopteryx remissella. However, that species clusters in several BINs and requires taxonomic revision. Eventually, this is a further cryptic species.
Xestia sp. (Noctuidae)
BIN: BOLD:ACG4935 (n = 3). Record: Cyprus, Kyrenia/Girne, Ilgaz E, 280 m, 35.322° N, 33.227° E, 15-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39215.
Remarks. Sequences within this BIN in BOLD are attributed to Xestia xanthographa or to X. cohaesa. However, both taxa are also represented by other BINs, indicating likely misidentifications.
Nola sp. (Nolidae)
BIN: BOLD:AAL6474 (n = 24). Record: Cyprus, Kyrenia/Girne, Ilgaz E, 280 m, 35.322° N, 33.227° E, 11-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39258.
Remarks. Sequences within this BIN in BOLD are attributed to Nola subchlamydula or to N. chlamitulalis. However, both taxa are also represented by other BINs, indicating likely misidentifications.

3.4. New Faunistic Records

Despite the already extensive faunistic research on Cyprus, 23 species of Lepidoptera were recorded for the first time on the island during the initial investigation period of our research program (Table 5), and partially published separately [44]. New country records represent approximately 2.5% of the species inventory previously known from Cyprus and about 10% of the species identified in North Cyprus in September 2023. The new findings belong to 11 different families of so-called Microlepidoptera, with a dominance of Pyralidae (six species) and Gelechiidae (four species). However, among the relatively species-poor groups of Macrolepidoptera in the sampling area—with the exception of Spodoptera frugiperda—no new species records were found.
Bucculatrix zizyphella Chrétien, 1907 (Bucculatricidae)
Records: Cyprus, Iskele, Bafra/Vokolida, Thalassa Beach, 6 m, 35.33° N, 34.065° E, 6-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_38996; Cyprus, Iskele, Bafra/Vokolida, Thalassa Beach, 4 m, 35.331° N, 34.068° E, 8-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39065; Cyprus, Dipkarpaz, Ayios Phylon Beach, 28 m, 35.62° N, 34.37° E, 9-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39136.
Remarks. Known only from a few localities in Croatia, North Macedonia, Algeria, and the West Bank [13].
Choreutis sexfasciella (Sauber, 1902) (Choreutidae)
Records: Cyprus, Iskele, Bafra/Vokolida, Thalassa Beach, 6 m, 35.33° N, 34.065° E, 6-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39031, DNA Barcode ID TLMF_Lep_39032.
Remarks. Initially described from the Philippines, this species was recently recorded from Israel but so far not from Europe [45].
Coleophora auroguttella (Zeller, 1849) (Coleophoridae)
Record: Cyprus, Kyrenia/Girne, Hisarköy, 250 m, 35.303° N, 33.105° E, 13-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39199.
Remarks. Distributed from Spain across central and southern Europe, as well as Turkey, to East Asia [13].
*Coleophora bivittella Staudinger, 1879 (Coleophoridae)
Remarks: [44].
Cataonia erubescens (Christoph, 1877) (Crambidae)
Record: Cyprus, Iskele, Bafra/Vokolida, Thalassa Beach, 6 m, 35.33° N, 34.065° E, 6-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_38949.
Remarks. Isolated reports from Spain to Iran, but with large gaps in distribution [13].
Parapoynx affinialis (Guenée, 1845) (Crambidae)
Remarks: [44].
*Anarsia acaciae Walsingham, 1896 (Gelechiidae)
Remarks: [44].
*Ephysteris iberica Povolný, 1977 (Gelechiidae)
Remarks: [44].
Metzneria artificella (Herricfh-Schäffer, 1861) (Gelechiidae)
Record: Cyprus, Iskele, Bafra/Vokolida, Thalassa Beach, 6 m, 35.33° N, 34.065° E, 6-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_38965.
Remarks. Local occurrences from Spain to China, also reported from the Middle East (Lebanon, Israel) [13].
*Scrobipalpa geomicta (Meyrick, 1918) (Gelechiidae)
Remarks: [44].
Cupedia cupediella (Herrich-Schäffer, 1855) (Gracillariidae)
Record: Cyprus, Kyrenia/Girne, Hisarköy, 250 m, 35.303° N, 33.105° E, 13-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39203.
Remarks. Scattered records in the Mediterranean region, from Italy to Iran [13].
Parornix acuta Triberti, 1980 (Gracillariidae)
Record: Cyprus, Kyrenia/Girne, Hisarköy, 250 m, 35.303° N, 33.105° E, 13-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39200.
Remarks. Known so far only from Italy, North Macedonia, and Greece [13].
Spodoptera frugiperda (Smith, 1797) (Noctuidae)
Remarks: [44].
Callima mikkolai Lvovsky, 1995 (Oecophoridae)
Record: Cyprus, Kyrenia/Girne, Ilgaz E, 280 m, 35.322° N, 33.227° E, 11-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39129.
Remarks. Few records from the Iberian Peninsula, including the Canary Islands, Tunisia, and the Middle East [13].
*Stenoptilia aridus (Zeller, 1847) (Pterophoridae)
Remarks: [44].
Anyclodes pallens Ragonot, 1887 (Pyralidae)
Record: Cyprus, Kyrenia/Girne, Ilgaz E, 280 m, 35.322° N, 33.227° E, 11-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39160.
Remarks. Disjunct distribution with records from Spain and the United Kingdom, as well as from southern Russia through the Middle East to Iran [13].
Cadra abstersella (Zeller, 1847) (Pyralidae)
Record: Cyprus, Iskele, Bafra/Vokolida, Thalassa Beach, 6 m, 35.33° N, 34.065° E, 6-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_38960.
Cadra furcatella (Herrich-Schäffer, 1849) (Pyralidae)
Records: Cyprus, Kyrenia/Girne, Ilgaz E, 280 m, 35.322° N, 33.227° E, 11-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39110, DNA Barcode ID TLMF_Lep_39113, DNA Barcode ID TLMF_Lep_39158.
Remarks. Recorded from the Iberian Peninsula to Iran [13].
Stemmatophora syriacalis (Ragonot, 1895) (Pyralidae)
Record: Cyprus, Kyrenia/Girne, Ilgaz E, 280 m, 35.322° N, 33.227° E, 11-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39111.
Remarks. Disjunct range in southwestern Europe and from Turkey to Iran [13].
*Teliphasa lophotalis (Hampson, 1900) (Pyralidae)
Remarks: [44].
Zophodiodes leucocostella (Ragonot, 1895) (Pyralidae)
Record: Cyprus, Kyrenia/Girne, Ilgaz E, 280 m, 35.322° N, 33.227° E, 11-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39105.
Remarks. From southeastern Europe (Dodecanese, Crete) to Iran [13].
Aethes sanguinana (Treitschke, 1830) (Tortricidae)
Record: Cyprus, Kyrenia/Girne, Ilgaz E, 280 m, 35.322° N, 33.227° E, 11-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39103.
Remarks. Locally distributed from central and southern Europe to southern Russia and Turkey, with many suspected distribution gaps in the Balkans [13].
Pammene oxycedrana (Millière, 1876) (Tortricidae)
Record: Cyprus, Dipkarpaz, Ayios Philon Beach, 28 m, 35.62° N, 34.37° E, 9-IX-2023, leg. Huemer, DNA Barcode ID TLMF_Lep_39143.
Remarks. Disjunct range southern Europe, from France and Italy to Crimea [13].
*Cedestis civitatensis Nel & Varenne, 2015 (Yponomeutidae)
Remarks: [44].

4. Discussion

Since the broader implementation of DNA barcoding for eukaryotes, just over two decades have passed, a period that has been used, among other things, to create comprehensive DNA reference libraries [46]. Currently, the most important reference library by far, BOLD, holds nearly 19 million barcode sequences, covering approximately 260 K animal species [47]. Lepidoptera play a key role here, with sequencing of species inventories being well advanced, especially in Europe, North and Central America, as well as in Australia [1,2,3,4]. Europe, in particular, has taken on a pioneering role due to several national and group-specific DNA barcode initiatives [6,14,15,16,17]. The DNA barcode reference sequences obtained through these initiatives can be used for a wide range of applied topics as well as in basic research [48,49,50], but they require a high level of completeness.
Regional and taxonomic deficiencies are a significant hurdle for the practical applicability of DNA-based studies. Such gaps are still more often the rule than the exception in the Mediterranean region, as recently demonstrated by a localized survey of Lepidoptera in Greece [12]. This particularly concerns island faunas with a heightened degree of genetic isolation and accompanying endemism. Although Cyprus, which is being studied here for the first time, has a moderately diverse Lepidoptera fauna of about 1000 species, its location and topography give rise to many unique characteristics. The island’s proximity to countries in the Near and Middle East has facilitated the colonization of species from these regions, which are otherwise absent from Europe. However, current knowledge also suggests the presence of several endemic species.
Our study fully confirms the postulated deficits, even though 80% of the inventory could be reliably assigned to a Linnaean name, thanks to the high genetic–morphological congruence of the BIN system [14,51]. However, for 20% of the collected morphospecies, species identification was not possible using the available reference sequences alone (Figure 3). Two percent of the species inventory, with reference sequences already present in BOLD, were ultimately clarified using morphological criteria. Additionally, 6% of the species inventory were identified with new BINs, which were integrated into BOLD and are now available for future surveys. Despite these efforts, 12% of all species (29 spp.) remain undetermined for the time being, and the relevant sequences are limited in their utility.
Interestingly, the proportion of species that could not be immediately identified is nearly identical to a previous survey in Greece [12], which also initially found 20% of species undetermined. This underscores the urgent need for comprehensive genetic cataloging of species in the Mediterranean region and a significant reduction in gap species in Europe. The large number of taxonomically unresolved species should not be underestimated, as they can only be reliably addressed and sometimes renamed through extensive integrative revisions. As shown in Greece, the situation in Cyprus primarily involves representatives of species-rich microlepidopteran families that have not undergone recent comprehensive revisions.
In comparison to Cyprus, the success rate of species identification using DNA barcode reference sequences is significantly higher in Central and Northern European countries, with a maximum of 2–3% of species still posing challenges due to various reasons, such as barcode sharing or isolated cases of cryptic diversity [7,8,12,52,53,54].
Our study, with 24 new records for the island of Cyprus (2.5% of the recorded species)—similar to comparable surveys in other regions of Central and Southern Europe [8,52,53,54]—demonstrates the enormous potential of molecular-based species inventories for faunistic research. Many of these new records have rarely been reported from Europe, or, as in the case of Coleophora bivittella, Choreutis sexfasciella, and Teliphasa lophotalis, are even new findings for the continent.
Despite the enormous potential of DNA barcoding applications, particularly for assessing cryptic diversity, it is essential not to overlook the potential limitations of this method [6,55]. In many cases, genomic and/or morphological data are discordant with mtDNA genealogies, and barcoding may not always correctly identify species due to historical or ongoing hybridization and introgression, or in some cases, due to incomplete lineage sorting, pseudogenes, or Wolbachia infection [56,57,58,59]. Several studies have found that up to approximately 30% of taxa may not be monophyletic with respect to mtDNA [6,60,61,62]. Future faunal surveys and especially taxonomic revision work in Cyprus will need to take these issues into account. Therefore, integrative research approaches are essential for the planned further study of the island’s fauna.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/d16110671/s1, Table S1: Taxa information (Taxon, Sample ID (one per taxon), BIN, total sequences/BIN, Nearest species, Nearest BIN).

Author Contributions

Conceptualization, P.H.; Data curation, P.H.; Formal analysis, P.H.; Methodology, P.H. and Ö.Ö.; Writing—original draft, P.H. and Ö.Ö. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

All 339 COI sequences are available in DS-LEPNCYPR on BOLD (dx.doi.org/10.5883/DS-LEPNCYPR) at https://www.boldsystems.org/ (accessed on 24 September 2024).

Acknowledgments

The authors are most grateful to Paul Hebert and his team at the Centre for Biodiversity Genomics (Guelph, Canada), whose sequencing support and the BOLD informatics were enabled by funding from the Canada Foundation for Innovation, by Genome Canada through Ontario Genomics, and by the Tri-Council’s New Frontiers in Research Fund. Collecting permits were supplied by the Environmental Protection Department in Nicosia.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. deWaard, J.R.; Ratnasingham, S.; Zakharov, E.V.; Borisenko, A.V.; Steinke, D.; Telfer, A.C.; Perez, K.H.J.; Sones, J.E.; Young, M.R.; Levesque-Beaudin, V.; et al. A reference library for the identification of Canadian invertebrates: 1.5 million DNA barcodes, voucher specimens, and genomic samples. Sci. Data 2019, 6, 308. [Google Scholar] [CrossRef] [PubMed]
  2. Roslin, T.; Somervuo, P.; Pentinsaari, M.; Hebert, P.D.N.; Agda, J.; Ahlroth, P.; Anttonen, P.; Aspi, J.; Blagoev, G.; Blanco, S.; et al. A molecular-based identification resource for the arthropods of Finland. Mol. Ecol. Res. 2021, 22, 803–822. [Google Scholar] [CrossRef] [PubMed]
  3. Hebert, P.D.N.; deWaard, J.R.; Zakharov, E.V.; Prosser, S.W.J.; Sones, J.E.; McKeown, J.T.A.; Mantle, B.; La Salle, J. A DNA ‘Barcode Blitz’: Rapid Digitization and Sequencing of a Natural History Collection. PLoS ONE 2013, 8, e68535. [Google Scholar] [CrossRef] [PubMed]
  4. Janzen, D.H.; Hallwachs, W. DNA barcoding the Lepidoptera inventory of a large complex tropical conserved wildland, Area de Conservacion Guanacaste, northwestern Costa Rica. Genome 2016, 59, 641–660. [Google Scholar] [CrossRef] [PubMed]
  5. Ratnasingham, S.; Hebert, P.D.N. BOLD: The Barcode of Life Data System (www.barcodinglife.org). Mol. Ecol. Notes 2007, 7, 355–364. [Google Scholar] [CrossRef]
  6. Mutanen, M.; Kivelä, S.M.; Vos, R.A.; Doorenweerd, C.; Ratnasingham, S.; Hausmann, A.; Huemer, P.; Dinca, V.; Van Nieukerken, E.J.; Lopez-Vaamonde, C.; et al. Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. Syst. Biol. 2016, 65, 1024–1040. [Google Scholar] [CrossRef]
  7. Huemer, P.; Mutanen, M.; Sefc, K.M.; Hebert, P.D.N. Testing DNA Barcode Performance in 1000 Species of European Lepidoptera: Large Geographic Distances Have Small Genetic Impacts. PLoS ONE 2014, 9, e115774. [Google Scholar] [CrossRef]
  8. Huemer, P.; Wieser, C. DNA Barcode Library of Megadiverse Lepidoptera in an Alpine Nature Park (Italy) Reveals Unexpected Species Diversity. Diversity 2023, 15, 214. [Google Scholar] [CrossRef]
  9. Huemer, P.; Wieser, C.; Stark, W.; Hebert, P.D.N.; Wiesmair, B. DNA barcode library of megadiverse Austrian Noctuoidea (Lepidoptera)–A nearly perfect match of Linnean taxonomy. Biodiv. Data J. 2019, 7, e37734. [Google Scholar] [CrossRef]
  10. Hausmann, A.; Haszprunar, G.; Segerer, A.H.; Speidel, W.; Behounek, G.; Hebert, P.D.N. Now DNA barcoded: The butterflies and larger moths of Germany (Lepidoptera: Rhopalocera, Macroheterocera). Spixiana 2011, 34, 47–58. [Google Scholar]
  11. Schattanek-Wiesmair, B.; Huemer, P.; Wieser, C.; Stark, W.; Hausmann, A.; Koblmüller, S.; Sefc, K.M. A DNA barcode library of Austrian Geometridae (Lepidoptera) reveals high potential for DNA-based species identification. PLoS ONE 2024, 19, e0298025. [Google Scholar] [CrossRef] [PubMed]
  12. Huemer, P.; Mutanen, M. An Incomplete European Barcode Library Has a Strong Impact on the Identification Success of Lepidoptera from Greece. Diversity 2022, 14, 118. [Google Scholar] [CrossRef]
  13. Lepiforum: Website zur Bestimmung von Schmetterlingen (Lepidoptera) und ihren Präimaginalstadien. Available online: http://www.lepiforum.eu/bh/downloads/2021-iii-20/Lepiforums-Europaliste_Schmetterlinge_Version_8.3_Stand_2021_03_20 (accessed on 9 September 2024).
  14. Hausmann, A.; Godfray, H.C.J.; Huemer, P.; Mutanen, M.; Rougerie, R.; Nieukerken, E.J.; van Ratnasingham, S.; Hebert, P.D.N. Genetic Patterns in European Geometrid Moths Revealed by the Barcode Index Number (BIN) System. PLoS ONE 2013, 8, e84518. [Google Scholar] [CrossRef]
  15. Huemer, P.; Karsholt, O.; Aarvik, L.; Berggren, K.; Bidzilya, O.; Junnilainen, J.; Landry, J.-F.; Mutanen, M.; Nupponen, K.; Segerer, A.; et al. DNA barcode library for European Gelechiidae (Lepidoptera) suggests greatly underestimated species diversity. ZooKeys 2020, 921, 141–157. [Google Scholar] [CrossRef]
  16. Lopez-Vaamonde, C.; Kirichenko, N.; Cama, A.; Doorenweerd, C.; Godfray, H.C.J.; Guiguet, A.; Gomboc, S.; Huemer, P.; Landry, J.-F.; Laštůvka, A.; et al. Evaluating DNA Barcoding for Species Identification and Discovery in European Gracillariid Moths. Front. Ecol. Evol. 2021, 9, 626752. [Google Scholar] [CrossRef]
  17. Dinca, V.; Dapporto, L.; Somervuo, P.; Vodă, R.; Cuvelier, S.; Gascoigne-Pees, M.; Huemer, P.; Mutanen, M.; Hebert, P.D.N.; Vila, R. High resolution DNA barcode library for European butterflies reveals continental patterns of mitochondrial genetic diversity. Comm. Biol. 2021, 4, 315. [Google Scholar] [CrossRef]
  18. Lederer, J. Beitrag zur Schmetterlings-Fauna von Cypern, Beirut und einem Theile Kleinasiens. Verh. Zoo.-Bot. Ges. Wien 1855, 5, 177–254, pls. 1–5. [Google Scholar]
  19. Rebel, H. Zur Lepidopterenfauna Cyperns. Mitt. Münchn. Ent. Ges. 1939, 29, 487–564. [Google Scholar]
  20. Arenberger, E. Zusammenfassende Darstellung der Mikrolepidopterenfauna Zyperns. Ann. Mus. Goulandris 1994, 9, 253–336. [Google Scholar]
  21. Arenberger, E.; Wimmer, J. Erster Nachtrag zur Microlepidopterenfauna Zyperns. Nachr. Ent. Ver. Apollo 1996, 17, 209–224. [Google Scholar]
  22. Arenberger, E.; Wimmer, J. 2. Nachtrag zur Microlepidopterenfauna Zyperns. Z. ArbGem. Öster. Ent. 1999, 51, 41–46. [Google Scholar]
  23. Arenberger, E.; Wimmer, J. Dritter Nachtrag zur Microlepidopterenfauna Zyperns. Quadrifina 2003, 6, 43–54. [Google Scholar]
  24. Gozmány, L. The Lepidoptera of Greece and Cyprus. Fauna Graecia IX; Hellenic Zoological Society: Athens, Greece, 2012; Volume 1. [Google Scholar]
  25. Barton, I. Contribution to the Microlepidopteran fauna of Cyprus. Entomol. Rec. J. Var. 2015, 127, 157–167. [Google Scholar]
  26. Barton, I. Second contribution to the Lepidoptera fauna of Cyprus, presenting records of 48 taxa from 17 families. Entomol. Rec. J. Var. 2018, 130, 29–39. [Google Scholar]
  27. Hacker, H. 4. Übersicht über die auf Zypern bisher festgestellten Noctuidae-Arten. In: Ergänzungen zu "Die Noctuidae Vorderasiens" und neue Forschungsergebnisse zur Fauna der Türkei II (Lepidoptera). Esperiana 1996, 4, 273–330. [Google Scholar]
  28. Lewandowski, S.; Fischer, H. Check-Liste der Noctuidae von Zypern (Lepidoptera, Noctuidae). Atalanta Würzburg 2004, 35, 119–126. [Google Scholar]
  29. Fischer, H.; Lewandowski, S. Aktualisierte Checkliste der Geometridenarten von Zypern inkl. Der wichtigsten Literaturangaben zu dieser Familie (Lepidoptera, Geometridae). Atalanta Würzburg 2010, 41, 265–269. [Google Scholar]
  30. Weidlich, M. Die Psychidenfauna der Republik Zypern (Lepidoptera: Psychidae). Contr. Ent. 2015, 65, 113–124. [Google Scholar] [CrossRef]
  31. John, E.; Makris, C. Field Guide to the Butterflies of Cyprus with Distribution Maps; Siri Scientific Press: Rochdale, UK, 2023. [Google Scholar]
  32. Wiltshire, E.P. Middle East Lepidoptera, IX: Two new forms or species and thirty-five new records from Cyprus. Entomol. Rec. J. Var. 1948, 60, 79–87. [Google Scholar]
  33. Wiltshire, E.P. Some more new records of Lepidoptera from Cyprus, Iraq and Persia (Iran). Entomol. Rec. J. Var. 1949, 61, 73–76. [Google Scholar]
  34. Wiltshire, E.P. Further new records of Lepidoptera from Cyprus, Iraq and Persia (Iran). Entomol. Rec. J. Var. 1951, 63 (Suppl. S10), 1–6. [Google Scholar]
  35. Malicky, H. Faunistische Meldungen von Lepidopteren aus Griechenland und Zypern. Esperiana 1992, 3, 391–407. [Google Scholar]
  36. Ahola, M. Noctuoidea (Lepidoptera) from Cyprus with descriptions of larvae of some species. Ent. Fenn. 1988, 9, 19–36. [Google Scholar] [CrossRef]
  37. Fibiger, M. New noctuid moths from Cyprus with winter appearance (Lepidoptera, Noctuidae). Ent. Meddl. 1997, 65, 17–27. [Google Scholar]
  38. Fibiger, M.; Nilson, D.; Svendsen, P. Contribution to the Noctuidae fauna of Cyprus, with descriptions of four new species, six new subspecies, and reports of 55 species not previously found on Cyprus (Lepidoptera, Noctuidae). Esperiana 1999, 7, 639–667, pls. 24–25. [Google Scholar]
  39. Can Doğanlar, F.; Arap, N. On the geometrid moths (Lepidoptera) of northern Cyprus, including three new records. Zool. Middle East 2005, 35, 79–86. [Google Scholar] [CrossRef]
  40. Karsholt, O.; van Nieukerken, E.J. Lepidoptera, Moths. Fauna Europaea 2013, Version 2021.12. Available online: https://fauna-eu.org (accessed on 20 September 2024).
  41. deWaard, J.R.; Ivanova, N.V.; Hajibabaei, M.; Hebert, P.D.N. Assembling DNA Barcodes: Analytical Protocols; Martin, C.C., Ed.; Methods in Molecular Biology: Environmental Genomics; Humana Press Inc.: Totowa, NJ, USA, 2008; pp. 275–293. [Google Scholar]
  42. Ratnasingham, S.; Hebert, P.D.N. A DNA-based registry for all animal species: The Barcode Index Number (BIN) System. PLoS ONE 2013, 8, e66213. [Google Scholar] [CrossRef]
  43. Huemer, P.; Özden, Ö. Scrobipalpa chardonnayi Huemer and Özden, sp. nov.: A new presumably endemic species from Cyprus (Lepidoptera, Gelechiidae). Zootaxa 2024, 5523, 437–447. [Google Scholar] [CrossRef]
  44. Huemer, P.; Özden, Ö. Molecular identification of newly recorded Lepidoptera for Cyprus and Europe (Insecta: Lepidoptera). SHIL. Rev. Lepidopterol. 2024, in press. [Google Scholar]
  45. Rittner, O. The first documented report of metalmark moths (Lepidoptera: Choreutidae) in Israel, with the first record of Oriental Choreutis sexfasciella (Sauber) in the Palearctic. Israel J. Ent. 2019, 49, 63–67. [Google Scholar] [CrossRef]
  46. Hebert, P.D.N.; Cywinska, A.; Ball, S.L.; deWaard, J.R. Biological identifications through DNA barcodes. Proc. Biol. Soc. 2003, 270, 313–321. [Google Scholar] [CrossRef] [PubMed]
  47. Ratnasingham, S. BOLD Barcode of Life Data System, Version 4, 2018. Available online: http://www.boldsystems.org (accessed on 20 September 2024).
  48. Cristescu, M.E. From barcoding single individuals to metabarcoding biological communities: Towards an integrative approach to the study of global biodiversity. Trends Ecol. Evol. 2014, 29, 566–571. [Google Scholar] [CrossRef] [PubMed]
  49. Ruppert, K.M.; Kline, R.J.; Rahman, M.S. Past, present, and future perspectives of environmental DNA (eDNA) metabarcoding: A systematic review in methods, monitoring, and applications of global eDNA. Global Ecol. Cons. 2019, 17, e00547. [Google Scholar] [CrossRef]
  50. Dapporto, L.; Menchetti, M.; Dincă, V.; Talavera, G.; Garcia-Berro, A.; d’Ercole, J.; Hebert, P.D.N.; Vila, R. The genetic legacy of the Quaternary ice ages for West Palearctic butterflies. Sci. Adv. 2024, 10, eadm8596. [Google Scholar] [CrossRef] [PubMed]
  51. Ortiz, A.S.; Rubio, R.M.; Guerrero, J.J.; Garre, M.J.; Serrano, J.; Hebert, P.D.N.; Hausmann, A. Close congruence between Barcode Index Numbers (Bins) and species boundaries in the Erebidae (Lepidoptera: Noctuoidea) of the Iberian Peninsula. Biodiv. Data J. 2017, 5, e19840. [Google Scholar] [CrossRef]
  52. Huemer, P.; Hebert, P.D.N. DNA-Barcoding der Schmetterlinge (Lepidoptera) Vorarlbergs (Österreich)-Erkenntnisse und Rückschlüsse. Inatura Forsch. Online 2015, 15, 1–36. [Google Scholar]
  53. Huemer, P.; Hebert, P.D.N. DNA Barcode Bibliothek der Schmetterlinge Südtirols und Tirols (Italien, Österreich)–Impetus für integrative Artdifferenzierung im 21. Jahrhundert. Gredleriana 2016, 16, 141–164. [Google Scholar]
  54. Huemer, P. DNA-based faunistics–exemplified by surveys of Lepidoptera in Greece. Entomol. Rec. J. Var. 2024, 136, 27–35. [Google Scholar]
  55. Dincă, V.; Montagud, S.; Talavera, G.; Hernández-Roldán, J.; Munguira, M.L.; García-Barros, E.; Hebert, P.D.N.; Vila, R. DNA barcode reference library for Iberian butterflies enables a continental-scale preview of potential cryptic diversity. Scie. Rep. 2015, 5, 12395. [Google Scholar] [CrossRef]
  56. Leite, L.A.R. Mitochondrial pseudogenes in insect DNA barcoding: Differing points of view on the same issue. Biota Neotrop. 2012, 12, 301–308. [Google Scholar] [CrossRef]
  57. Dincă, V.; Lee, K.M.; Vila, R.; Mutanen, M. The conundrum of species delimitation: A genomic perspective on a mitogenetically super-variable butterfly. Proc. R. Soc. Lond. B Biol. Sci. 2019, 286, 20191311. [Google Scholar] [CrossRef] [PubMed]
  58. Bocek, M.; Motyka, M.; Kusy, D.; Bocak, L. Genomic and Mitochondrial Data Identify Different Species Boundaries in Aposematically Polymorphic Eniclases Net-Winged Beetles (Coleoptera: Lycidae). Insects 2019, 10, 295. [Google Scholar] [CrossRef] [PubMed]
  59. DeRaad, D.A.; McCormack, J.E.; Chen, N.; Peterson, A.T.; Moyle, R.G. Combining Species Delimitation, Species Trees, and Tests for Gene Flow Clarifies Complex Speciation in Scrub-Jays. Syst. Biol. 2022, 71, 1453–1470. [Google Scholar] [CrossRef] [PubMed]
  60. Duran, D.P.; Laroche, R.A.; Roman, S.J.; Godwin, W.; Herrmann, D.P.; Bull, E.; Egan, S.P. Species delimitation, discovery and conservation in a tiger beetle species complex despite discordant genetic data. Sci. Rep. 2024, 14, 6617. [Google Scholar] [CrossRef] [PubMed]
  61. Funk, D.J.; Omland, K.E. Species-Level Paraphyly and Polyphyly: Frequency, Causes, and Consequences, with Insights from Animal Mitochondrial DNA. Annu. Rev. Ecol. Evol. Syst. 2003, 34, 397–423. [Google Scholar] [CrossRef]
  62. Joshi, M.; Espeland, M.; Huemer, P.; deWaard, J.; Mutanen, M. Species delimitation under allopatry: Genomic insights within and across continents in Lepidoptera. Insect Syst. Diver. 2024, 8, 7. [Google Scholar] [CrossRef]
Figure 1. Sampling localities in North Cyprus (1 = Dipkarpaz; 2 = Bafra/Vokolida; 3 = Ilgaz; 4 = Selvili tepe; 5 = Hisarköy). Copyrights: OpenStreetMap contributors (http://www.openstreetmap.org/copyright (accessed on 20 September 2024); SRTM 30 m by NASA EOSDIS Land Processes Distributed Active Archive Center (LP DAAC, https://lpdaac.usgs.gov/ (accessed on 20 September 2024).
Figure 1. Sampling localities in North Cyprus (1 = Dipkarpaz; 2 = Bafra/Vokolida; 3 = Ilgaz; 4 = Selvili tepe; 5 = Hisarköy). Copyrights: OpenStreetMap contributors (http://www.openstreetmap.org/copyright (accessed on 20 September 2024); SRTM 30 m by NASA EOSDIS Land Processes Distributed Active Archive Center (LP DAAC, https://lpdaac.usgs.gov/ (accessed on 20 September 2024).
Diversity 16 00671 g001
Figure 2. Largely unspoiled sand dunes near Dipkarpaz.
Figure 2. Largely unspoiled sand dunes near Dipkarpaz.
Diversity 16 00671 g002
Figure 3. Identification success based on BIN system (numbers refer to species).
Figure 3. Identification success based on BIN system (numbers refer to species).
Diversity 16 00671 g003
Table 1. Taxa per family (n = total number of putative species; nL = number of species attached to a Linnean name; nu = number of unidentified species).
Table 1. Taxa per family (n = total number of putative species; nL = number of species attached to a Linnean name; nu = number of unidentified species).
FamilynnLnu
Autostichidae422
Bedelliidae110
Blastobasidae303
Bucculatricidae211
Choreutidae110
Coleophoridae752
Cosmopterigidae541
Cossidae220
Crambidae23212
Depressariidae550
Erebidae15132
Gelechiidae433310
Geometridae22220
Gracillariidae532
Lecithoceridae110
Nepticulidae330
Noctuidae25232
Nolidae211
Notodontidae110
Oecophoridae220
Plutellidae110
Pterophoridae660
Pyralidae382711
Scythrididae330
Sphingidae220
Tineidae1139
Tortricidae12111
Yponomeutidae220
Ypsolophidae110
total24820049
Table 2. BINs in BOLD firstly attached to species level (n = number of BIN members).
Table 2. BINs in BOLD firstly attached to species level (n = number of BIN members).
BINnFamilyTaxon
BOLD:ADI52328CosmopterigidaeAscalenia pachnodes
BOLD:AAI24965CrambidaeParapoynx affinialis
BOLD:ABV211712NolidaeEarias syriacana
BOLD:ACO52585PterophoridaeAgdistis cypriota
BOLD:ACS043122ScythrididaeEretmocera medinella
BOLD:ADZ87926ScythrididaeScythris monochreella
Table 3. New BINs for BOLD identified to species level (n = number of new BIN members).
Table 3. New BINs for BOLD identified to species level (n = number of new BIN members).
New BINTaxonn
BOLD:AFN2738Ethmia distigmatella1
BOLD:AFN3576Metzneria artificella1
BOLD:AFN6724Aethes sanguinana1
BOLD:AFN8538Stemmatophora syriacalis1
BOLD:AFO1355Selidosema tamsi1
BOLD:AFO3946Coleophora auroguttella1
BOLD:AFO8360Charadraula parcella1
BOLD:AFO8760Cataonia erubescens1
BOLD:AFP0124Agdistis nigra2
BOLD:AFP0608Paropta l-nigrum1
BOLD:AFP2465Wegneria panchalcella1
BOLD:AFP2969Batia hilszczanskii1
BOLD:AFP8090Metasia rosealis4
BOLD:AFW7836Altenia mersinella1
Table 4. New BINs for BOLD (n = number of new BIN members).
Table 4. New BINs for BOLD (n = number of new BIN members).
New BINTaxonnNearest BINNearestTaxon
BOLD:AFN4060Epidola2BOLD:AEA1515Gelechiidae
BOLD:AFN5947Pragmatodes3BOLD:ACG2243Elachista
BOLD:AFN8036Scrobipalpa3BOLD:ABA3381Scrobipalpa vasconiella
BOLD:AFN8075Caradrina1BOLD:ABZ7109Caradrina selini
BOLD:AFN8455Hapsifera2BOLD:AEI7400Hapsifera luridella
BOLD:AFN9022Bryotropha1BOLD:AAD3661Bryotropha senectella
BOLD:AFN9290Assara1BOLD:ADR6757Assara conicolella
BOLD:AFO3293Ephestia1BOLD:ADC7878Ephestia
BOLD:AFO4840Ancylolomia2BOLD:ACA9335Ancylolomia pectinatellus
BOLD:AFO5720Cupedia1BOLD:ABV8138Cupedia sp. Croatia
BOLD:AFO6568Tineidae1BOLD:AAH5443Elatobia
BOLD:AFO6731Edosa1BOLD:AAX9697Edosa fuscoviolacella
BOLD:AFO7408Neurothaumasia1BOLD:AEI9677Neurothaumasia
BOLD:AFO7793Tineidae2BOLD:AEH5539Tineidae
BOLD:AFO8727Pyralidae2BOLD:AAD9851Ptyobathra atrisquamella
BOLD:AFO8943Pyralidae1BOLD:ADG5246Erebidae
BOLD:AFO8945Pyralidae1BOLD:AEC8662Gymnancyla canella
BOLD:AFP2798Euzophera1BOLD:AAJ0516Euzophera cinerosella
BOLD:AFP4538Aproaerema1BOLD:ADG7311Aproaerema
BOLD:AFP6311Epischnia2BOLD:ADR7630Epischnia cretaciella
BOLD:AFP6485Ornativalva1BOLD:ABW9166Ornativalva plutelliformis
BOLD:AFP6531Dysspastus1BOLD:ADM3660Dysspastus
BOLD:AFP7272Tineidae1BOLD:AFM0593Tineidae
BOLD:AFP8924Tecmerium2BOLD:AEI5321Tecmerium perplexum
BOLD:AFP9332Coleophora2BOLD:AAE8786Coleophora dianthi
Table 5. New faunistic records for Cyprus. * species published separately [44].
Table 5. New faunistic records for Cyprus. * species published separately [44].
TaxonFamily
Bucculatrix zizyphella Chrétien, 1907Bucculatricidae
Choreutis sexfasciella (Sauber, 1902)Choreutidae
Coleophora auroguttella (Zeller, 1849)Coleophoridae
Coleophora bivittella Staudinger, 1879Coleophoridae
Cataonia erubescens (Christoph, 1877)Crambidae
Parapoynx affinialis (Guenée, 1854)Crambidae
Stenoptilia aridus (Zeller, 1847) *Pterophoridae
Anarsia acaciae Walsingham, 1896Gelechiidae
Ephysteris iberica Povolný, 1977 *Gelechiidae
Metzneria artificella (Herrich-Schäffer, 1861)Gelechiidae
Scrobipalpa geomicta (Meyrick, 1918) *Gelechiidae
Cupedia cupediella (Herrich-Schäffer, 1855)Gracillariidae
Parornix acuta Triberti, 1980Gracillariidae
Spodoptera frugiperda (Smith, 1797)Noctuidae
Callima mikkolai Lvovsky, 1995Oecophoridae
Ancylodes pallens Ragonot, 1887Pyralidae
Cadra abstersella (Zeller, 1847)Pyralidae
Cadra furcatella (Herrich-Schäffer, 1849)Pyralidae
Stemmatophora syriacalis (Ragonot, 1895)Pyralidae
Teliphasa lophotalis (Hampson, 1900) *Pyralidae
Zophodiodes leucocostella Ragonot, 1887Pyralidae
Aethes sanguinana (Treitschke, 1830)Tortricidae
Pammene oxycedrana (Millière, 1876)Tortricidae
Cedestis civitatensis Nel & Varenne, 2015 *Yponomeutidae
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Huemer, P.; Özden, Ö. First Attempts at DNA Barcoding Lepidoptera in North Cyprus Reveal Unexpected Complexities in Taxonomic and Faunistic Issues. Diversity 2024, 16, 671. https://doi.org/10.3390/d16110671

AMA Style

Huemer P, Özden Ö. First Attempts at DNA Barcoding Lepidoptera in North Cyprus Reveal Unexpected Complexities in Taxonomic and Faunistic Issues. Diversity. 2024; 16(11):671. https://doi.org/10.3390/d16110671

Chicago/Turabian Style

Huemer, Peter, and Özge Özden. 2024. "First Attempts at DNA Barcoding Lepidoptera in North Cyprus Reveal Unexpected Complexities in Taxonomic and Faunistic Issues" Diversity 16, no. 11: 671. https://doi.org/10.3390/d16110671

APA Style

Huemer, P., & Özden, Ö. (2024). First Attempts at DNA Barcoding Lepidoptera in North Cyprus Reveal Unexpected Complexities in Taxonomic and Faunistic Issues. Diversity, 16(11), 671. https://doi.org/10.3390/d16110671

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop